Neuro-Oncology Advances 1 3(1), 1–12, 2021 | doi:10.1093/noajnl/vdab061 | Advance Access date 19 April 2021 Characteristics of diffuse hemispheric gliomas, H3 G34-mutant in adults    Thiébaud Picart , Marc Barritault , Delphine Poncet, Lise-Prune Berner , Cristina Izquierdo, Emeline Tabouret , Dominique Figarella-Branger , Ahmed Idbaïh , Franck Bielle , Véronique Bourg, Fanny Burel Vandenbos , Elizabeth Cohen-Jonathan Moyal , Emmanelle Uro-Coste , Jacques Guyotat, Jérôme Honnorat, Mathieu Gabut , David Meyronet , and François Ducray Department of Neurosurgery, Hôpital Neurologique Pierre Wertheimer, Hospices Civils de Lyon, Bron, France (T.P., J.G.); Cancer Initiation and Tumoral Cell Identity Department, Cancer Research Centre of Lyon (CRCL) INSERM 1052, CNRS 5286, Lyon, France (T.P., M.B., M.G., D.M., F.D.); University Claude Bernard Lyon I, Villeurbanne, France (T.P., M.B., D.P., J.H., M.G., D.M., F.D.); Department of Molecular Biology, Groupe Hospitalier Est, Hospices Civils de Lyon, Bron, France (M.B., D.P.); INSERM 1052, CNRS 5286, Signaling, metabolism and tumor progression Centre Léon Bérard, Centre de Recherche en Cancérologie de Lyon, Lyon Cedex 08, France (D.P.); Department of Neuroradiology, Hôpital Neurologique Pierre Wertheimer, Hospices Civils de Lyon, Bron, France (L.P.B.); Department of Neurooncology, Hôpital Neurologique Pierre Wertheimer, Hospices Civils de Lyon, Bron, France (C.I., J.H., F.D.); Department of Neuroscience Hospital Universitari Germans Trias i Pujol, Universitat Autònoma de Barcelona, Barcelona Spain (C.I.); Department of Neurooncology, AP-HM, Hôpital de la Timone, Marseille, France (E.T.); Aix-Marseille University, CNRS UMR 7051, Institut de Neurophysiopathologie, Marseille, France (E.T.); Aix- Marseille Univ, APHM, CNRS, INP, Inst Neurophysiopathol, CHU Timone, Service d’Anatomie Pathologique et de Neuropathologie, Marseille, France (D.F.B.); Sorbonne Université, Inserm, CNRS, UMR S 1127, Institut du Cerveau et de la Moelle épinière, ICM, AP-HP, Hôpitaux Universitaires La Pitié Salpêtrière - Charles Foix, Service de Neurologie 2-Mazarin, Paris, France (A.I.); Department of Neuropathology, AP-HP, Hôpitaux Universitaires La Pitié Salpêtrière - Charles Foix, Paris, France (F.B.); Sorbonne University, Inserm U1127, CNRS, UMR 7225, Université Paris 06 4 Place Jussieu, Paris, France (F.B.); Department of Neurology, Hôpital Pasteur, Nice, France (V.B.); Department of Neuropathology, Hôpital Pasteur, Nice, France (F.B.V.); Université Côte D’Azur, CNRS, INSERM, Institut de Biologie Valrose, Nice, France (F.B.V.); Department of Radiation Oncology, Institut Claudius Regaud/Institut Universitaire du Cancer de Toulouse – Oncopôle, Toulouse, France (E.C.J.M.); Centre de Recherches contre le Cancer de Toulouse, INSERM U1037, Toulouse, France (E.C.J.M., E.U.C.); Department of Pathology, CHU Toulouse, Institut Universitaire du Cancer-Oncopole, Toulouse, France (E.U.C.); Institut NeuroMyoGène – Equipe Synaptopathies et autoanticorps, INSERM U1217 / UMR CNRS 5310, Lyon, France (J.H.); Department of Pathology and Neuropathology, Groupe Hospitalier Est, Hospices Civils de Lyon, Bron, France (D.M.) Corresponding Author: François Ducray, MD, PhD, Department of Neurooncology, Hôpital Neurologique Pierre Wertheimer, Hospices Civils de Lyon, 59 boulevard Pinel, 69677 Bron, France (francois.ducray@chu-lyon.fr). Abstract Background. Diffuse hemispheric gliomas, H3 G34-mutant (DHG H3G34-mutant) constitute a distinct type of ag- gressive brain tumors. Although initially described in children, they can also affect adults. The aims of this study were to describe the characteristics of DHG H3G34-mutant in adults and to compare them to those of established types of adult WHO grade IV gliomas. Methods. The characteristics of 17 adult DHG H3G34-mutant, 32 H3.3 K27M-mutant diffuse midline gliomas (DMG), 100 IDH-wildtype, and 36 IDH-mutant glioblastomas were retrospectively analyzed. Results. Median age at diagnosis in adult DHG H3G34-mutant was 25 years (range: 19–33). All tumors were hem- ispheric. For 9 patients (56%), absent or faint contrast enhancement initially suggested another diagnosis than a high-grade glioma, and diffusion-weighted imaging seemed retrospectively more helpful to suspect an aggressive tumor than MR-spectroscopy and perfusion MRI. All cases were IDH-wildtype. Most cases were immunonegative for ATRX (93%) and Olig2 (100%) and exhibited MGMT promoter methylation (82%). The clinical and radiolog- ical presentations of adult DHG H3G34-mutant were different from those of established types of adult grade IV © The Author(s) 2021. Published by Oxford University Press, the Society for Neuro-Oncology and the European Association of Neuro-Oncology. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. 2 Picart et al. Diffuse hemispheric gliomas, H3 G34-mutant in adults gliomas. Median overall survival of adult DHG H3G34-mutant was 12.4 months compared to 19.6 months (P = .56), 11.7 months (P = .45), and 50.5 months (P = .006) in H3.3 K27M-mutant DMG, IDH-wildtype, and IDH-mutant glioblastomas, respectively. Conclusions. Adult DHG H3G34-mutant are associated with distinct characteristics compared to those of es- tablished types of adult WHO grade IV gliomas. This study supports considering these tumors as a new type of WHO grade IV glioma in future classifications. Key Points • Adult diffuse gliomas G34-mutant display a misleading radiological presentation. • Adult diffuse gliomas G34-mutant differ from other grade IV gliomas. • Adult diffuse gliomas G34-mutant have a poor outcome. Importance of the Study In future classifications, diffuse gliomas H3 that adult diffuse hemispheric gliomas, H3 G34-mutant will be considered as a new WHO G34-mutant frequently display a misleading grade IV tumor type. Since the median age radiological presentation that can lead to at diagnosis in diffuse hemispheric gliomas, a potentially detrimental diagnostic delay. H3 G34-mutant is around 20 years, half of Although these gliomas have a poor prog- the patients are followed by adult neuro- nosis, similar to that of H3.3 K27M-mutant oncologists. This study provides a detailed diffuse