Experimental Neurology 358 (2022) 114220 Contents lists available at ScienceDirect Experimental Neurology journal homepage: www.elsevier.com/locate/yexnr Research paper Aberrant perineuronal nets alter spinal circuits, impair motor function, and increase plasticity J. Sánchez-Ventura a, C. Canal a, J. Hidalgo a, C. Penas a, X. Navarro a, A. Torres-Espin b, K. Fouad c, E. Udina a, * a Institute of Neuroscience, Department Cell Biology, Physiology and Immunology, Universitat Autònoma de Barcelona, and Centro de Investigación Biomédica en Red sobre Enfermedades Neurodegenerativas (CIBERNED), Bellaterra, Spain b Weill Institute for Neuroscience, Brain and Spinal Injury Center (BASIC), Department of Neurological Surgery, University of California San Francisco, San Francisco, CA, USA c Neuroscience and Mental Health Institute, Department of Physical Therapy, Faculty of Rehabilitative Medicine, University of Alberta, Edmonton, AB, Canada A R T I C L E I N F O A B S T R A C T Keywords: Perineuronal nets (PNNs) are a specialized extracellular matrix that have been extensively studied in the brain. Perineuronal nets Cortical PNNs are implicated in synaptic stabilization, plasticity inhibition, neuroprotection, and ionic buffering. Link protein 1 However, the role of spinal PNNs, mainly found around motoneurons, is still unclear. Thus, the goal of this study Plasticity is to elucidate the role of spinal PNNs on motor function and plasticity in both intact and spinal cord injured Locomotion Spinal cord injury mice. We used transgenic mice lacking the cartilage link protein 1 (Crtl1 KO mice), which is implicated in PNN assembly. Crtl1 KO mice showed disorganized PNNs with an altered proportion of their components in both motor cortex and spinal cord. Behavioral and electrophysiological tests revealed motor impairments and hy­ perexcitability of spinal reflexes in Crtl1 KO compared to WT mice. These functional outcomes were accompanied by an increase in excitatory synapses around spinal motoneurons. Moreover, following spinal lesions of the corticospinal tract, Crtl1 KO mice showed increased contralateral sprouting compared to WT mice. Altogether, the lack of Crtl1 generates aberrant PNNs that alter excitatory synapses and change the physiological properties of motoneurons, overall altering spinal circuits and producing motor impairment. This disorganization generates a permissive scenario for contralateral axons to sprout after injury. 1. Introduction follows the assembly of PNNs (Carulli et al., 2010). In vitro, its absence prevents PNN formation around PNN-bearing cells (Kwok et al., 2010). Perineuronal nets (PNNs) are a dynamic extracellular matrix that In vivo, its genetic deletion confers increased levels of plasticity in the surround neurons in the central nervous system (CNS) and play a key adult visual cortex and Purkinje cell terminals and also promotes role in synaptic stabilization and plasticity inhibition (reviewed in Wang regeneration into the denervated cuneate nucleus (Carulli et al., 2010; and Fawcett, 2012). They are composed of chondroitin sulfate pro­ Foscarin et al., 2011). teoglycans (CSPGs), hyaluronan and proteins such as tenascin-R, link In the mature CNS, the role of PNNs in regulating plasticity-stability proteins and Semaphorin 3A (Dick et al., 2013; Kwok et al., 2011). PNN processes has been extensively studied in the brain, demonstrated in the formation is activity dependent and occurs at late postnatal stage, spe­ visual cortex (Pizzorusso, 2002), amygdala (Nadine et al., 2009), medial cifically at the end of the ‘critical period’ for plasticity which coincides prefrontal cortex (Slaker et al., 2015), and the cerebellum (Carulli et al., with the maturation of neural circuits and the decline of neural plasticity 2020). Other functions have been attributed to cortical PNNs, such as (Berardi et al., 2000; Pizzorusso, 2002; Dityatev et al., 2007). In fact, the ionic buffering (Brückner et al., 1993), neuroprotection (Suttkus et al., enzymatic breakdown of PNNs by chondroitinase (ChABC) reopens the 2014), and synaptic refinement (Frischknecht et al., 2009). In contrast, plasticity window, demonstrating the implication of PNNs in this pro­ little is known about PNNs' function within the spinal cord even though cess (Pizzorusso, 2002). Among all PNN components, the cartilage link they surround 80% of α-motoneurons (MNs) and many spinal in­ protein 1 (Crtl1) is crucial in PNN formation since its expression closely terneurons (Irvine and Kwok, 2018). * Corresponding author. E-mail address: esther.udina@uab.cat (E. Udina). https://doi.org/10.1016/j.expneurol.2022.114220 Received 9 June 2022; Received in revised form 24 August 2022; Accepted 28 August 2022 Available online 3 September 2022 0014-4886/© 2022 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by- nc-nd/4.0/). J. Sánchez-Ventura et al. Experimental Neurology 358 (2022) 114220 Interestingly, spinal PNNs thickness is modulated by neuronal ac­ genomic DNA and 3 specific sets primers by PCR (Table 2). tivity in the opposite direction of cortical PNNs, since activity reduces brain PNNs but increases spinal ones (Smith et al., 2015). Thus, 2.3. Functional assessment decreased spinal motoneurons activity below a SCI reduces the thickness of their PNNs. This reduction is reversed by physical rehabilitation Animals were handled for 3 days and habituated for 15 min in the (Sánchez-Ventura et al., 2020), and depends on increased synaptic ac­ behavioral room before each test. tivity (Arbat-Plana et al., 2015; Smith et al., 2015). It is interesting to note that application of ChABC at the injury site in SCI models, degrades 2.3.1. Open field test CSPGs secreted by the fibro-glial scar, and attenuates the growth Open field testing was used to measure general locomotor activity limiting properties of CSPGs (Barritt et al., 2006; Massey et al., 2006; (Seibenhener and Wooten, 2015). Mice were individually placed into a Vavrek et al., 2007). However, the plasticity achieved by ChABC only white methacrylate box (56 × 36,5 × 31 cm) and allowed to explore for establishes meaningful connections and translates into functional re­ 5 min. Their exploratory behavior was recorded for automated assess­ covery when combined with rehabilitative motor training (García-Alías ment. The total distance, and the average speed traveled were analyzed et al., 2009; Tom et al., 2009; Wang et al., 2011), to facilitate the for­ from recorded footage with Ethovision XT version 11.5 (Noldus) soft­ mation and stabilization of functional connections. This synaptic stabi­ ware, whereas the number of rearings was annotated during the test lization is comparable to that found at the end of the developmental session. critical period in which PNNs participate. Despite sound and promising evidence, most studies highlight the 2.3.2. Novel object recognition test (NORT) potential of ChABC to boost plasticity in the spinal cord without prop­ NORT was performed in the Open field arena. Mice were habituated erly evaluating the importance of modulating PNNs. Thus, the current during 3 consecutive days (10 min) to the arena. The familiarization study aims to describe the role of spinal PNNs on motor function by phase started on the 4th day. During this session, two identical objects using transgenic mice lacking the Hyaluronan and Proteoglycan Link (A1 and A2) were placed in the middle of the arena and mice explored protein 1 (Crtl1/HAPLN1) gene, which encodes the cartilage link pro­ them for 10 min. Two hours after familiarization, short-term memory tein1 (Crtl 1), a key element triggering PNN formation (Carulli et al., was tested by placing mice back into the arena for 10 min, where one of 2010). In previous research, Crtl1 KO mice were used to study PNNs' role the familiar objects was replaced by a novel object (B). To test long-term in the cerebellum and brain (Carulli et al., 2010; Foscarin et al., 2011). memory, animals were put back in the box 24 h after the familiarization Within the present study, our goal was to study the functional impor­ phase, to explore the familiar object A and a second novel object C (10 tance of PNNs in the motor system using behavioral, electrophysiolog­ min). The time spent with each object – when an animal sniffed or ical, and histological analysis in Crtl1 KO mice. Elucidating PNN touched it – was measured. Finally, a discrimination index (DI) was function in the spinal cord will improve our understanding of its role in calculated as the difference between the time spent with the novel or fine-tuning synaptic plasticity and stability. familiar objects divided by the total time spent with the two objects at 2, 5 and 10 min cumulatively. A higher DI reflects greater memory 2. Materials and methods consolidation for the familiar object (Bevins and Besheer, 2006). All objects had similar sizes but different shapes and colors. Between trials, 2.1. Experimental design ethanol was applied to the objects to avoid the use of odor cues. Transgenic mice (Crtl1 KO) used in this study were provided by Dr. 2.3.3. Pole test Pizzorusso (Carulli et al., 2010) and maintained in the Animal Service of The pole test is used to evaluate coordination and balance (Ogawa the Universitat Autònoma de Barcelona (UAB). et al., 1985). A pole (50 cm high, 1 cm in diameter) was vertically placed Their generation and phenotype are described by Czipri et al (Czipri on a soft platform, which contains the nesting material of the animal et al., 2003). In brief, Crlt1 KO mice lack for the cartilage link protein 1, home cage to motive the mouse to climb down. Following a brief period encoded by the Crtl1/HAPLN1 gene, which is required for the proper (30 s) of ground exploration, each mouse was placed on the top of the assembly of PNNs (Fig. 1). These Crtl1 KO mice are rescue transgenic pole and the time required to turn head down (T-turn) and descend the mice, in which Crtl1is expressed under the control of the type II collagen pole (T-descend) was measured. A maximum of 120 s was allowed to cartilage-specific promoter and enhancer, resulting in Crtl1 expression complete the task. If the mouse fell from the top of the pole, this trial was in cartilage but depletion in all tissues including the CNS (Carulli et al., discarded. Each mouse underwent 3 consecutive trials. 