midline gliomas and IDH-wildtype analysis of clinical, radiological, and survival glioblastomas, they display distinct charac- of a series of 17 adult diffuse hemispheric teristics compared to established types of gliomas, H3 G34-mutant. The results highlight WHO grade IV adult gliomas. Recurrent somatic gain-of-function mutations in the genes Official WHO) indeed recommended to consider H3.3 G34- encoding the histone H3 variants H3.3 and H3.1 are encoun- mutant diffuse gliomas as a new WHO grade IV tumor type tered in and characterize 2 different types of high-grade that should be referred to as “Diffuse hemispheric glioma, gliomas that have initially been described in the pediatric H3.3 G34-mutant” and the grade will be given in arabic.13 population but can also affect adults.1–4 Lysine to methionine In the fifth edition of the CNS WHO classification, which is substitution at codon 27 in the H3F3A or in the HIST1H3B/C in progress, the suggested name is consequently “Diffuse genes (H3.3 K27M mutation) are associated with aggressive hemispheric glioma, H3G34-mutant,” grade 4. Since the diffuse midline gliomas and define “Diffuse midline glioma, median age at diagnosis in diffuse hemispheric gliomas, H3.3 K27M-mutant” which corresponds to grade IV in the re- H3 G34-mutant is around 18–19 years, half of the patients vised 2016 World Health Organization (WHO) classification.5 are followed by adult neuro-oncologists.3,4,6,10 Yet, the char- In contrast, glycine to arginine or valine substitutions at acteristics and the outcome of adult diffuse hemispheric codon 34 in the H3F3A gene (H3.3 G34 mutation) are asso- gliomas, H3 G34-mutant remain to be fully described.14–16 ciated with non-midline hemispheric high-grade gliomas.6–8 Consequently, the aim of this study was to report the char- H3.3 K27M and H3.3 G34 mutations are mutually exclusive acteristics of diffuse hemispheric gliomas, H3 G34-mutant and exclusive with IDH mutations.1,9,10 H3.3 G34 mutations in adults and compare them to those of established types are about twice less frequent than H3.3 K27M mutations. of adult WHO grade IV gliomas. They are encountered in less than 1% of all gliomas but in 15% of high-grade gliomas in adolescents and young adults.7,11,12 In the 2016 WHO classification, H3.3 G34-mutant diffuse gliomas were not considered as a distinct tumor type and Material and Methods most cases are currently classified as IDH-wildtype glio- Patient Identification blastomas.5 However, in future classifications, H3.3 G34- mutant diffuse gliomas will be individualized. In its sixth Adult patients (≥18-year-old) diagnosed with diffuse hemi- update, cIMPACT-NOW (the consortium to Inform Molecular spheric glioma, H3 G34-mutant were retrospectively iden- and Practical Approaches to CNS Tumor Taxonomy—Not tified in 5 French University Hospitals (Lyon, Marseille, Picart et al. Diffuse hemispheric gliomas, H3 G34-mutant in adults 3 Advances Neuro-Oncology Nice, Paris, and Toulouse) between January 2012 and May Standard Protocol Approvals and Registrations 2018. Their clinical, radiological, histological, and molec- ular characteristics were retrospectively reviewed. Study design and manuscript organization were guided by The characteristics of adult diffuse hemispheric gliomas, the STROBE statement on cohort studies. The study was H3 G34-mutant were compared to those of retrospective approved by the Institutional Review Board (local number contemporaneous series of H3.3 K27M-mutant diffuse 19–113). Informed consents were obtained from alive midline gliomas (DMG), IDH-wildtype, and IDH-mutant patients. glioblastomas diagnosed in Lyon University Hospital ac- cording to the revised WHO 2016 classification. The in- clusion criteria were the following: (1) age ≥ 18 years, (2) available MRI for radiological review, (3) and avail- Results able TERT promoter mutation status for IDH-wildtype Patients and Tumor Characteristics glioblastomas. Brain MRI scans were independently reviewed by 3 in- A total of 17 adult patients diagnosed with a diffuse hem- vestigators (T.P., C.I., and L.P.B.) for the location of T2/fluid- ispheric glioma, H3 G34-mutant were retrospectively attenuated inversion recovery (FLAIR) hyperintensity, identified. Their characteristics are summarized in Table 1. the presence and type (fainted, nodular, or ring-like) of Median age at diagnosis was 25 years (range: 19–33). Most parenchymal contrast enhancement, the presence of ap- patients were aged ≤ 30 years (n = 13, 76%). Clinical pres- parent diffusion coefficient (ADC) restriction, as well as entation consisted of epileptic seizure (n = 9, 53%), focal abnormalities on proton magnetic resonance spectros- deficit (n = 5, 29%), and acute intracranial hypertension copy (1H-MRS) and, dynamic contrast-enhanced per- (n = 3, 18%) that was imputable to a massive tumor hemor- fusion MRI. For patients with available MRI follow-up, rhage in 2 patients (12%). tumor progression was defined according to RANO Histologically, all cases presented as a diffusely criteria.17 infiltrating high-grade glioma. Mitotic activity was ob- served in all cases, and microvascular proliferation and/ or necrosis in all but one case (94%). All cases were IDH- Molecular Analysis wildtype (17/17). According to the 2016 WHO classification, DNA was extracted from formalin-fixed paraffin-embedded one case was diagnosed as an IDH-wildtype anaplastic samples using a standard protocol (QIAmp DNA mini astrocytoma and 16 as IDH-wildtype glioblastomas. Kit, Qiagen). After PCR amplification, the mutations of Among the latter cases, 8 tumors displayed a PNET-like codon 132 of IDH1, codon 172 of IDH2, codons 27 and 34 morphology (50%), 4 displayed an undifferentiated mor- of H3F3A, codon 28 of HIST1H3B, codon 600 of BRAF, as phology (25%), 3 contained multinucleated giant cells well as mutational hotspots C228 and C250 of the TERT (19%), and 1 displayed an oligodendroglial appearance promoter were investigated by single-nucleotide primer (6%). These features are illustrated in Figure 1. Median Ki67 extension with the ABI PRISM SNaPshot Multiplex kit, labeling was 42% (range: 15–95%). Olig2 immunostaining Applied Biosystems.18 was completely negative in 13/16 cases (81%) and focally MGMT promoter methylation was assessed by positive in 3/16 cases (19%). In these cases, however, pyrosequencing, which was performed using the Olig2 positivity corresponded to reactive glial cells and PyroMark Q96 MGMT kit (Qiagen) on a PSQTM96 MA after review they were finally considered as negative. TP53 system (Biotage).19 EGFR gene amplification was de- staining was positive (>10%) in 14/16 cases (88%) and ATRX tected by using SYBR Green real-time quantitative pol- expression was lost in 13/14 cases (93%). Finally, all cases ymerase chain reaction (qPCR) analysis (Absolute SYBR displayed ATRX loss and/or TP53-positive immunostaining. Green Rox Mix; Abgene) with the following set of pri- The H3F3A mutation was a G34R mutation in all cases and mers EGFR-F: GTGCAGATCGCAAAGGTAATCAG, EGFR-R: was conserved at recurrence in the 2 patients from the GCAGACCGCATGTGAGGAT; hydrolysis probe: FAM series who underwent a second surgery. All studied cases CCCCTCCCCCGTATCTC.20 were BRAF wildtype (n = 15/15) and lacked TERT promoter mutations (n = 10/10). An EGFR amplification was present in 2/14 patients (14%) and MGMT promoter was methyl- Statistical Analysis ated in 9/11 patients (82%). Categorical comparisons were performed using the Fisher’s exact test or the Chi2 test when the conditions Radiological Presentation of application were met. The nonparametric Wilcoxon test was used for quantitative variable as the hypoth- Initial MRI scans were available for review for 16/17 pa- esis of normality of distribution was not verified. Overall tients. Radiological characteristics are summarized in Table survival and progression-free survival were repre- 1. One patient (patient 6) underwent a brain MRI which was sented with Kaplan–Meier plots and compared using the normal, 3 years before diagnosis. At diagnosis, all tumors log-rank test. had a hemispheric location and were monocentric. Midline The statistical tests were bilateral and the level of signifi- involvement was observed in 4 patients but always as an cance was set at 5% (P < .05). Statistical analyses were con- extension of a primarily hemispheric tumor. Most cases ducted using SAS version 9.4 (SAS Institute Inc.). demonstrated no or only a faint contrast-enhancement 4 Picart et al. Diffuse hemispheric gliomas, H3 G34-mutant in adults (n = 11/15, 73%) and presented as cortico-subcortical consisted of gliomatosis cerebri (n = 9, 60%) with contra- (n = 13/16, 81%), poorly delimited (n = 9/16, 69%), lateral hemispheric (n = 4, 27%) or infratentorial (n = 5, infiltrative lesions that were mostly located in the fronto- 33%) infiltration, local recurrence (n = 3, 20%), distant pro- parietal (n = 11/16, 69%) or in the temporo-insular lobes gression (n = 3, 20%), and leptomeningeal dissemination (n = 3/16, 19%). All but one tumor (n = 12/13, 92%) harbored (n = 4, 26%). At progression, treatment consisted of che- areas of ADC restriction on diffusion-weighted imaging. motherapy alone (n = 8, 53%), chemotherapy combined Only half of the cases in which perfusion MRI and/or MR with cyberknife radiation (n = 1, 8%) or conformational ra- spectroscopy were performed presented an elevated (>1.7) diotherapy (n = 1, 8%), surgery followed by chemotherapy intratumoral relative cerebral blood flow (50%, n = 4/8) or (n = 2), radiotherapy at a remote site (n = 1, 8%), or pallia- a metabolic profile suggestive of an aggressive tumor (el- tive cares (n = 3, 23%). evated Choline/N-Acetyl-Aspartate ratio > 2 and/or of lipid/ lactate peaks, 44%, n = 4/9). For 6 patients, the initial radiological presentation led to Comparison of Adult Diffuse Hemispheric suspect a high-grade glioma. For 10 cases, however, the Gliomas, H3 G34-mutant With Established Types young age of the patient, absent or faint contrast enhance- of Adult WHO Grade IV Gliomas ment (n = 9) or the presence of an isolated hemorrhage As given in Table 2, several characteristics of adult dif- (n = 1) led to suspect another diagnosis (Figure 2). In these fuse hemispheric gliomas, H3 G34-mutant differed sig- patients, the initially suspected diagnoses were the fol- nificantly from those of established types of adult WHO lowing: low-grade glioma (n = 3), primary CNS lymphoma grade IV gliomas. Compared to H3.3 K27M-mutant DMG, (n = 2), multiple sclerosis (n = 2), limbic encephalitis (n = 1), IDH-mutant and IDH-wildtype glioblastomas, diffuse hem- metabolic disease (n = 1), and ruptured arterio-venous ispheric gliomas, H3 G34-mutant occurred in younger pa- malformation (n = 1). Subsequently, in 8 patients, the de- tients, more frequently involved the parietal lobe, more cision was made to perform an MRI follow-up leading to a frequently presented as a hemorrhagic tumor at diagnosis, median delay of 2.3 months before histological diagnosis. less frequently demonstrated contrast-enhancement and Retrospectively, in all but one of these patients, the initial necrosis, more frequently displayed ADC restriction and MRI demonstrated focal ADC restriction that could have less frequently expressed Olig2. In addition, TERT pro- led to suspect an aggressive glioma. In contrast, an ele- moter mutations were lacking in diffuse hemispheric vated intra-tumoral relative cerebral blood flow and an ag- gliomas in contrast to IDH-wildtype glioblastomas while gressive metabolic profile on MR spectroscopy were both MGMT promoter methylation was more frequent in diffuse present in only 2/8 patients (25%). hemispheric gliomas, H3 G34-mutant than in H3.3 K27M- Among the 11 patients with initially absent or faint mutant DMG and IDH-wildtype glioblastomas. Median contrast-enhancement, 8 underwent a repeated MRI be- overall survival of adult diffuse hemispheric gliomas, H3 fore (n = 4) or after (n = 4) histological diagnosis that dem- G34-mutant was 12.4 months compared to 19.6 months onstrated the apparition of a ring-like or nodular contrast (P = .56), 11.7 months (P = .45), and 50.5 months (P = .006) enhancement in all of the patients after a median interval in H3.3 K27M-mutant DMG, IDH-wildtype glioblastomas, of 2.6 months (range: 0.8–5.3 months). and