2010). This specific overexpression is produced to avoid skeletal mal­ formations incompatible with life (Suppl. Fig. 1). They are maintained in 2.3.4. Adapted rotarod a C57BL6/J genetic background. Standard rotarod tests evaluate motor function and coordination Ninety-six female and male adult (8–12 weeks of age) Crlt1 KO mice (Shiotsuki et al., 2010). To also assess motor learning, the test was and their WT littermates were used. A total of 62 mice were used for repeated during 4 consecutive days at a constant velocity of 10 rpm characterization and 34 for evaluating the role of link protein 1 in (Shiotsuki et al., 2010). The day before training sessions, mice were sprouting after SCI. From the 62 mice used for characterization, 20 were habituated to stay on the stopped rotarod for 3 min. This habituation randomly chosen for histological analysis. Since no sex differences were protocol was repeated every test day for 1 min, just before the training detected (Suppl. Fig. 2), data from both sexes was pooled. All experi­ session started. In each session, mice were placed on the rotarod and the ments were blinded to genotype during behavioral testing and histo­ latency to fall was measured. Immediately after falling, mice were logical analysis. placed back on the drum up to 5 times. A fall was overlooked when the The experimental procedures were approved by UAB Experimental animal endured on the drum for 180 s. Finally, the total fall latencies of Ethical Committee (CEAAH) and conducted following the animal wel­ each day were summed and compared between the 4 days and groups. fare guidelines 2010/63/EC of the European Communities Council The habituation and the training session were performed at the same Directive. Mice were housed in groups, at 22 ◦ C (± 2 ◦ C), kept on a 12:12 time of the day. light/dark cycle and received water and food ad libitum. 2.3.5. DigiGait and maximal velocity assessment 2.2. Genotyping The maximal velocity that animals could reach was evaluated on a treadmill. Locomotion kinematics was evaluated through the DigiGait The genotype of mice (Table 1) was determined using mouse tail system (Mouse Specifics, Boston, MA) in which animals were placed 2 J. Sánchez-Ventura et al. 3 Fig. 1. Schematic diagram illustrating the genetic differences between the Crtl1 KO and WT mice and their corresponding PNN structure. WT mice present highly organized and functional PNN. These nets are anchored to neurons by the enzyme hyaluronan synthase, which produces a hyaluronan polymer chain. This chain provides a scaffold for the binding of different types of CSPGs of the lectican family (aggrecan, neurocan, brevican and versican), whose interaction is stabilized by the link protein 1. Finally, the tenascin-R interconnects the different chains of CSPGs, generating a complex structure. The Sema3A protein can bind to the PNN's structure. In the Crtl1 KO mice, the expression of the Crtl1 gene is disrupted by the addition of a Neomycin vector in all cells. In the cartilage, there are normal levels of Crtl1 expression given that these mice overexpress the Crtl1 gene under the control of a cartilage-specific promoter. Crtl1 KO mice present disorganized PNNs due to the lack of the stabilizer link protein 1. Sema3A: semaphorin 3A; WT: wild type; KO: knock- out; PNN: perineuronal nets; Crtl1: cartilage link protein 1; Neo: neomycin. Experimental Neurology 358 (2022) 114220 J. Sánchez-Ventura et al. Experimental Neurology 358 (2022) 114220 Fig. 2. The lack of link protein 1 generates PNNs with altered proportion of their components in the lumbar spinal cord. A. Maximal projection of confocal images showing the expression of different components of PNNs around lumbar MNs: link protein 1 (red), aggrecan (green), semaphorin 3A (red) around Nissl positive-cells (green), neurocan (green) and tenascin-R (red). B. Quantification of the immunolabeling of PNN components. Ntotal = 19 mice. Bar graphs are rep­ resenting the mean values ± SEM. Scale bar: 100 μm. **p < 0.01, ***p < 0.001 by Weltch t-test. Crtl1: cartilage link protein 1; WT: wild type; KO: knock-out. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) onto the treadmill belt at 20 cm/s, based on previous results of our Table 1 laboratory (Mancuso et al., 2011). Only those Crtl1 KO mice that could Genotypes generated. reach that velocity were included in the DigiGait analysis. A high-speed Neomycin Crtl1 MC59 video camera (150 frames/s) located below the transparent belt was WT (Crtl1 +/+) − + − used to monitor around 10–12 strides/animal. Two trials were given to Heterozygous (Crtl1 +/− Crtl1-Tg +/0 or Crtl1 + + +/− each animal to obtain an appropriate video for analysis, which was +/− ) considered when mice walked straight ahead at a constant velocity. KO (Crtl1 − /− Crtl1-Tg +/0) + − + Then, each video was digitized, and the area of the paw was calculated with the DigiGait software. Mistakes of the imaging in which the paw area was not correctly detected were manually corrected. Parameters Table 2 such as the percentage of duration of the stride phases, the ratio between Primer sequences and PCR conditions. the stance and the swing phase, the paw area at the stance phase and the Gene F/ Sequence PCR conditions dA/dT max and dA/dT min were evaluated. R Crtl1 F 5’ 94 ◦ C for 2 min, 35× 2.3.6. Grip strength TAATGACCTTTCCTGTCTCTCC (94 ◦ C for 15 s, 60,5 ◦ C The limb strength of all mice was determined using the grip strength 3’ for 30s, 72 ◦ C for 5 min) R 5’ CCCAAAACCCGTAGTTCC 3′ and 72 ◦ C for 5 min. test (Meyer et al., 1979). For three days, mice were placed on a grid Neomycin F 5’ CTTGGGTGGAGAGGCTATTC 95 ◦ C for 3 min, 35× strength apparatus so they could grab a small grid with their fore and 3’ (95 ◦ C for 30s, 60 ◦ C for both fore and hindlimbs. Afterwards, mice were slowly pulled away R 5’ AGGTGAGATGACAGGAGATC 30s, 72 ◦ C for 45 s) and from the grid until they release it. The maximal peak force was measured 3’ 72 ◦ C for 2 min. using a sensor connected to the grip strength apparatus. Each day, five Crtl1 F 5’ CCTTTCAGACAGCTACACTCC 94 ◦ C for 2 min, 30 x cartilage 3’ (94 ◦ C for 30s, 59 ◦ C for trials of 15 s were performed and averaged. All the values were (MC59) R 5’ 30s, 72 ◦ C for 1 min) and normalized using the body weight of each mouse. AAACACTCGACCTTGATAGCC 72 ◦ C for 5 min. 3’ 2.3.7. Electrophysiological tests To evaluate the state of spinal reflexes, electrophysiological tests were performed under anesthesia (ketamine 90 mg/kg and xylazine 10 mg/kg) since it has negligible effects on electrophysiological recordings (Ho and Waite, 2002). 4 J. Sánchez-Ventura et al. Experimental Neurology 358 (2022) 114220 For stretch reflex measurements, the sciatic nerve was stimulated by to the midline, at 0.5 mm, − 0.5 mm and − 1 mm from Bregma and at a delivering a single electrical pulse of 0.02 ms at supramaximal intensity depth of 0.7 mm ventral to the dura. A 10 μl Hamilton syringe fitted with (Grass S88) by a monopolar needle inserted in the sciatic notch. The a 33 G needle was used. Each injection delivered 0.5 μl of the tracer at a compound muscle action potential (CMAP) of the plantar muscle was velocity rate of 0.25 μl/min and the syringe was left at the site of in­ recorded using a monopolar needle inserted in that muscle. In this jection for 3 min before removal. Two weeks after injection, animals recording, the maximal baseline to peak amplitude of the M wave (Mmax: were euthanized. direct muscle response), initial and final M wave latencies, and the maximum amplitude of the H wave (Hmax: monosynaptic reflex) were 2.6. Histological evaluation measured. Finally, the Hmax/Mmax was calculated as an index of the excitability of the Ia afferent synapses on spinal MNs (Thompson et al., Mice were euthanized (pentobarbital; ip: 200 mg/kg) and trans­ 1992). While M wave values were obtained with supramaximal stimu­ cardially perfused with 4% paraformaldehyde (PFA) in 0.1 M phosphate lations, the Hmax was elicited after progressively increasing the intensity buffer (PB). Spinal cords, brains and tibialis anterior muscles were of the electrical stimulation until reaching the maximal amplitude of the harvested. Spinal cords and brains were post-fixed in 4% PFA over 2 h H wave. The depression profile of the H wave or rate-dependent and overnight (ON), respectively. Afterwards, both tissues were cry­ depression (RDD) was performed following the protocol previously oprotected in 30% sucrose solution in PB at 4 ◦ C until tissue sank, while described (Sánchez-Ventura et al., 2020). tibialis anterior muscles were directly cryopreserved in that solution. Regarding the withdrawal reflex, the ipsilateral polysynaptic reflex For the Crtl1 