IDH-mutant glioblastomas, respectively (Figure 3). The comparison yielded similar results when the analysis was Treatment and Outcome restricted to H3.3 K27M-mutant DMG and IDH-mutant glio- blastomas with comparable age (ie, aged < 35 years, data A total of 12 patients underwent a biopsy (70%), 1 un- not shown). In IDH-wildtype glioblastomas, the number derwent a partial (6%) and 4 a complete resection (24%). of patients aged < 35 years was too limited to allow this One patient presented with a brain hematoma leading to analysis. neurological worsening after biopsy and one patient pre- sented a lethal refractory raised intracranial pressure after biopsy. In the 15 remaining patients, postsurgical course was uneventful. Postoperative oncological treatment con- Discussion sisted of temozolomide radio-chemotherapy (n = 13, 82%), Diffuse hemispheric gliomas, H3 G34-mutant are rare radiotherapy alone (n = 1, 6%), radiotherapy followed by brain tumors that affect children and adolescents but PCV (procarbazine, CCNU, and vincristine) chemotherapy also adults.4,10,12,15 In this study, that is the first dedicated (n = 1, 6%), and temozolomide chemotherapy alone (n = 1, to adult cases, we show that adult diffuse hemispheric 6%). No severe adverse effect was reported during the gliomas, H3 G34-mutant frequently displayed a misleading oncological treatment and no patient developed drug- radiological presentation, had distinct characteristics com- resistant epilepsy. pared to established types of WHO grade IV adult gliomas At last news, after a median follow-up of 12.7 months, and a poor prognosis. tumor progression was diagnosed in 17 patients and 15 patients had died. The median progression-free survival was 8.8 months and the median overall survival was Radiological Presentation 12.4 months, in the entire series. For the 13 patients who were treated with temozolomide radio-chemotherapy, The radiological characteristics of adult diffuse hemi- the median overall survival was 25 months. The pattern spheric gliomas, H3 G34-mutant in the present series of tumor progression was analyzed for 15 patients and are consistent with those reported in previous studies,    Table 1. Characteristics of the 17 Included Adult Patients Diagnosed With Diffuse Hemispheric Glioma, H3 G34-mutant Pa- Sex Age Suspected Tumor Gadolinium Presence Presence RestrictionSurgical Micro- Ki67 Olig2 TP53 IDH mu- ATRX EGFR am- MGMT Progression Overall tients (years) diganosis location menhan­ of a cyst of necrotic of diffu- manage- scopic index staining staining tation loss plification methyla- free survival survival cement areas sion ment aspect tion (months) (months) 1 M 29 HGG PO Yes Yes No - TR Monstro 35% 0% 80% No Yes No Yes 97 99c 2 F 25 HGG FP Yes No No - TR PNET 60% 0% 80% No Yes No Yes 40.8 53.4 3 F 23 MS FP No No No Yes(F) B PNET 40% 0% 60% No - No Yes 9.3 11.1 4 M 33 LE TI No No No Yes PR PNET 75% 0% 100% No Yes No Yes 4.5 11.9 5 F 29 LGG/MS FPa No No No Yes B PNET 20% 0% 100% No Yes No - 5.7 50.4 6 F 30 HGG FCb Yes Yes Yes Yes(F) B Undiff 28% 0%* 80% No No No Yes 9.5 27.5 7 M 22 H/HGG TI Yes(F) No No Yes TR PNET 40% 0% 100% No Yes Yes Yes 23.1 28.8 8 M 33 PCNSL FCb Yes(F) No No Yes(F) B Oligoid 60% 0%* 100% No Yes No Yes 4.9 6.3 9 M 21 H/AVM FP - No No - TR Monstro 95% 0% 100% No Yes No Yes 24 30c 10 M 19 LGG FPb No No No Yes(F) B PNET 40% 0% 100% No Yes Yes No 7.1 9.0 11 F 37 LGG FP No No No No B A-III 30% 0%* 10% No Yes No Yes 26.2 55.4 12 M 31 HGG TIa Yes(F) No No Yes(F) B Undiff 40% 0% 90% No - No No 8.7 12.4 13 M 29 A FPa Yes(F) No No Yes(F) B PNET 50% 0% 90% No Yes - - 8.8 12.5 14 M 18 MD PCb Yes(F) No No Yes(F) B Undiff 25% 0% 40% No Yes - - 3.2 4.2 15 M 22 H/HGG FP Yes No No Yes B PNET 25% 0% 5% No Yes - - 0.1 0.1 16 F 19 PCNSL FP Yes(F) No No Yes(F) B Monstro 15% 0% 90% No Yes No - 6.4 8.4 17 M 18 - - - - - - B Undiff - - - No - No - 11.4 14.4 Sex. F: Female, M: Male; Initially suspected diagnosis. A: Abscess, AVM: Arterio-venous Malformation, H: Hematoma, HGG: High-grade glioma, LE: Limbic encephalitis, LGG: Low-grade glioma, MD: Metabolic disease, MS: Multiple scle- rosis, PCNSL: Primary central nervous system lymphoma; Tumor location. FC: fronto-callosal, FP: fronto-parietal, PO: parieto-occipital, TI: temporo-insular, a indicates tumors that were only cortical at diagnosis, b indicates midline invasion; Gadolinium enhancement. (F): Faint; Restriction of Diffusion. (F): Focal; Surgical management. B: Biopsy, PR: Partial Resection, TR: Total Resection; Microscopic aspect. A-III: Grade III Astrocytoma, Monstro: Monstroscellular glioblastoma, Oligoid: Glioblastoma with oligoid morphology, PNET: Glioblastoma with Primitive Neuro-Ectodermic Tumor-like foci, Undiff: Glioblastoma with undifferenciated morphology; Olig2 staining. * indicates cases containing Olig2-imunopositive reactive glial cells Overall survival. c indicates patients who are still alive.    Picart et al. Diffuse hemispheric gliomas, H3 G34-mutant in adults Advances 5 Neuro-Oncology 6 Picart et al. Diffuse hemispheric gliomas, H3 G34-mutant in adults    HPS Olig2 TP53 ATRX A B C D Figure 1. Histological characteristics of adult diffuse hemispheric gliomas, H3 G34-mutant (Scale bar = 100 µm). (A) PNET-like morphology, charac- terized by small round cells, with anaplastic features including endothelial cell proliferation, negative Olig2 immunostaining, positive TP53 staining and ATRX loss. (B) Undifferenciated glial morphology, characterized by irregularly shaped nuclei and poorly delimited cytoplasms with anaplastic features including endothelial cell proliferation, positive Olig2 (reactive glial cells), ATRX, and TP53 stainings. (C) Monstrocellular morphology, characterized by multinucleated cells, with anaplastic features including endothelial cell proliferation, necrosis, negative Olig2 immunostaining, positive TP53 staining, and ATRX loss. (D) Oligoid morphology, characterized by small cells with a clear peri-nuclear halo, with anaplastic features including endothelial cell proliferation and 2 mitoses, positive Olig2 (reactive glial cells) and TP53 immunostaining and ATRX loss.    although these studies were not dedicated to adults (Table including inflammatory, infectious, vascular and metabolic 3). In the present series, adult diffuse hemispheric gliomas, diseases, could be initially suspected. Retrospectively, H3 G34-mutant were constantly located within cerebral a striking feature in these patients that could have raised hemispheres,3,4,6,8–10,14 frequently affected the parietal and suspicions toward an aggressive hypercellular tumor15,24 temporal lobes,4,6–8,11,15,21,22 frequently demonstrated no or was the presence of areas of profound focal ADC restric- faint contrast-enhancement,7,15 not rarely presented a mas- tion. In addition to diffusion-weighted-imaging, dynamic sive initial hemorrhage23 and, frequently presented an un- 18F-Fluoro-Ethyl-L-Tyrosine positron emission tomography usual presentation for a high-grade glioma.7,15,23 Actually, (FET-PET) may be useful to preoperatively identify non- less than half of cases fulfilled the imaging criteria of high- contrast enhancing diffuse hemispheric gliomas, H3 G34- grade glioma which led in some cases to a potentially mutant as aggressive gliomas.23 detrimental diagnostic delay. Patients for whom the radi- ological presentation was misleading typically presented Histo-molecular Presentation with an MRI aspect that has been previously described as “gliomatosis cerebri-like,” consisting of a non-contrast At the histo-molecular level, it was evidenced herein that enhancing ill-defined infiltrating lesion that led to suspect adult diffuse hemispheric gliomas, H3 G34-mutant could another diagnosis than a high-grade glioma because of present a PNET-like or a GBM-like morphology, lacked the young age of the patients.15 Nontumoral diagnoses, Olig2 expression, were most frequently immunonegative Picart et al. Diffuse hemispheric gliomas, H3 G34-mutant in adults 7 Advances Neuro-Oncology    A B C D 0.42 0.4 0.38 0.36 0.34 0.32 0.3 0.28 0.26 0.24 0.22 E 0.2 0.18 0.16 0.14 0.12 0.1 0.08 0.06 0.04 0.02 0 –0.02 4.2 4 3.8 3.6 3.4 3.2 3 2.8 2.6 2.4 2.2 2 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 Figure 2. Radiological characteristics of adult diffuse hemispheric gliomas, H3 G34-mutant For each case, T1-weighted contrast-enhanced MRI (left), T2-weighted FLAIR MRI (middle) and ADC map (right) are shown. (A) Frontal cortico-subcortical, poorly delimited, diffuse hemispheric glioma, H3 G34-mutant without contrast enhancement, displaying focal ADC restriction and a metabolic profile on MR spectroscopy demonstrating no Choline/Creatinine ratio increase but an elevated Choline/N-Acetyl-Aspartate ratio (2.35) and a lipid peak (patient 10). In this patient, a low-grade glioma was initially suspected. (B–D) Three other cases of diffuse hemispheric gliomas, H3 G34-mutant with a misleading presentation, including absent or faint contrast enhancement and a focal ADC restriction. These characteristics led to suspect at first diagnosis multiple sclerosis (B— Patient 5, D—Patient 3), limbic encephalitis (C—Patient 4) or low-grade glioma (D—Patient 3). (E) Fronto-callosal diffuse hemispheric glioma, H3 G34-mutant with a presentation suggestive of high-grade glioma, including necrosis area and an evident contrast enhancement (patient 6). Three years earlier, this patient underwent an MRI which was normal.    for ATRX, immunopositive for TP53, frequently demon- rate of MGMT promoter methylation, adult diffuse hem- strated a methylated MGMT promoter, and lacked TERT ispheric gliomas, H3 G34-mutant had a poor prognosis. promoter mutations. These findings are consistent with Despite many similarities, it has been shown that pedi- those reported in previous series that included both pe- atric and adult H3.3 K27M-mutant DMG present signif- diatric and adult cases (Table 3).3,4,6,7,11,15,21,22,25,26 The icant differences.29 Compared to pediatric cases, adult absence of Olig2 expression is a hallmark of diffuse H3.3 K27M-mutant DMG more frequently affect the thal- hemispheric gliomas, H3 G34-mutant. Yet, as observed amus and less frequently the pons, almost exclusively in our series, reactive glial cells may wrongly suggest harbour H3F3A mutations and have a better prognosis.29 positivity in some cases. As highlighted in children,27 It remains to be determined whether this is also the case due to a frequent PNET-like morphology, adult diffuse in diffuse hemispheric gliomas, H3 G34-mutant, how- hemispheric gliomas, H3 G34-mutant could have previ- ever, these gliomas seem to be a more homogeneous ously been misdiagnosed as CNS PNET, a now obsolete entity than H3.3 K27M-mutant DMG. Age at diagnosis is entity. Actually, in a young adult presenting with an IDH- narrower in H3 G34-mutant gliomas than in H3.3 K27M- wildtype hemispheric PNET-like tumor, the most likely di- mutant DMG and in a previous study neither histological agnosis is a diffuse hemispheric glioma, H3 G34-mutant appearance nor molecular characteristics were associated since other entities that can present as PNET-like tumors with age.6 Also consistent with this hypothesis, as detailed occur in younger patients.28 Importantly, in the present in Table 3, the characteristics of adult diffuse hemispheric series, despite the young age of the patients and a high gliomas, H3 G34-mutant in the series herein seemed very 8    Table 2. Comparison of the Characteristics of Adult Diffuse Hemispheric Gliomas, H3 G34-Mutant with Those of H3.3 K27-mutant DMG, IDH1/2-mutant Glioblastomas and pTERT-mutant Glioblastomas H3.3 G34-mutant H3.3 K27-mutant DMG Pa IDH-mutant glioblastomas Pb IDH-wt glioblastomas Pc gliomas (n = 17) (n = 33) (n = 36) (n = 100) Median age at diagnosis (years) 25.8 (SD = 5.9) 34.8 (SD = 16.5) .005 38.5 (SD = 13.7) <.001 66.4 (SD = 11.8) <.001 Sex Male 11/17 (65%) 15/33 (45%) .24 13/36 (36%) .09 49/100 (49%) .30 Female 6/17 (35%) 18/33 (55%) 23/36 (64%) 51/100 (51%) Location Frontal 11/16 (69%) 0/33 (0%) <.001 24/36 (67%) .99 48/100 (48%) .27 Parietal 11/16 (69%) 0/33 (0%) <.001 7/36 (19%) .001 22/100 (22%) <.001 Temporal 3/16 (19%) 2/33 (6%) .31 11/36 (31%) .51 32/100 (32%) .25 Occipital 1/16 (6%) 0/33 (0%) .32 1/36 (3%) .52 14/100 (14%) .69 Corpus callosum 3/16 (19%) 0/33 (0%) .03 11/36 (31%) .50 33/100 (33%) .38 Midline 4/16 (25%) 33/33 (100%) <.001 10/36 (28%) .99 10/100 (10%) .11 Initial hemorrhage Yes 3/16 (19%) 0/33 (0%) .03 2/36 (6%) .16 2/100 (2%) .01 No 13/16 (81%) 33/33 (100%) 34/36 (94%) 98/100 (98%) Radiological features CE 4/15 (27%) 18/29 (62%) .05 27/36 (75%) .002 93/100 (93%) <.001 Cyst 2/16 (12%) 3/28 (11%) .60 7/36 (19%) .70 8/100 (8%) .60 Necrosis 1/16 (6%) 10/28 (36%) .03 14/36 (39%) .02 70/100 (70%) <.001 ADC restriction 12/13 (92%) 3/23 (13%) <.001 4/30 (13%) <.001 35/68 (51%) .006 Picart et al. Diffuse hemispheric gliomas, H3 G34-mutant in adults IHC features OLIG2 positivity 3/16 (19%) 29/29 (100%) <.001 36/36 (100%) .03 89/91 (98%) <.001 Molecular characteristic IDH mut. 0/17 (0%) 0/33 (0%) .99 - - - - EGFR amplif. 