KO histological analysis, lumbar spinal cords (L4-L5), was elicited by stimulating the sciatic nerve with a pulse of 0.1 ms at a motor cortices (Bregma 0.98 to 1.94) and tibialis anterior muscles were supramaximal intensity and the potentials were recorded at the ipsi­ transversally cut on a cryostat (20 μm thick) and collected onto gelatin- lateral tibialis anterior muscle. The contralateral polysynaptic reflex was coated glass slides. To study PNN components (L4-L5 spinal segment and elicited by stimulating the left tibial nerve at the ankle and recorded at motor cortex), synaptic markers (L4-L5 spinal segment) and muscle fi­ the right tibialis anterior muscle. The maximum amplitude, and the area bers, tissue sections were permeabilized with Phosphate Buffer saline under the curve (Root Mean Square; RMS) of the third component (C3) Triton 0.3% (PBST 0.3%) except for the KCC2 marker, which was per­ were evaluated, which is conveyed by C fibers and found in latencies meabilized with PBST 0.3%-Bovine Serum Albumin 3%. Then, nonspe­ between 18 and 55 ms (Valero-Cabré et al., 2004). cific interactions were blocked with 10% Normal Donkey Serum for 1 h For motor units' evaluation, the mean amplitude of single motor unit at room temperature (RT). Afterwards, sections were incubated ON at activation potentials (SMUA) was assessed. From a subthreshold in­ 4 ◦ C with primary antibodies (Table 3). After washes, immunoreactive tensity, the sciatic nerve was stimulated with pulses that progressively sites were revealed using species-specific secondary antibodies (1:200; increased their intensity and recorded in the plantar and tibialis anterior 2 h RT; Table 3). For Neurocan and Semaphorin 3A (Sema3A) markers, muscle. Increments higher than 50 μV were considered as indicative of the signal was amplified by streptavidin (1:200) and biotin tyramide the recruitment of an additional motor unit. Finally, the mean amplitude (1:60; TSA Biotin System; Perkin Elmer NEL700001KT) for 1 h and 3 of individual motor units was calculated as the average of consistent min, respectively. Finally, sections were coverslipped using increases. Fluoromount-G medium (Southern Biotech). All recorded potentials were amplified and visualized on a digital For sprouting evaluation, the C1 level of the spinal cord was cross- oscilloscope (Tektronix 450S). LabChart Reader software was used for sectioned (20 μm), whereas the rest of the cervical spinal cord was the analysis. longitudinally cut (25 μm). Both types of sections were immunolabeled to detect the BDA tracer. For BDA detection, sections were initially 2.4. Spinal cord injury washed with TBS-Tween 0.1 and then, endogenous peroxidases were blocked for 10 min. Next, we incubated the streptavidin-HRP (1:200) for To determine the potential of the corticospinal axons to sprout and 1 h at RT. After several washes, the signal was amplified incubating the grow after injury, a unilateral dorsal hemisection at the C4 level (HxC4) biotin tyramide (1:50) for 7 min and visualized with Alexa Fluor 488- was performed. Before the injury, the following experimental groups streptavidin (1:200) after 1 h at RT. were randomly generated: WT sham (n = 6); WT+ HxC4 (n = 12); Crtl1 KO sham (n = 10); Crtl1 KO + HxC4 (n = 6). 2.6.1. Image analysis For the surgical procedure, mice were anesthetized using an intra­ To analyze PNN components and synaptic markers, images were peritoneal injection (i.p.) of ketamine (90 mg/kg) and xylazine (10 mg/ taken from 4 spinal cord (L4-L5) or brain sections (motor cortex) using a kg) in saline solution. After skin and muscle incision, a laminectomy of confocal laser-scanning microscope (around 30 steps, z-step size of 0.5 segment C3-C4 was performed to expose the spinal cord. Then, a uni­ μm, Leica TCS SP5) at 40× for each mouse. To quantify PNNs and lateral dorsal hemisection of the left C4 spinal cord was done, using synaptic changes, a minimum of 30 MNs (located within the ventral small scissors, to a depth of 1.0 mm to completely sever the dorsolateral horn and presenting an area > 350 μm2 (Friese et al., 2009)) were corticospinal tract. To ensure that the lesion was complete, the scissors measured for each animal. PNN analysis was performed as described were passed through the dorsal part of the spinal cord three times. After before (Sánchez-Ventura et al., 2020). In brief, the maximal projection surgery, animals received 1 ml of saline solution subcutaneously. For of the z-stacks was performed and then, the background was corrected. pain management, subcutaneous injections of buprenorphine (0.1 mg/ Then, a band of 4 μm around the cell body of MNs was delimited to kg) were administered. Mice were kept on a 38 ◦ C heating pad during measure the integrated density of that region. For synaptic measure­ the surgical procedure and until they were fully awake. ments, VGlut1 (vesicular glutamate transporter 1) and VGAT (vesicular GABA transporter) + synaptic boutons presented in a band of 4 μm 2.5. Biotinylated dextran amine tracing around the selected MN were measured by integrated density. Synaptic competition between proprioceptive afferents and C-boutons (Jiang To anterogradely label the axons of the corticospinal tract (CST), 1,5 et al., 2016) was assessed by counting the number of VGlut1 positive μl of the neuronal tracer biotinylated dextran amine (BDA; 10,000 MV; synaptic boutons and C-boutons positive dots presented in the whole 10% in PB; Thermo Fisher) were injected in the left motor cortex. photograph. Briefly, 7 days after injury, mice were deeply anesthetized with keta­ For spinal MN analysis, slides corresponding to L4-L5 spinal cord mine/xylazine (see above) and placed in a stereotaxic device to perform sections separated 200 μm each were stained using ChAT (choline ace­ the craniotomy and the injection of the tracer. The injection was set up tyltransferase) and MMP9 (matrix metalloproteinase 9) antibodies. The in three points of the left motor cortex (ipsilateral to SCI): − 1 mm lateral number of lumbar MN was determined by counting the number of 5 J. Sánchez-Ventura et al. Experimental Neurology 358 (2022) 114220 Table 3 List of primary and secondary antibodies used in the histological analysis. Primary antibodies Secondary antibodies Antibody Dilution Host Reference Antibody Host Reference Aggrecan (Cat301) 1:100 Mouse MAB5284- Sigma Aldrich Alexa Fluor 488 Donkey x Mouse A21202 - Invitrogen Link protein 1 1:100 Goat AF2608-SP, R&D systems Alexa 594 Donkey x Goat A11058- Invitrogen Sema3A 1:400 Goat OASG06564 – Aviva Systems biology Streptavidin- Cys3 43–4315- Zimed Neurocan 1:50 Sheep AF5800- R&D systems Strepatividin 488 S11223- Invitrogen Tenascin- R 1:200 Goat AF3865- R&D systems Alexa Fluor 594 Donkey x Goat A11058- Invitrogen VGlut1 1:300 Guinea Pig AB5905- Millipore Cys 3 Donkey x Guinea Pig 706–165-148- Jackson VGAT 1:1000 Rabbit 131,002- Synaptic systems Alexa Fluor 488 Donkey x Rabbit A21206-Invitrogen KCC2 1:400 Rabbit 07–432- Millipore Alexa Fluor 594 Donkey x Rabbit A21207- Invitrogen ChAT 1:50 Goat AB144P, Millipore Alexa Fluor 488 Donkey x Goat A 11055-Invitrogen MMP9 1:200 Rabbit ab38898, Abcam Cys 5 Donkey x Rabbit 711–175-152- Jackson Collagen IV 1:100 Mouse M3F7, Hybridoma Bank Alexa Fluor 594 Donkey x Mouse A21203 - Invitrogen ChAT+ cells located in lamina IX of grey matter (bilaterally). The per­ the collagen IV staining – in 5 regions of 0,8043 μm2 (captured at 20×) centage of MMP9+ cells was then calculated from the total of ChAT+ in a single muscle section. Then, the total area of the muscle slice neurons. To quantify KCC2 staining at the dorsal horn, confocal images (captured at 4×) was used to estimate the total number of muscle fibers. were obtained at 40× and the integrated density of the whole immu­ Two tibialis anterior muscle sections were used in each animal and noreactivity was measured. For the VGlut1 marker, images were obtained results were averaged. captured at 20× and the integrated density of immunoreactivity was To evaluate the sprouting of contralateral axons induced by the measured in a region of interest (ROI) of 0.175 mm2. After background cervical injury, we first estimated the number of traced axons of the CST. correction, the threshold was defined for all the microphotographs of the Images from C1 sections containing the BDA tracer were taken at 40× same marker. and the total number of traced axons of the CST was counted in two The estimated number of muscle fibers found in the tibialis anterior different sections and averaged. Longitudinal sections were captured at muscle was calculated counting the number of fibers – delimitated by 10× and then, the count of CST collaterals was performed at C3-C6 over Fig. 3. Characterization of PNN components in the motor cortex of the Crtl1 KO mice. A. Confocal images in which cortical PNNs are stained against the link protein 1 (red), aggrecan (green), tenascin-R (red) and neurocan (red). B. Quantification of the immunolabeling of aggrecan and tenascin-R around neurons. Neurocan quantification is not shown due to the little staining found in the WT group. Ntotal = 10 mice. Bar graphs are representing the mean values ± SEM. Scale bar: 100 μm. Significant different were neither found by unpaired t-test (aggrecan) nor Weltch t-test (tenascin-R). Crtl1: cartilage link protein 1; WT: wild type; KO: knock-out. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) 6 J. Sánchez-Ventura et al. Experimental Neurology 358 (2022) 114220 14 sections (separated by 50 μm each), and thus, evaluating a total seemed more diffuse than in WT animals, suggesting a less dense PNN. extension of 700 μm of the spinal cord. Finally, the number of traced Moreover, aggrecan was only distributed around the soma, with almost axons at C1 was used to normalize the sprouting in each animal. no staining around dendrites (Fig. 2A), consistent with the motor cortex Image analysis was performed by Fiji software. (Fig. 3A, B). In addition, Sema3A staining at lumbar levels was reduced although not significantly in Crtl1 KO compared to WT mice (p = 0.06; Fig. 2A, B). Finally, Crtl1 KO mice showed a marked reduction of neu­ 2.7. Statistical analysis rocan (p < 0.001) and increased tenascin-R (p < 0.001) in the spinal cord (Fig. 2B). Notably, the tenascin-R increase was also visible across Data is analyzed using GraphPad Prism 7 software and shown as the grey matter parenchyma (Fig. 2A). In contrast, the expression of mean ± standard error of the mean (SEM). Differences were considered tenascin-R moderately decreased in cortical PNNs of Crtl1 KO mice, significant when p < 0.05. Shapiro-Wilk test confirmed a normal dis­ albeit not significantly (Fig. 3B). Neurocan was not quantified in the tribution of each response variable/group. Thus, functional results were motor cortex due to the faint staining observed in the WT group analyzed by Student's t-test (unpaired), since variables presented equal (Fig. 3A). variance except for the adapted rotarod, pole test, DigiGait analysis, grip strength and NORT which were analyzed by two-way ANOVA repeated measures followed by pairwise post-hoc contrast with Bonferroni 3.2. Crtl1 KO mice presented reduced body weight and hypoactivity adjustment of p values. Histological results were analyzed by Student's t- test except for the MN distribution and the VGlut1 analysis at the dorsal Crtl1 KO mice of both sexes had significantly less weight compared to horn that were evaluated by two-way ANOVA with same post-hoc as WT mice (p < 0.01 in males and p < 0.001 in females; Fig. 4A). Evalu­ above. Considering Student's t-test for histological analysis, those vari­ ation of general overground locomotion (Open field arena) revealed that ables that did not present equal variance (PNN analysis) were evaluated Crtl1 KO mice were hypoactive since their travel distance (p < 0.001), by Weltch t-test. locomotor velocity (p < 0.001) and time locomoting (p < 0.001) were reduced compared to WT mice. Similarly, Crtl1 KO mice showed reduced explorative behavior, with fewer rearings (p < 0.001) (Fig. 4B). 3. Results 3.1. The lack of link protein 1 altered PNN composition in the spinal cord 3.3. Animals lacking link protein 1 displayed impaired locomotion, motor coordination and abnormal gait performance We first corroborated the absence of link protein 1 in the central nervous system of Crtl1 KO mice. Immunofluorescence of the link pro­ The observed hypoactivity prompted us to investigate whether it was tein 1 was neither detected in the lumbar spinal cord (Fig. 2A) nor the caused by motor deficits. We addressed this using some complementary motor cortex (Fig. 3A). Since link protein 1 is implicated in the assembly functional motor tests that allow us to evaluate motor coordination, of PNNs, we next studied PNN components of the Crtl1 KO mice by locomotion, and motor learning. Animals lacking link protein 1 could immunolabeling aggrecan, neurocan, Sema3A and tenascin-R in lumbar not reach the maximum velocity values obtained by WT mice on a spinal cord samples (Fig. 2A). No significant differences in the intensity treadmill (p < 0.001, Fig. 5A). Adapted rotarod gives us information of aggrecan labeling between WT and Crtl1 KO mice were observed about motor coordination and motor learning. We found that Crtl1 KO (Fig. 2B). Nevertheless, the aggrecan distribution in Crtl1 KO mice mice could not stay as long on the rotarod as WT mice (significantly Fig. 4. Crtl1 KO mice present reduced weight and hypoactivity assessed by Open Field test. A. Males and females Crtl1 KO mice presented reduced body weight. B. Open Field test revealed that Crtl1 KO present hypoactivity observed in the total distance traveled, average velocity, percentage of time in movement and number of rearing performed in 5 min. Ntotal = 44 mice. Bar graphs are representing the mean values ± SEM. **p < 0.01, ***p < 0.001 by unpaired t-test. WT: wild type; KO: knock-out. 7 J. Sánchez-Ventura et al. Experimental Neurology 358 (2022) 114220 Fig. 5. Crtl1 KO mice displayed altered locomotor activity, coordination, and motor learning. A. Evaluation of the maximum velocity reached by Crtl1 KO and WT mice on a treadmill. Ntotal = 35 mice. B. Quantification of the daily amount of time (latency) of Crtl1 KO and WT mice sustained performance in the adapted rotarod during four consecutive sessions. Ntotal = 30 mice. C. Photographs representing the two possibilities to climb down the pole: turning 180◦ (WT mice) or climbing down in a horizontal position (Crtl1 KO mice). D. Representation of the time required for the Crtl1 KO and WT mice to turn down (T-turn) and descend the pole (T-descend) in three consecutive trials. Ntotal = 38 mice. E. Assessment of the grip strength of the forelimb and the 4 paws of Crtl1 KO and WT mice for three days. Ntotal = 14 mice. Data are representing the mean values ± SEM. ***p < 0.001 by unpaired t-test for the maximum velocity and **p < 0.01, ***p < 0.001 by two-way ANOVA (Adapted rotarod: time F3,123 = 53.72, p < 0.001; group F1,41 = 19.76, p < 0.001; interaction F3,123 = 12.66, p < 0.001; T-turn: time F2,72 = 24.63, p < 0.001; group F1,36 = 27.34, p < 0.001; interac­ tion F2,72 = 20.82, p < 0.001; T-descend: time F2,72 = 27.79, p < 0.001; group F1,36 = 39.67, p < 0.001; interaction F2,72 = 20.93, p < 0.001) followed by post hoc test with Bonferroni correction. Crtl1: cartilage link protein 1; WT: wild type; KO: knock-out. different in the last two days of testing (p < 0.001; Fig. 5B)). Perfor­ (Fig. 5E; p > 0.05). mance of WT mice on the rotarod also improved over four consecutive Considering the marked motor discoordination observed, DigiGait days whereas Crtl1 KO mice exhibited limited improvement (interaction was used for walking pattern analysis in both genotypes. Percentages of effect over time: p < 0.001; day 1 vs 2 WT and KO p > 0.05; day 2 vs 3 the stride phases in the Crtl1 KO mice were altered in both forelimb (p < WT p < 0.001, KO p > 0.05; day 3 vs 4 WT p < 0.01, KO p > 0.05). 0.001 in brake and p < 0.05 in propulsion phase) and hindlimb (p < During the pole test (also for motor coordination), WT mice turned 180◦ 0.001 in swing and propulsion phase) compared to WT mice. Conse­ to orient themselves downward and descend the pole, whereas almost quently, these alterations decreased the stance/swing ratio in the hin­ all Crtl1 KO mice failed to turn 180◦ and descended in a horizontal dlimb of Crtl1 KO mice compared to WT mice (p < 0.001). The plantar position (Fig. 5C). The analysis showed that Crtl1 KO mice spend more placement of the hindlimb of Crtl1 KO mice was also reduced, repre­ time turning down (T-turn; 1st trial p < 0.001 and 2nd trial p < 0.01) sented as a smaller paw area compared to WT mice. dA/dT min and max and descending the pole (T-descend) (both trials p < 0.001) compared to refer to the maximal rate of change of paw area in contact with the WT mice (Fig. 5D). In contrast, Crtl1 KO mice did not present alterations treadmill belt during the propulsion and braking phase, respectively. in the limb strength evaluated by the grip strength test compared to WT Thus, dA/dTmin shows how rapidly the animal can propel itself into the 8 J. Sánchez-Ventura et al. Experimental Neurology 358 (2022) 114220 Fig. 6. Crtl1 KO mice showed altered gait performance. A. Scheme of the experimental procedure in which mice run on a treadmill bell at 20 cm/s and their paws (marked in orange) are analyzed. B. Schematic representation of the different phases of the stride. The stride is divided into two parts: the swing and the stance phase, the latter is further divided into the brake and propulsion phase. The swing phase coincides when there is no paw contact with the treadmill belt. The brake phase includes from the initial paw contact to the maximum paw contact and the propulsion phase includes from the maximum paw contact to just before the swing phase starts. C. Gait analysis: representation of the % of duration of the different phases of the stride in both fore and hindlimb, the Stance/swing ratio, the maximum paw area at the peak, and the rate of change of paw area contact with the treadmill belt (dA/dT). Ntotal = 23 mice. Bar graphs are representing the mean values ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 by two-way ANOVA (Forelimb stride: time F2,92 = 13.12, p < 0.001; group F1,46 = 1.476, p = 0.231; interaction F2,92 = 8.03, p = 0.006; Hindlimb stride: time F2,92 = 1096, p < 0.001; group F1,46 = 3.138e-010, p > 0.99; interaction F2,92 = 13.27, p < 0.001; Stance/swing: time F1,46 = 17.96, p < 0.001; group F1,46 = 20.74, p < 0.001; interaction F1,46 = 14.48, p = 0.004; Paw area at peak: time F1,46 = 1239; p < 0.001; group F1,46 = 12.73, p = 0.009; interaction F1,46 = 32.52, p < 0.001; dA/dTmin: time F1,46 = 378.2, p < 0.001; group F1,46 = 0.147, p = 0.703; interaction F1,46 = 21.77, p < 0.001; dA/dTmax: time F1,46 = 1599; p < 0.001; group F1,46 = 12.78, p < 0.001; interaction F1,46 = 29.06, p < 0.001) followed by post hoc test with Bonferroni correction. WT: wild type; KO: knock-out; Propul: propulsion. 