2/14 (14%) 0/33 (0%) .08 2/34 (6%) .57 34/96 (35%) .13 pTERT mut. 0/15 (0%) 2/30 (7%) .99 1/28 (4%) .99 88/100 (88%) <.001 MGMT meth. 9/11 (82%) 4/31 (13%) .001 27/32 (84%) .99 46/93 (49%) .05 BrafV600E mut. 0/10 (0%) 0/30 (0%) .99 0/18 (0%) .99 1/59 (2%) .99 Median Overall Survival (months) 12.4 19.6 .56 50.5 .006 11.7 .45 95%CI [6.3–27.5] 95%CI [6.1–29.1] 95% CI [45.9–79.2] 95%CI [9.3–17.5] ADC, Apparent diffusion coefficient; CE, Contrast enhancement; SD, Standard deviation. aH3.3 K27-mutant DMG compared to diffuse hemispheric gliomas, H3 G34-mutant, b IDH-mutant glioblastomas compared to diffuse hemispheric gliomas, H3 G34-mutant, c IDH-wt glioblastomas compared to diffuse hemispheric gliomas, H3 G34-mutant. Significant P-values are indicated in bold characters.       Table 3. Summary of H3 G34-mutant gliomas characteristics in the present and in previously reported series* Present Chen C et al.28 Roux et al.12 Mackay Vettermann Mackay Puntonet Neumann Korshunov Sturm, series et al.22 et al.23 et al.21 et al.15 et al.11 et al.6 Schwartzentruber Summary et al.4 2020 2020 2018 2018 2017 2017 2016 2016 2012 Population Adult Pediatric, adult 15–25 years Pediatric Pediatric, adult Pediatric, Pediatric, <30 years Pediatric, adult Pediatric, adult adult adult N 17 95 11 7 8 67 12 12 81 18 Median age (years, 25 (19–33) - 17.6 12 27 (9–52) 15 (7–31) 16 (6–31) 14.5 19 (9–51) 18 (9–42) 12–27 range) Radiological characteristics Main location FP - FP TP TP (50%) TP T TP TP (80%) TP FTP  Contrast- 27% - 100% - 62% - 37% - - - 27%–100% enhancement (%) ADC restriction (%) 92% - - - - - 100% - - - 92%–100% Histological and molec- ular characteristics (%) GBM-like 53% - 72% 57% - - 83% 0% 50% - 50%–83%$$ PNET-like 47% - - - - - 17% 100% 50% - 17%–50%$$  Olig2 100% - - 100% - - 100% - 100% 100% 100% immunonegative ATRX loss or mutant 93% 84% - 86% - 89% 75% 91% 95% 100% 75%–100% TERTp mutation 0% - - - - - - - - - -  TP53 expression or 88% 95% - - - 89% - 54% 88% 100% 54%–100% mutant EGFR amplification 14% - - - - 3% - - 4% 5% 3%–14% $ - - 27%$ 10%$ 10%–71% PDGFRA alteration - 44%/81%** - 71%*** 13% MGMT methylated 82% - - 50% 65% - - 74% - 50%–82% Median survival 12.5 - 36.2 12 - 18 - - 22 24 12–36.2 (months) FP, fronto-parietal; TP, temporo-parietal; T, temporal. *Only series with > 4 cases were included. ** PDGFRA mutations diagnosis/recurrence, *** PDGFRA mutations and amplifications, $: PDGFRA amplification, $$: excluding Neumann et al. study11 that focused on cases with a PNET-like presentation.    Picart et al. Diffuse hemispheric gliomas, H3 G34-mutant in adults Advances 9 Neuro-Oncology 10 Picart et al. Diffuse hemispheric gliomas, H3 G34-mutant in adults However, the H3.3 G34 mutations alter accessibility of H3    K36 to histone methyltransferases affecting H3 K36 meth- 100 H3.3 G34-mt ylation and subsequently gene expression.37 H3.3 G34 Probability of Survival H3K27M-mt mutations have been shown to result in the upregulation GBM IDH-wt of transcription factor MYCN38,39 and to impair H3 K36 methylation by SETD2 which promotes aberrant PRC2 GBM IDH-mt 50 activity and drives tumor progression.40 H3.3 G34 muta- tions also promote genomic instability by blocking the interaction between H3 K36 and the mismatch repair pro- 0 tein MutSα.41 In addition, it has been shown that diffuse 0 50 100 150 hemispheric gliomas, H3 G34-mutant are characterized Overall survival (months) by a global DNA hypomethylation and ATRX/DAXX mu- H3.3 G34-mt 17 4 0 tations, resulting in alternative lengthening of telomeres H3K27M-mt 33 5 0 (ALT).3,4,8,25,30 Recently, it has been shown that although GBM IDH-mt 36 18 6 GBM IDH-wt 100 3 0 considered gliomas, H3 G34-mutant tumors arise in spe- cific interneuron progenitors, in which G34 mutations pre- vent neuronal differentiation and that PDGFRA signalling Figure 3. Kaplan–Meier survival analysis of diffuse hemispheric plays a major role in these tumors.26 PDGFRA activating gliomas, H3 G34-mutant, H3.3 K27M-mutant diffuse midline gliomas, mutations (mostly in the extracellular domain) which are IDH-mutant glioblastomas, and IDH-wildtype glioblastomas patients. present in 40% of the cases at diagnosis and, in 80% of Patients at risk are indicated below. the cases at recurrence, promote astroglial features and    are potent oncogenic drivers.26 In the future, targeting MYCN,38 DNA hypomethylation,4,8 ALT,3,25,30 and PDGFRA similar to those reported in previous studies that included signaling26 could constitute new treatment strategies in both adult and pediatric cases3,4,6,21,22,27 or only pediatric diffuse hemispheric gliomas, H3 G34-mutant. Targeting cases.3,4,6,21,22,27 However, analysis of larger series will be MYCN upregulation could be achieved by inhibiting kin- necessary to assess whether there are age-related differ- ases such as CHK1 and AURKA which stabilize MYCN38 or ences in H3 G34-mutant gliomas. by using BRD3 and BRD4 inhibitors which play essential roles in the transcription of MYCN.42,43 Regarding PDGFRA signaling inhibition, given the high rate of extracellular Outcomes and Therapeutic Opportunities mutations, it remains to be determined whether it could The median overall survival of adult diffuse hemispheric be best achieved through PDGFRA inhibitors or through gliomas, H3 G34-mutant herein is consistent with the me- inhibitors targeting downstream MAPK activation.26 In dian overall survival ranging from 12 