9 J. Sánchez-Ventura et al. Experimental Neurology 358 (2022) 114220 next step, while dA/dt max shows how quickly the limb is loaded during evaluating short- and long-term memory using the NORT (Suppl. the initial period of stance (Fig. 6B). Our data demonstrated that Crtl1 Fig. 3A). Crtl1 KO mice had a greater ability to recognize a new object in KO mice presented altered values in both parameters compared to WT the short-term memory test (p < 0.05 at 2 min) but showed impaired mice (Fig. 6C) in the forelimb (p < 0.05 in dA/dT min analysis) and long-term memory consolidation (p < 0.01 at 2 min; Suppl. Fig. 3B). hindlimb (p < 0.01 in the dA/dTmin and p < 0.001 in the dA/dT max). Since PNNs have already been described to have a role in memory 3.4. Crtl1 KO mice presented increased excitability of spinal reflexes consolidation (Nadine et al., 2009; Fawcett et al., 2019), we corrobo­ rated the altered functionality of PNNs in our Crtl1 KO mice by Electrophysiological tests were used to assess if the motor Fig. 7. Crtl1 KO mice presented increased excitability of spinal circuits observed in both monosynaptic and polysynaptic spinal reflexes. A. Representative image of the recordings studied. At the left side of the image, it is represented the different components of the compound muscle action potential (CMAP): the M and the H wave. These waves are measured to evaluate the stretch reflex (monosynaptic). Ntotal = 62 mice. The colored arrows represent the onset (yellow) and final (green) latencies of the M wave. At the right side of the image, the C3 component of the withdrawal reflex is represented, whose maximum amplitude and the area under the curve are analyzed. B. Quantification of the onset and final latencies of the M wave studied in the plantar muscle. C. H/M ratio studied in the plantar muscle. D. Representative electromyographs showing the CMAP in the WT and Crtl1 KO mice. E. Depression profile of the H wave after consecutive stimulations at different frequencies. F. Evaluation of the area under the curve (RMS) and maximum amplitude of the C3 component of the withdrawal reflex, recorded at the ipsilateral tibialis anterior muscle. Ntotal = 32 mice. G. Representative electromyographs showing the C3 component of the withdrawal reflex in the WT and Crtl1 KO mice. Data are representing the mean values ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 by unpaired t-test. No significant differences were found in the depression of the H wave (RDD) analyzed by two-way ANOVA (time F3,180 = 926.8, p < 0.001; group F1,60 = 0.514, p = 0.476; interaction F3,180 = 0.781, p = 0.506) followed by a post hoc test with Bonferroni correction. Crtl1: cartilage link protein 1; WT: wild type; KO: knock-out. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) 10 J. Sánchez-Ventura et al. Experimental Neurology 358 (2022) 114220 impairments observed in the Crtl1 KO mice were linked to alteration in Fig. 9D). Altogether, these results suggested that Crtl1 KO presents a spinal networks. Stimulation of the sciatic nerve elicited a M wave with shift in the lumbar MN pool composition, leading to an increase in slow reduced initial (p < 0.05) and final latency (p < 0.01) in Crtl1 KO mice motor units and a decrease in fast ones. compared to WT mice (Fig. 7B). Regarding the stretch reflex (or H-re­ To evaluate the functional repercussion of this shift, motor unit flex), Crtl1 KO mice exhibited an increased H/M ratio compared to WT recruitment and muscle properties were assessed (Suppl. Fig. 6). Crtl1 mice (p < 0.001). Since the stretch reflex is a monosynaptic reflex in KO mice presented a higher mean amplitude of their motor units which only proprioceptive (Ia) afferences and MNs participate, this (SMUA) compared to WT mice in both plantar (p < 0.01) and tibialis hyperexcitability could be caused by an alteration of local circuitry anterior muscle (p < 0.001). At the muscle level, Crtl1 KO mice showed between MNs and Ia afferences, or inhibitory descending pathways. a reduced number of muscle fibers in the tibialis anterior muscle (p < These inhibitory descending pathways regulate the amount of pre- 0.05), as well as a reduction in the weight of the muscle studied (p < synaptic inhibition that Ia afferents received and thus, indirectly 0.05 in absolute values and p < 0.001 related to the body weight). adjust the stretch reflex (Faist et al., 1994). To elucidate the origin of this hyperexcitability, we studied the state of inhibitory descending path­ 3.7. Crtl1 KO mice displayed increased corticospinal sprouting after ways by evaluating the RDD of the H wave. Given that Crtl1 KO and WT spinal cord injury mice presented a similar pattern of depression, we assumed that these descending pathways were unaffected (Fig. 7E). Thus, the hyperexcit­ To further evaluate the impact of cartilage link protein 1 on motor ability observed in the H/M ratio may be caused by a change at the local function, we next studied the corticospinal tract (CST) and its potential MN circuitry. Next, the polysynaptic withdrawal reflex was evoked at to sprout after SCI (Suppl. Fig. 7A). No significant differences were the tibialis anterior muscle and assessed by C3 component evaluation found in the number of fibers traced CST fibers between groups (Fig. 7G). Increased hyperreflexia in both the ipsilateral (p < 0.01; measured at C1 spinal level (Suppl. Fig. 7B, C). After unilateral dorsal Fig. 7F) and contralateral side (Suppl. Fig. 4) was observed in transgenic hemisection at the C4 level, the contralateral CST of Crtl1 KO mice animals compared to WT group, indicating a general hyperexcitability of showed increased sprouting of spared axons below the injury level the spinal reflex circuits in Crtl1 KO mice. compared to WT mice (p < 0.05). Once contralateral axons reached the denervated side of the cord, a high density of small axons was found near 3.5. Mice with aberrant PNNs exhibited a general increase in excitatory the midline rather than observing long sprouts crossing the grey matter. but not inhibitory synapses No significant differences were observed in the percentage of contra­ lateral projections between uninjured groups (Suppl. Fig. 7D, E). To complement the functional analysis and further study spinal cir­ cuits, we evaluated the composition of spinal synapses in Crtl1 KO mice. 4. Discussion We found that lumbar MNs from Crtl1 KO mice received a greater number of excitatory (VGlut1), but not inhibitory (VGAT) inputs Although most spinal MNs are wrapped by PNNs, their functional compared to WT mice (Fig. 8A, B; p < 0.001 in the VGlut1 analysis). In role and the impact of their degradation remain largely unexplored. contrast, however, KCC2, whose reduction is a hallmark of hyperexcit­ However, ChABC application on the spinal cord has been used exten­ ability (Boulenguez et al., 2010), was unaltered in the Crtl1 KO group sively in experimental models to promote axonal growth post-SCI (Fig. 8A, B). Therefore, the hyperexcitability observed in the electro­ (Bradbury et al., 2002; Fawcett, 2015). Thus, our goal was to assess physiological test could be caused by an increase in excitatory inputs. the role of spinal PNNs on motor spinal networks. Consistent with this, the increased expression of VGlut1 was also notable in the dorsal horn of Crtl1 KO mice (p < 0.001). Of note, Crtl1 KO mice 4.1. Crtl1 KO mice show aberrant PNNs with an altered proportion of showed increased KCC2 staining in the dorsal horn (p < 0.001; Suppl. their components Fig. 5). Given that motoneurons from Crtl1 KO mice presented a high num­ To study the role of PNNs, we used Crtl1 KO mice as they lack the ber of proprioceptive inputs (VGlut1), we wondered whether this in­ Crtl1/HAPLN1 gene, which encodes the cartilage link protein 1, crucial crease could impact on the number of C-boutons (marked with ChAT) for PNNs formation during development. Once PNNs are formed, link received (Fig. 8C). We observed an increase of both VGlut1 and C- proteins stabilize the interaction between CSPGs to the hyaluronan boutons in MNs from Crtl1 KO compared to WT mice (p < 0.001; backbone in the net structure (Spicer et al., 2003). In the present work, Fig. 8D), suggesting a general increase of excitatory synapses around we have found that aggrecan can still accumulate around the neuronal MNs with aberrant PNNs. soma despite the lack of link protein 1, generating aberrant PNNs in these Crtl1 KO mice. Similar findings were reported by Carulli et al in the 3.6. Altered PNNs modified the lumbar motoneuron size and motor unit brain (Carulli et al., 2010). The presence of aggrecan allowed tenascin-R properties to attach to the remaining CSPGs and hence, contribute to this aberrant PNN deposition. In contrast, neurocan was almost absent in PNNs of We discarded that the motor impairment was caused by MN loss as Crtl1 KO mice. These altered PNNs were also found in neurons of the we did not find differences in the number of ChAT+ cells between motor cortex. Thus, Crtl1 KO mice presented aberrant PNNs with groups (Fig. 9A). However, we noticed a reduction in the mean area of disorganized morphology and altered proportion of their components. motoneuron soma of Crtl1 KO compared to WT animals (p < 0.001; Fig. 9B). This reduction could be mediated by a general reduction in the 4.2. Aberrant PNNs increase the excitability of spinal circuits somatic area of all motoneurons or due to a decrease in the percentage of bigger neurons. Thus, we generated a distribution graph representing PNNs are highly organized structures that play a crucial role in sta­ the number of MN found depending on their size. Fig. 9C revealed a bilizing mature synapses initially formed during development. In our significant increase in the number of small MNs (between 300 and 450 study, Crtl1 KO mice showed an increased number of excitatory, but not μm) and a reduction in large MNs (between 650 and 750 μm) in Crtl1 KO inhibitory synapses around lumbar MNs. One of the mechanisms that compared to WT mice (p < 0.01, p < 0.001). To confirm whether this allow PNNs to restrict synapse formation is the expression of Sema3A change in soma size is related to MN physiological properties, we stained (Vo et al., 2013). In our KO mice, we found a slight reduction of Sema3A MNs with anti-MMP9, a marker of MN from fast motor units (Kaplan in PNNs, which could partially facilitate synaptogenesis. The reduced et al., 2014) (Fig. 9E). We found a reduction in the percentage of levels of neurocan could also lead to this increased synaptic content MMP9+/ChAT+ cells in Crtl1 KO compared to the WT group (p < 0.05; since it contributes to neuronal outgrowth inhibition (Shen et al., 2009). 11 J. Sánchez-Ventura et al. Experimental Neurology 358 (2022) 114220 Fig. 8. Crtl1 KO mice exhibited a general increase in excitatory synapses around lumbar motoneurons. A. Confocal images representing synapses around lumbar motoneurons (VGAT and VGlut1) and the KCC2 transporter anchored in motoneurons membrane. B. Quantification of the integrated density of the immunoreactive staining around lumbar motoneurons. C. Confocal images showing the amount of proprioceptive afferents (VGlut1) and C-boutons (ChAT) in Crtl1 KO and WT mice. D. Quantification of the number of VGlut1 and CHAT-positive dots and their ratio. Scale bar: 100 μm. Ntotal = 20 mice. Bar graphs are representing the mean values ± SEM. **p < 0.01, ***p < 0.001 by unpaired t-test. VGlut1: vesicular glutamate transporter 1; VGAT: vesicular GABA transporter; ChAT: choline acetyltransferase; Crtl1: cartilage link protein 1; WT: wild type; KO: knock-out. 12 J. Sánchez-Ventura et al. Experimental Neurology 358 (2022) 114220 Fig. 9. The lack of link protein 1 modified the properties of lumbar motoneurons. Quantification of the number of ChAT-positive cells/ section of the lumbar spinal cord (A) and the neuronal soma area (B). C. Motoneuron distribution of 55–70 motoneurons/animal based on the neuronal soma surface area. D. Percentage of ChAT-positive cells stained against the MMP9 marker. E. Representative microphotographs of the ventral horn of the lumbar spinal cord in which ChAT-positive (green) and MMP9-positive (purple) are shown. Scale bar: 100 μm. Ntotal = 20 mice. Data are representing the mean values ± SEM. *p < 0.05, ***p < 0.001 by unpaired t-test. **p < 0.01, ***p < 0.001 by two-way ANOVA (time F21,336 = 47.31, p < 0.001; group F1,16 = 1.012, p = 0.329; interaction F21,336 = 5.684, p < 0.001) followed by post hoc test with Bonferroni correction. ChAT: choline acetyltransferase, MMP9: matrix metalloproteinase 9; Crtl1: cartilage link protein 1; WT: wild type; KO: knock-out. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) This increased synapse formation was also observed in mice lacking effects (Glykys et al., 2014). Similarly, the presence of the tenascin-R different PNN components (Geissler et al., 2013) and after ChABC in­ protein, which regulates GABA release (Saghatelyan et al., 2000), can jection (Pyka et al., 2011). Interestingly, ChABC application modifies also contribute to the maintenance of inhibitory synapses in these both inhibitory and excitatory neurotransmission. The lack of inhibitory transgenic animals. Thus, the altered composition of PNNs on Crtl1 KO inputs in our transgenic mice could be attributed to the buffering role of mice produce an increased number of excitatory but not inhibitory PNNs conferred by the negative charge of their CSPGs. Both CSPG synapses. digestion and PNN reduction around denervated neurons after SCI Specifically, we observed and increase of VGlut1-labeled boutons, change the transmembrane Cl- gradient, altering GABAergic neuro­ corresponding to proprioceptive contacts (Alvarez et al., 2004). In fact, transmission (Geissler et al., 2013; Hirono et al., 2018; Sánchez-Ventura PNN breakdown has been associated with altered glutamatergic trans­ et al., 2020). However, Crtl1 KO mice had CSPGs accumulating around mission (Frischknecht et al., 2009). We also observed an increased the neuronal soma, whose negative charge can still have functional amount of C-boutons, corresponding to cholinergic interneurons (Witts 13 J. Sánchez-Ventura et al. Experimental Neurology 358 (2022) 114220 et al., 2014). This finding is quite interesting since prior work has sug­ our study, Crtl1 KO mice exhibited impaired memory consolidation, but gested that cholinergic and proprioceptive inputs compete for contact improved ability to recognize a new object, as previously described spinal MNs, dependent on neural activity. Thus, increased activity in (Romberg et al., 2013). However, this is the first time that motor proprioceptive terminals should correlate with fewer cholinergic inputs learning has been assessed in the context of spinal PNNs. and vice versa (Jiang et al., 2016). Our findings suggest that this syn­ Overall, the present work demonstrates the involvement of PNNs in aptic competition was absent in Crlt1 KO mice, where both VGlut1 and motor function through properly wiring spinal circuits and determining C-bouton inputs were increased, probably because MNs with altered the identity of lumbar MNs. Nevertheless, alteration of PNNs located in PNNs have more synaptic space available. Nevertheless, these newly brain regions related to motor control, as well as the skeletal abnor­ formed synapses might not be functional (Geissler et al., 2013). malities described in these mice (Czipri et al., 2003), can contribute to The increase in excitatory synapses found in the ventral and dorsal this motor impairment. horn can foster a more excitable milieu in the developmental spinal cord, that can affect MN maturation and motor circuitry function. Crtl1 4.4. Aberrant PNNs increase sprouting after spinal cord injury KO mice showed an increased number of small MNs and a reduction of larger ones. The increased excitability found in the spinal cord of KO The role of PNNs in restricting plasticity has been known for decades mice may affect the physiological properties of α-MNs during develop­ (Pizzorusso, 2002). In fact, ChABC application has been widely used to ment, directing the maturation of MNs into a more excitable phenotype, promote axon growth. When it is applied in a denervated sensory nu­ compatible with smaller MNs (de Martínez-Silva et al., 2018). In fact, cleus of the brainstem after a cervical SCI, an increased collateral fast and slow MNs have different excitability, and this can already be sprouting is observed (Massey et al., 2006). Increased plasticity was also distinguished in the neonatal stage based on their firing pattern (Manuel observed in our Crtl1 KO mice, shown by enhanced sprouting of spared and Zytnicki, 2019). Since PNNs can affect this firing pattern, and contralateral axons after injuring the corticospinal tract. Therefore, al­ aberrant PNNs increase the membrane capacitance leading to excitable terations of PNNs generate a growth permissive environment for axons changes (Tewari et al., 2018), it is plausible that altered PNNs generate a to sprout after injury. However, the application of ChABC has a stronger slow MN-like firing pattern that increases the percentage of MNs impact on the sprouting of spared axons compared to our Crtl1 KO mice, maturing towards a slower profile. In fact, the role of PNNs in neural based on the percentage of sprouting of contralateral axons below the maturation was already described in parvalbumin-positive cells injury (Starkey et al., 2012). This can be due to the incomplete loss of (Sugiyama et al., 2008; Beurdeley et al., 2012). Overall, a correct PNN CSPGs around Crtl1 KO mice's neurons, that inhibits neural regeneration composition might be crucial for the function and identity of MNs, and (Shen et al., 2009). Moreover, ChABC acts on all CSPGs in the CNS, their disorganization can affect the role and the connectivity of these although only 2% are in PNNs (Fawcett, 2015), facilitating a more neurons. plastic milieu and hindering the distinction of the effects of modifying These changes in the properties of lumbar MNs have an impact on PNNs or the whole ECM. Hence, despite aberrant PNNs lead to detri­ neuromuscular function. Indeed, the loss of fast MNs, which tend to mental effects at the locomotion level, they are beneficial promoting innervate more and larger muscle fibers (Manuel and Zytnicki, 2019), regeneration after a SCI. Thus, any therapeutical modulation of spinal can explain the decreased number of muscle fibers and the reduced PNNs must consider the balance between synaptic integrity and weight of the tibialis anterior muscle. To compensate the loss of fast plasticity. MNs, slow MNs would comparatively innervate more fibers than WT mice generating bigger amplitudes and thus, becoming larger than the 5. Conclusion ones from WT mice (Suppl Fig. 6). However, these small changes did not have a functional repercussion on the muscle force assessment. The present study demonstrates that aberrant PNNs enhance excit­ atory synapses and