to 36 months re- H3.3 K27M-mutant DMG histone deacetylase inhibitors ported in previous series (Table 3).3,4,6,12,21,22,26 Although and the selective antagonist of dopamine receptor DRD2/3 several studies suggested that diffuse hemispheric ONC201 are promising therapeutic strategies that are gliomas, H3 G34-mutant had a better prognosis than H3.3 currently being evaluated in clinical trials.44,45 Whether K27M-mutant DMG4,10,30,31 the prognosis of these two these strategies may benefit patients with H3 G34-mutant tumor types was similar in the present series and was also gliomas remains to be determined. similar to that of IDH-wildtype glioblastomas. However, the clinical, radiological and histo-molecular characteristics of Study Limitations diffuse hemispheric gliomas, H3 G34-mutant were very dif- ferent from those of H3.3 K27M-mutant DMG, IDH-mutant, Other than the limited sample size and its retrospective and IDH-wildtype glioblastomas. These findings support design, this study is limited by the absence of a compre- that diffuse hemispheric gliomas, H3 G34-mutant should hensive molecular analysis, the absence of multimodal be considered as a new WHO grade IV tumor type in future imaging in all of the patients, and the absence of com- classifications.13 parative pediatric series. In addition, the results will Beside gliomas, H3.3 G34 mutations are found in the need to be validated in an independent and larger series. majority of giant cell tumors of the bone (92%) and some Nevertheless, the study provides for the first time a pic- osteosarcomas (5%).32,33 Although the oncogenesis of dif- ture of adult diffuse hemispheric gliomas, H3 G34-mutant fuse hemispheric gliomas, H3 G34-mutant remains to be characteristics. fully understood, some therapeutic opportunities have already been identified. Histones pack DNA and are in- volved in transcriptional regulation and telomeres sta- bility10,34 through post-translational modifications.1,2,14,34–36 Conclusions Mutations of some histone residues, such as the H3.3 K27 and K36 residue, generate conformational changes or Adult diffuse hemispheric gliomas, H3 G34-mutant are as- steric inhibition that prevent post-translational modifica- sociated with distinct characteristics compared to those tions and trigger deep epigenetic reprogramming.1–3,14,34 of established types of adult WHO grade IV gliomas. In contrast to the H3.3 K27 residue, the H3.3 G34 res- This study supports considering these tumors as a new idue does not undergo post-translational modifications. type of WHO grade IV glioma in future classifications. If Picart et al. Diffuse hemispheric gliomas, H3 G34-mutant in adults 11 Advances Neuro-Oncology further studies confirm that adult and pediatric diffuse 5. Louis DN, Perry A, Reifenberger G, et al. The 2016 World Health hemispheric gliomas, H3 G34-mutant share similar char- Organization Classification of Tumors of the Central Nervous System: a acteristics, it may be reasonable to include patients in the summary. Acta Neuropathol (Berl). 2016;131(6):803–820. same clinical trials, irrespective of age. 6. Korshunov A, Capper D, Reuss D, et al. Histologically distinct neu- roepithelial tumors with histone 3 G34 mutation are molecularly sim- ilar and comprise a single nosologic entity. Acta Neuropathol (Berl). 2016;131(1):137–146. Keywords 7. Yoshimoto K, Hatae R, Sangatsuda Y, et al. Prevalence and clinicopathological features of H3.3 G34-mutant high-grade gliomas: a diffuse hemispheric glioma | H3.3 G34R/V mutation | H3.3 retrospective study of 411 consecutive glioma cases in a single institu- K27M mutation | PNET | survival tion. Brain Tumor Pathol. 2017;34(3):103–112. 8. Korshunov A, Ryzhova M, Hovestadt V, et al. Integrated analysis of pe- diatric glioblastoma reveals a subset of biologically favorable tumors with associated molecular prognostic markers. Acta Neuropathol (Berl). Acknowledgments 2015;129(5):669–678. 9. Pathak P, Jha P, Purkait S, et al. Altered global histone-trimethylation We thank Mrs. Hélène Boyer for English reviewing of the code and H3F3A-ATRX mutation in pediatric GBM. J Neurooncol. manuscript. We also thank Dr. Pierre Brandicourt, Dr. Imène 2015;121(3):489–497. Djidjelli, Dr. Yordanka Yordanova and the Hospices Civils de 10. Fontebasso AM, Liu X-Y, Sturm D, Jabado N. Chromatin remodeling de- Lyon Biological Resource Center – Tissus Tumorothèque Est & fects in pediatric and young adult glioblastoma: a tale of a variant his- Neurobiotec for their precious help in collecting data. Cases tone 3 tail. Brain Pathol Zurich Switz. 2013;23(2):210–216. from Marseille were retrieved from the AP-HM tumor bank (au- 11. Neumann JE, Dorostkar MM, Korshunov A, et al. Distinct thorization number: AC2018-31053; CRB BB-0033-00097). Histomorphology in Molecular Subgroups of Glioblastomas in Young Patients. J Neuropathol Exp Neurol. 2016;75(5):408–414. 12. Roux A, Pallud J, Saffroy R, et al. High-grade gliomas in adolescents and young adults highlight histomolecular differences from their adult and Funding pediatric counterparts. Neuro-Oncol. 2020;22(8):1190–1202. 13. Louis DN, Wesseling P, Aldape K, et al. cIMPACT-NOW update 6: new None declare. entity and diagnostic principle recommendations of the cIMPACT- Utrecht meeting on future CNS tumor classification and grading. Brain Pathol Zurich Switz. 2020;30(4):844–856. 14. Lee J, Solomon DA, Tihan T. The role of histone modifications and tel- Conflict of interest statement. None declared. omere alterations in the pathogenesis of diffuse gliomas in adults and children. J Neurooncol. 2017;132(1):1–11. 15. Puntonet J, Dangouloff-Ros V, Saffroy R, et al. Historadiological cor- relations in high-grade glioma with the histone 3.3 G34R mutation. J Authorship Statement. T.P., D.M., and F.D. designed the study. Neuroradiol J Neuroradiol. 2018;45(5):316–322. T.P., M.B., D.P., C.I., E.T., V.B., F.B.V., E.C.J.M., and J.G. substan- 16. Zhang R-Q, Shi Z, Chen H, et al. Biomarker-based prognostic stratifica- tially contributed to data acquisition. T.P., M.B., L.P.B., C.I., D.F.B., tion of young adult glioblastoma. Oncotarget. 