change the physiological properties of lumbar MNs, 4.3. The disruption of spinal circuits leads to motor impairment overall altering spinal circuits and producing motor impairment. This disorganization generates a permissive scenario for contralateral axons By electrophysiological tests, we evaluated monosynaptic and poly­ to sprout after SCI. Thus, new strategies to promote regeneration after synaptic reflexes and we observed an increased excitability in the spinal injury require a more refined PNN modulation to strike an accurate circuits of Crtl1 KO mice. We also detected a reduction in both initial and balance between promoting plasticity and maintaining the beneficial final latencies of M wave in Crtl1 KO mice compared to WT. However, properties of PNNs. In conclusion, PNNs' malleability makes them a this reduction is unlikely to be related to altered nerve conduction ve­ potential therapeutic target to treat neural disorders in which plasticity locity, since the formation of the nodes of Ranvier depends on link and stability are key elements to consider. protein 2 expression (Bekku et al., 2010). Neurocan reduction could Supplementary data to this article can be found online at https://doi. indirectly affect the structure of the node of Ranvier, which is also rich in org/10.1016/j.expneurol.2022.114220. CSPGs (Bekku and Oohashi, 2011), but we think that these shorter la­ tencies can be easily explained by the reduced size of Crtl1 KO mice. Author contribution Moreover, Crtl1 KO mice presented hypoactivity and impaired motor function in the different functional tests performed. The hypoactivity JSV contributed to the design of the experiments, performed the observed could be explained by fewer fast MNs, which innervate rapidly experiments, analyzed the data, and wrote the original draft of the contracting motor units (Olson and Swett Jr., 1969). The motor manuscript. CC and JH contribute to the design and analysis of the impairment was confirmed in the rotarod and pole tests, after observing behavior experiments and reviewed and edited the manuscript. CP that Crtl1 KO mice could not reach the maximum velocity obtained by performed some of the surgical procedures and reviewed and edited the WT, lasted a shorter time in the rotarod and needed more time to manuscript. XN supervised some of the electrophysiological tests and descend the pole. These results together with the gait abnormalities analysis of data and reviewed and edited the manuscript. KF and ATE observed in the DigiGait analysis suggested impaired motor coordina­ contributed to the design of the experiments, analysis of the data and tion in mice with altered PNNs. Similar functional outcomes were re­ reviewed and edited the manuscript. EU acquired the funding, designed ported by Freitag et al. in animals with altered PNNs (Freitag et al., the study, contributed to the analysis of the data, and reviewed and 2003). Crtl1 KO mice also present altered motor learning, assessed by edited the manuscript. the adapted rotarod. Learning and memory processes have been studied in the brain of animals with altered PNNs (Montag-Sallaz and Montag, 2003) or after ChABC administration (Hylin et al., 2013; Tsien, 2013). In 14 J. Sánchez-Ventura et al. Experimental Neurology 358 (2022) 114220 Declaration of Competing Interest de Martínez-Silva, M.L., Imhoff-Manuel, R.D., Sharma, A., Heckman, C.J., Shneider, N.A., Roselli, F., Zytnicki, D., Manuel, M., 2018. Hypoexcitability precedes denervation in the large fast-contracting motor units in two unrelated mouse models of ALS. Elife 7, Authors declare no conflict of interest. 1–26. Dick, G., Liktan, C., Alves, J.N., Ehlert, E.M.E., Miller, G.M., Hsieh-Wilson, L.C., Data availability Sugahara, K., Oosterhof, A., van Kuppevelt, T.H., Verhaagen, J., Fawcett, J.W., Kwok, J.C.F., 2013. Semaphorin 3A binds to the perineuronal nets via chondroitin sulfate type E motifs in rodent brains. J. Biol. Chem. 288, 27384–27395. Data will be made available on request. Dityatev, A., Brückner, G., Dityateva, G., Grosche, J., Kleene, R., Schachner, M., 2007. Activity-dependent formation and functions of chondroitin sulfate-rich extracellular matrix of perineuronal nets. Dev. Neurobiol. 67, 570–588. Acknowledgments Faist, M., Mazevet, D., Dietz, V., Pierrot-Deseilligny, E., 1994. A quantitative assessment of presynaptic inhibition of la afferents in spastics: differences in hemiplegics and This work was funded by the Fundació La Marató-TV3 (TV3-201736- paraplegics. Brain 117, 1449–1455. Fawcett, J.W., 2015. The Extracellular Matrix in Plasticity and Regeneration after CNS 30-31) and by funds from CIBERNED and TERCEL networks, co-funded Injury and Neurodegenerative Disease. Elsevier B.V. by European Union (ERDF/ESF, “Investing in your future”). JSV holds a Fawcett, J.W., Oohashi, T., Pizzorusso, T., 2019. The roles of perineuronal nets and the predoctoral fellowship of the AGAUR, Secretaria d'Universitats i Recerca perinodal extracellular matrix in neuronal function. Nat. Rev. Neurosci. 20, 451–465. del Departament d'Empresa i Coneixement de la Generalitat de Cata­ Foscarin, S., Ponchione, D., Pajaj, E., Leto, K., Gawlak, M., Wilczynski, G.M., Rossi, F., lunya, cofunded by European Social Funds. CC and JH acknowledge the Carulli, D., 2011. Experience-dependent plasticity and modulation of growth support of PIF UAB fellowship, and of Ministerio de Economía y Com­ regulatory molecules at central synapses. PLoS One 6. Freitag, S., Schachner, M., Morellini, F., 2003. Behavioral alterations in mice deficient for petitividad y Fondo Europeo de Desarrollo Regional (RTI2018-101105- the extracellular matrix glycoprotein tenascin-R. Behav. Brain Res. 145, 189–207. B-I00), respectively. Friese, A., Kaltschmidt, J.A., Ladle, D.R., Sigrist, M., Jessell, T.M., Arbera, S., 2009. We thank Dr. Pizzorusso for the donation of Crtl1 KO mice. We also Gamma and alpha motor neurons distinguished by expression of transcription factor appreciate the technical help of Mònica Espejo, Jessica Jaramillo and Err3. Proc. Natl. Acad. Sci. U. S. A. 106, 13588–13593. Frischknecht, R., Heine, M., Perrais, D., Seidenbecher, C.I., Choquet, D., Gundelfinger, E. Neus Hernández, and the Servei de Microscopia de la Universitat D., 2009. Brain extracellular matrix affects AMPA receptor lateral mobility and Autònoma de Barcelona. We also thank the help of Dr. Joost Verhaagen short-term synaptic plasticity. Nat. Neurosci. 12, 897–904. and Dra Daniela Carulli for technical support on Sem3A staining and García-Alías, G., Barkhuysen, S., Buckle, M., Fawcett, J.W., 2009. Chondroitinase ABC treatment opens a window of opportunity for task-specific rehabilitation. Nat. analysis. Finally, we thank Dr. Francesc Jiménez-Altayó and Dr. Emma Neurosci. 12, 1145–1151. Puighermanal for letting us use their rotarod and pole test, respectively Geissler, M., Gottschling, C., Aguado, A., Rauch, U., Wetzel, C.H., Hatt, H., Faissner, A., (Universitat Autònoma de Barcelona) and Dr. Michael A. Lane for the 2013. Primary hippocampal neurons, which lack four crucial extracellular matrix molecules, display abnormalities of synaptic structure and function and severe revision of the manuscript. deficits in perineuronal net formation. J. Neurosci. 33, 7742–7755. Glykys, J., Dzhala, V., Egawa, K., Balena, T., Saponjian, Y., Kuchibhotla, K.V., Bacskai, B. References J., Kahle, K.T., Zeuthen, T., Staley, K.J., 2014. Local impermeant anions establish the neuronal chloride concentration. Science 343, 670–675 (1979). Hirono, M., Watanabe, S., Karube, F., Fujiyama, F., Kawahara, S., Nagao, S., Alvarez, F.J., Villalba, R.M., Zerda, R., Schneider, S.P., 2004. Vesicular glutamate Yanagawa, Y., Misonou, H., 2018. Perineuronal nets in the deep cerebellar nuclei transporters in the spinal cord, with special reference to sensory primary afferent regulate GABAergic transmission and delay eyeblink conditioning. J. Neurosci. 38, synapses. J. Comp. Neurol. 472, 257–280. 6130–6144. Arbat-Plana, A., Torres-Espín, A., Navarro, X., Udina, E., 2015. Activity dependent Ho, S.M., Waite, P.M.E., 2002. Effects of different anesthetics on the paired-pulse therapies modulate the spinal changes that motoneurons suffer after a peripheral depression of the H reflex in adult rat. Exp. Neurol. 177, 494–502. nerve injury. Exp. Neurol. 263, 293–305. Hylin, M.J., Orsi, S.A., Moore, A.N., Dash, P.K., 2013. Disruption of the perineuronal net Barritt, A.W., Davies, M., Marchand, F., Hartley, R., Grist, J., Yip, P., McMahon, S.B., in the hippocampus or medial prefrontal cortex impairs fear conditioning. Learn. Bradbury, E.J., 2006. Chondroitinase ABC promotes sprouting of intact and injured Mem. 20, 267–273. spinal systems after spinal cord injury. J. Neurosci. 26, 10856–10867. Irvine, S.F., Kwok, J.C.F., 2018. Perineuronal nets in spinal motoneurones: chondroitin Bekku, Y., Oohashi, T., 2011. Neurocan contributes to the molecular heterogeneity of the sulphate proteoglycan around alpha motoneurones. Int. J. Mol. Sci. 19. perinodal ECM. Arch. Histol. Cytol. 73, 95–102. Jiang, Y.-Q., Zaaimi, B., Martin, J.H., 2016. Competition with primary sensory afferents Bekku, Y., Vargová, L., Goto, Y., Vorísek, I., Dmytrenko, L., Narasaki, M., Ohtsuka, A., drives remodeling of corticospinal axons in mature spinal motor circuits. J. Neurosci. Fässler, R., Ninomiya, Y., Syková, E., Oohashi, T., 2010. Bral1: Its role in diffusion 36, 193–203. barrier formation and conduction velocity in the CNS. J. Neurosci. 