2016;7(4):5030–5041. A.I., F.B., E.U.C., J.G., M.G., D.M., and F.D. interpreted the data. 17. Wen PY, Macdonald DR, Reardon DA, et al. Updated response as- T.P. and F.D. drafted the manuscript. All authors revised the man- sessment criteria for high-grade gliomas: response assessment in uscript critically for important intellectual content and approved neuro-oncology working group. J Clin Oncol Off J Am Soc Clin Oncol. the final version to be published. 2010;28(11):1963–1972. 18. Meyronet D, Esteban-Mader M, Bonnet C, et al. Characteristics of H3 K27M-mutant gliomas in adults. Neuro-Oncol. 2017;19(8):1127–1134. 19. Walter T, van Brakel B, Vercherat C, et al. O6-Methylguanine-DNA methyltransferase status in neuroendocrine tumours: prognostic rele- References vance and association with response to alkylating agents. Br J Cancer. 2015;112(3):523–531. 20. Idbaih A, Crinière E, Marie Y, et al. Gene amplification is a poor 1. Wu G, Broniscer A, McEachron TA, et al. Somatic histone H3 alterations prognostic factor in anaplastic oligodendrogliomas. Neuro-Oncol. in pediatric diffuse intrinsic pontine gliomas and non-brainstem glio- 2008;10(4):540–547. blastomas. Nat Genet. 2012;44(3):251–253. 21. Mackay A, Burford A, Carvalho D, et al. Integrated molecular meta- 2. Wu G, Diaz AK, Paugh BS, et al. The genomic landscape of diffuse in- analysis of 1,000 pediatric high-grade and diffuse intrinsic pontine trinsic pontine glioma and pediatric non-brainstem high-grade glioma. glioma. Cancer Cell. 2017;32(4):520–537.e5. Nat Genet. 2014;46(5):444–450. 22. Mackay A, Burford A, Molinari V, et al. Molecular, pathological, radiolog- 3. Schwartzentruber J, Korshunov A, Liu X-Y, et al. Driver mutations in his- ical, and immune profiling of non-brainstem pediatric high-grade Glioma tone H3.3 and chromatin remodelling genes in paediatric glioblastoma. from the HERBY Phase II randomized trial. Cancer Cell. 2018;33(5):829– Nature. 2012;482(7384):226–231. 842.e5. 4. Sturm D, Witt H, Hovestadt V, et al. Hotspot mutations in H3F3A and 23. Vettermann FJ, Felsberg J, Reifenberger G, et al. Characterization of dif- IDH1 define distinct epigenetic and biological subgroups of glioblas- fuse gliomas with histone H3-G34 Mutation by MRI and Dynamic 18F- toma. Cancer Cell. 2012;22(4):425–437. FET PET. Clin Nucl Med. 2018;43(12):895–898. 12 Picart et al. Diffuse hemispheric gliomas, H3 G34-mutant in adults 24. Pramanik PP, Parmar HA, Mammoser AG, et al. Hypercellularity compo- 35. Martin C, Zhang Y. The diverse functions of histone lysine methylation. nents of glioblastoma identified by high b-value diffusion-weighted im- Nat Rev Mol Cell Biol. 2005;6(11):838–849. aging. Int J Radiat Oncol Biol Phys. 2015;92(4):811–819. 36. Vanan MI, Underhill DA, Eisenstat DD. Targeting epigenetic pathways in 25. Ebrahimi A, Skardelly M, Bonzheim I, et al. ATRX immunostaining pre- the treatment of pediatric diffuse (High Grade) gliomas. Neurother J Am dicts IDH and H3F3A status in gliomas. Acta Neuropathol Commun. Soc Exp Neurother. 2017;14(2):274–283. 2016;4(1):60. 37. Shi L, Shi J, Shi X, Li W, Wen H. Histone H3.3 G34 mutations 26. Chen CCL, Deshmukh S, Jessa S, et al. Histone H3.3G34-Mutant alter histone H3K36 and H3K27 Methylation In Cis. J Mol Biol. Interneuron progenitors Co-opt PDGFRA for gliomagenesis. Cell. 2018;430(11):1562–1565. 2020;183(6):1617–1633.e22. 38. Bjerke L, Mackay A, Nandhabalan M, et al. Histone H3.3. mutations 27. Gessi M, Gielen GH, Hammes J, et al. H3.3 G34R mutations in pediatric drive pediatric glioblastoma through upregulation of MYCN. Cancer primitive neuroectodermal tumors of central nervous system (CNS- Discov. 2013;3(5):512–519. PNET) and pediatric glioblastomas: possible diagnostic and therapeutic 39. Huang M, Weiss WA. G34, another connection between MYCN and a implications? J Neurooncol. 2013;112(1):67–72. pediatric tumor. Cancer Discov. 2013;3(5):484–486. 28. Sturm D, Orr BA, Toprak UH, et al. New brain tumor entities emerge from 40. Jain SU, Khazaei S, Marchione DM, et al. Histone H3.3 G34 mutations molecular classification of CNS-PNETs. Cell. 2016;164(5):1060–1072. promote aberrant PRC2 activity and drive tumor progression. Proc Natl 29. Schulte JD, Buerki RA, Lapointe S, et al. Clinical, radiologic, and genetic Acad Sci. 2020;117(44):27354–27364. characteristics of histone H3 K27M-mutant diffuse midline gliomas in 41. Fang J, Huang Y, Mao G, et al. Cancer-driving H3G34V/R/D mutations adults. Neuro-Oncol Adv. 2020;2(1):vdaa142. block H3K36 methylation and H3K36me3-MutSα interaction. Proc Natl 30. Sturm D, Bender S, Jones DTW, et al. Paediatric and adult glio- Acad Sci USA 2018;115(38):9598–9603. blastoma: multiform (epi)genomic culprits emerge. Nat Rev Cancer. 42. Puissant A, Frumm SM, Alexe G, et al. Targeting MYCN in neu- 2014;14(2):92–107. roblastoma by BET bromodomain inhibition. Cancer Discov. 31. Khuong-Quang D-A, Buczkowicz P, Rakopoulos P, et al. K27M mutation in his- 2013;3(3):308–323. tone H3.3 defines clinically and biologically distinct subgroups of pediatric dif- 43. Shahbazi J, Liu PY, Atmadibrata B, et al. The bromodomain inhibitor JQ1 fuse intrinsic pontine gliomas. Acta Neuropathol (Berl). 2012;124(3):439–447. and the histone deacetylase inhibitor panobinostat synergistically re- 32. Behjati S, Tarpey PS, Presneau N, et al. Distinct H3F3A and H3F3B driver duce N-Myc expression and induce anticancer effects. Clin Cancer Res. mutations define chondroblastoma and giant cell tumor of bone. Nat 2016;22(10):2534–2544. Genet. 2013;45(12):1479–1482. 44. Grasso CS, Tang Y, Truffaux N, et al. Functionally defined ther- 33. Koelsche C, Schrimpf D, Tharun L, et al. Histone 3.3 hotspot mutations apeutic targets in diffuse intrinsic pontine glioma. Nat Med. in conventional osteosarcomas: a comprehensive clinical and molecular 2015;21(6):555–559. characterization of six H3F3A mutated cases. Clin Sarcoma Res. 2017;7:9. 45. Chi AS, Tarapore RS, Hall MD, et al. Pediatric and adult H3 K27M- 34. Kallappagoudar S, Yadav RK, Lowe BR, Partridge JF. Histone H3 mutations--a mutant diffuse midline glioma treated with the selective DRD2 antago- special role for H3.3 in tumorigenesis? Chromosoma. 2015;124(2):177–189. nist ONC201. J Neurooncol. 2019;145(1):97–105.