30, 3113–3123. Kaplan, A., Spiller, K.J., Towne, C., Kannng, K., Choe, G., Geber, A., Akay, T., Berardi, N., Pizzorusso, T., Maffei, L., 2000. Critical periods during sensory development. Aebischer, P., Henderson, C., 2014. Neuronal matrix metalloproteinase-9 is a Curr. Opin. Neurobiol. 10, 138–145. determinant of selective neurodegeneration. Neuron 81, 333–348. Beurdeley, M., Spatazza, J., Lee, H.H.C., Sugiyama, S., Bernard, C., Di Nardo, A.A., Kwok, J.C.F., Carulli, D., Fawcett, J.W., 2010. In vitro modeling of perineuronal nets: Hensch, T.K., Prochiantz, A., 2012. Otx2 binding to perineuronal nets persistently Hyaluronan synthase and link protein are necessary for their formation and regulates plasticity in the mature visual cortex. J. Neurosci. 32, 9429–9437. integrity. J. Neurochem. 114, 1447–1459. Bevins, R.A., Besheer, J., 2006. Object recognition in rats and mice: a one-trial non- Kwok, J.C.F., Dick, G., Wang, D., Fawcett, J.W., 2011. Extracellular matrix and matching-to-sample learning task to study “recognition memory”. Nat. Protoc. 1, perineuronal nets in CNS repair. Dev. Neurobiol. 71, 1073–1089. 1306–1311. Mancuso, R., Oliván, S., Osta, R., Navarro, X., 2011. Evolution of gait abnormalities in Boulenguez, P., Liabeuf, S., Bos, R., Bras, H., Jean-Xavier, C., Brocard, C., Stil, A., SOD1 G93A transgenic mice. Brain Res. 1406, 65–73. Darbon, P., Cattaert, D., Delpire, E., Marsala, M., Vinay, L., 2010. Down-regulation Manuel, M., Zytnicki, D., 2019. Molecular and electrophysiological properties of mouse of the potassium-chloride cotransporter KCC2 contributes to spasticity after spinal motoneuron and motor unit subtypes. Curr. Opin. Physiol. 8, 23–29. cord injury. Nat. Med. 16, 302–307. Massey, J.M., Hubscher, C.H., Wagoner, M.R., Decker, J.A., Amps, J., Silver, J., Onifer, S. Bradbury, E.J., Moon, L.D.F., Popat, R.J., King, V.R., Bennett, G.S., Patel, P.N., M., 2006. Chondroitinase ABC digestion of the perineuronal net promotes functional Fawcett, J.W., McMahon, S.B., 2002. Chondroitinase ABC promotes functional collateral sprouting in the cuneate nucleus after cervical spinal cord injury. recovery after spinal cord injury. Nature 416, 636–640. J. Neurosci. 26, 4406–4414. Brückner, G., Brauer, K., Härtig, W., Wolff, J.R., Rickmann, M.J., Derouiche, A., Meyer, O.A., Tilson, H.A., Byrd, W.C., Riley, M.T., 1979. A method for the routine Delpech, B., Girard, N., Oertel, W.H., Reichenbach, A., 1993. Perineuronal nets assessment of fore- and hindlimb grip strength of rats and mice. Neurobehav. provide a polyanionic, glia-associated form of microenvironment around certain Toxicol. 1, 233–236. neurons in many parts of the rat brain. Glia 8, 183–200. Montag-Sallaz, M., Montag, D., 2003. Severe cognitive and motor coordination deficits in Carulli, D., Pizzorusso, T., Kwok, J.C.F., Putignano, E., Poli, A., Forostyak, S., tenascin-R-deficient mice. Genes Brain Behav. 2, 20–31. Andrews, M.R., Deepa, S.S., Glant, T.T., Fawcett, J.W., 2010. Animals lacking link Nadine, G., Pico, C., Andreas, L., Cyril, H., 2009. Perineuronal nets protect fear memories protein have attenuated perineuronal nets and persistent plasticity. Brain 133, from erasure. Science 325, 1258–1261 (1979). 2331–2347. Ogawa, N., Hirose, Y., Ohara, S., Ono, T., Watanabe, Y., 1985. A simple quantitative Carulli, D., Broersen, R., de Winter, F., Muir, E.M., Meškovic, M., de Waal, M., de bradykinesia test in MPTP-treated mice. Res. Commun. Chem. Pathol. Pharmacol. Vries, S., Boele, H.J., Canto, C.B., de Zeeuw, C.I., Verhaagen, J., 2020. Cerebellar 50, 435–441. plasticity and associative memories are controlled by perineuronal nets. Proc. Natl. Olson, C.B., Swett Jr., C.P., 1969. Speed of contraction of skeletal muscle: the effect of Acad. Sci. U. S. A. 117, 6855–6865. hypoactivity and hyperactivity. Arch. Neurol. 20, 263–270. Czipri, M., Otto, J.M., Cs-Szabó, G., Kamath, R.V., Vermes, C., Firneisz, G., Kolman, K.J., Pizzorusso, T., 2002. Reactivation of ocular dominance plasticity in the adult visual Watanabe, H., Li, Y., Roughley, P.J., Yamada, Y., Olsen, B.R., Glant, T.T., 2003. cortex. Science 298, 1248–1251 (1979). Genetic rescue of chondrodysplasia and the perinatal lethal effect of cartilage link Pyka, M., Wetzel, C., Aguado, A., Geissler, M., Hatt, H., Faissner, A., 2011. Chondroitin protein deficiency. J. Biol. Chem. 278, 39214–39223. sulfate proteoglycans regulate astrocyte-dependent synaptogenesis and modulate 15 J. Sánchez-Ventura et al. Experimental Neurology 358 (2022) 114220 synaptic activity in primary embryonic hippocampal neurons. Eur. J. Neurosci. 33, Sugiyama, S., Di Nardo, A.A., Aizawa, S., Matsuo, I., Volovitch, M., Prochiantz, A., 2187–2202. Hensch, T.K., 2008. Experience-dependent transfer of Otx2 homeoprotein into the Romberg, C., Yang, S., Melani, R., Andrews, M.R., Horner, A.E., Spillantini, M.G., visual cortex activates postnatal plasticity. Cell 134, 508–520. Bussey, T.J., Fawcett, J.W., Pizzorusso, T., Saksida, L.M., 2013. Depletion of Suttkus, A., Rohn, S., Weigel, S., Glöckner, P., Arendt, T., Morawski, M., 2014. Aggrecan, perineuronal nets enhances recognition memory and long-term depression in the link protein and tenascin-R are essential components of the perineuronal net to perirhinal cortex. J. Neurosci. 33, 7057–7065. protect neurons against iron-induced oxidative stress. Cell Death Dis. 5, 1–12. Saghatelyan, A.K., Gorissen, S., Albert, M., Hertlein, B., Schachner, M., Dityatev, A., Tewari, B.P., Chaunsali, L., Campbell, S.L., Patel, D.C., Goode, A.E., Sontheimer, H., 2000. The extracellular matrix molecule tenascin-R and its HNK-1 carbohydrate 2018. Perineuronal nets decrease membrane capacitance of peritumoral fast spiking modulate perisomatic inhibition and long-term potentiation in the CA1 region of the interneurons in a model of epilepsy. Nature. Communications 9. hippocampus. Eur. J. Neurosci. 12, 3331–3342. Thompson, F.J., Reier, P.J., Lucas, C.C., Parmer, R., 1992. Altered patterns of reflex Sánchez-Ventura, J., Giménez-Llort, L., Penas, C., Udina, E., 2020. Voluntary wheel excitability subsequent to contusion injury of the rat spinal cord. J. Neurophysiol. running preserves lumbar perineuronal nets, enhances motor functions and prevents 68, 1473–1486. hyperreflexia after spinal cord injury. Exp. Neurol. 336. Tom, V.J., Kadakia, R., Santi, L., Houlé, J.D., 2009. Administration of chondroitinase Seibenhener, M.L., Wooten, M.C., 2015. Use of the open field maze to measure locomotor ABC rostral or caudal to a spinal cord injury site promotes anatomical but not and anxiety-like behavior in mice. J. Visual. Exp. 1–6. functional plasticity. J. Neurotrauma 26, 2323–2333. Shen, Y., Tenney, A.P., Busch, S.A., Horn, K.P., Fernando, X., Liu, K., He, Z., Silver, J., Tsien, R.Y., 2013. Very long-term memories may be stored in the pattern of holes in the Flanagan, J.G., 2009. PTPσ is a receptor for Chondroitin Sulfate Proteoglycan, an perineuronal net. Proc. Natl. Acad. Sci. U. S. A. 110, 12456–12461. inhibitor of neural regeneration. Science 326, 592–596 (1979). Valero-Cabré, A., Forés, J., Navarro, X., 2004. Reorganization of reflex responses Shiotsuki, H., Yoshimi, K., Shimo, Y., Funayama, M., Takamatsu, Y., Ikeda, K., mediated by different afferent sensory fibers after spinal cord transection. Takahashi, R., Kitazawa, S., Hattori, N., 2010. A rotarod test for evaluation of motor J. Neurophysiol. 91, 2838–2848. skill learning. J. Neurosci. Methods 189, 180–185. Vavrek, R., Pearse, D.D., Fouad, K., 2007. Neuronal populations capable of regeneration Slaker, M., Churchill, L., Todd, R.P., Blacktop, J.M., Zuloaga, D.G., Raber, J., Darling, R. following a combined treatment in rats with spinal cord transection. J. Neurotrauma. A., Brown, T.E., Sorg, B.A., 2015. Removal of perineuronal nets in the medial 24 (10), 1667–1673. https://doi.org/10.1089/neu.2007.0290. PMID: 17970629. prefrontal cortex impairs the acquisition and reconsolidation of a cocaine-induced Vo, T., Carulli, D., Ehlert, E.M.E., Kwok, J.C.F., Dick, G., Mecollari, V., Moloney, E.B., conditioned place preference memory. J. Neurosci. 35, 4190–4202. Neufeld, G., de Winter, F., Fawcett, J.W., Verhaagen, J., 2013. The chemorepulsive Smith, C.C., Mauricio, R., Nobre, L., Marsh, B., Wüst, R.C.I., Rossiter, H.B., Ichiyama, R. axon guidance protein semaphorin3A is a constituent of perineuronal nets in the M., 2015. Differential regulation of perineuronal nets in the brain and spinal cord adult rodent brain. Mol. Cell. Neurosci. 56, 186–200. with exercise training. Brain Res. Bull. 111, 20–26. Wang, D., Fawcett, J., 2012. The perineuronal net and the control of cns plasticity. Cell Spicer, A.P., Joo, A., Bowling, R.A., 2003. A hyaluronan binding link protein gene family Tissue Res. 349, 147–160. whose members are physically linked adjacent to chrondroitin sulfate proteoglycan Wang, D., Ichiyama, R.M., Zhao, R., Andrews, M.R., Fawcett, J.W., 2011. Chondroitinase core protein genes. The missing links. J. Biol. Chem. 278, 21083–21091. combined with rehabilitation promotes recovery of forelimb function in rats with Starkey, M.L., Bartus, K., Barritt, A.W., Bradbury, E.J., 2012. Chondroitinase ABC chronic spinal cord injury. J. Neurosci. 31, 9332–9344. promotes compensatory sprouting of the intact corticospinal tract and recovery of Witts, E.C., Zagoraiou, L., Miles, G.B., 2014. Anatomy and function of cholinergic C forelimb function following unilateral pyramidotomy in adult mice. Eur. J. Neurosci. Bouton inputs to motor neurons. J. Anat. 224, 52–60. 36, 3665–3678. 16