New Phytologist Supporting Information Article title: Induced ligno-suberin vascular coating and tyramine-derived hydroxycinnamic acid amides restrict Ralstonia solanacearum colonization in resistant tomato Authors: Anurag Kashyap, Álvaro Jiménez-Jiménez, Weiqi Zhang, Montserrat CapelladesSumithra Srinivasan, Anna Laromaine, Olga Serra, Mercè Figueras, Jorge Rencoret, Ana Gutiérrez, Marc Valls, Nuria S. Coll Article acceptance date: January 3rd, 2022 The following Supporting Information is available for this article: Figure S1: Tissue used for analysis and bacterial dynamics. Figure S2: H7996 plants show mild symptoms upon challenge inoculation of R. solanacearum. Figure S3: R. solanacearum-induced xylem vascular ferulic acid deposition occurs in resistant H7996, but not in susceptible Marmande. Figure S4: Expression of suberin biosynthetic genes in xylem vasculature of taproots upon infection of R. solanacearum. Figure S5: Phylogeny of Feruloyl transferase (FHT) orthologues in different plant species and expression of the putative tomato FHT ortholog in response to Ralstonia solanacearum infection. Figure S6: Phylogeny of tyramine hydroxycinnamoyl transferase (THT) orthologues in different plant species and expression of the tomato THT gene family members in response to R. solanacearum infection. Figure S7: Expression of phenylpropanoid pathway genes in xylem vasculature of taproots upon invasion of R. solanacearum. Figure S8: Immunoblot of 35S::SlFHT-HA in independent Marmande tomato lines expressing 35S::SlFHT-HA (Marmande). Figure S9: Fresh weight of 35S::SlFHT-HA plants. Figure S10: Fresh weight of 35S::SlTHT1-3 plants. Figure S11: Overexpression of SlTHT1-3 in tomato results in restricted colonization by R. solanacearum. Table S1: List of primers used in this study. Table S2: Assignments of the correlation signals in the 2D HSQC spectra. Fig. S1 Tissue used for analysis and bacterial dynamics. (a) A picture of a tomato plant is shown, highlighting in red the selected region for all cross-sections used in this work, both for histological methods and molecular analysis. The transition zone between the taproot and the hypocotyl, down the soil line, was chosen because of their implications on R. solanacearum- tomato interactions, as discussed in the manuscript. (b) Plants (4–5 weeks old) of the susceptible variety Marmande and the resistant variety H7996 were inoculated with ~1x107 CFU/ml of a fluorescent R. solanacearum strain by soil drenching. Cross-sections of the taproot-to-hypocotyl area containing 105 CFU g−1 of R. solanacearum were obtained and photographed with a fluorescence stereomicroscope under brightfield and UV light. Images from a representative experiment out of 3 with n=5 plants per cultivar. Scale bar = 500 µm. Fig. S2 H7996 plants show mild symptoms upon challenge inoculation of R. solanacearum. Susceptible (Marmande) and resistant (H7996), 5-week-old tomato plants were inoculated through roots by soil-soak with ~1x107 CFU/ml of R. solanacearum GMI1000 and incubated at 28°C. (a) Wilting progress was assayed in both cultivars by rating plants daily on a 0 to 4 disease index scale where 0 = healthy and 4 =100% wilted. Data presented are means ± SE of a representative experiment with n=20 plants for each cultivar, out of a total of 3 experiments. (b) The level of in planta colonization by R. solanacearum was calculated as colony forming units per gram of fresh −1 taproot tissue (CFU·g ) at the indicated days post-infection (dpi). Data presented are of a representative experiment with n=10 plants for each time point each cultivar out of a total of 3 experiments. Asterisks indicate statistically significant difference between Marmande and H7996 in a paired Student´s t-test (** p-value of p < 0.01 and *** p-value of p < 0.001). Supports Figure 1 of the main manuscript. Fig. S3 R. solanacearum-induced xylem vascular ferulic acid deposition occurs in resistant H7996, but not in susceptible Marmande. Cell wall-bound ferulic acid can be detected by emission of a blue fluorescence with UV excitation at neutral pH, which characteristically changes to stronger green emission under conditions of high pH such as in the presence of alkali. Five- week-old Marmande and H7996 plants were inoculated with ~1x107 CFU/ml of R. solanacearum GMI1000 and incubated at 28°C. Taproot cross-sections were obtained at 9 dpi (a) or in plants −1 containing a bacterial load of approximately 105 CFU g of R. solanacearum (b, c). (a) Autofluorescence emitted from taproot cross-section from mock-treated and infected Marmande and H7996 plants was visualized at 9 dpi under UV before and after treatment with KOH alkali (high pH above 10). In infected H7996 a green/turquoise color appears in vessel walls and surrounding xylem parenchyma cells, indicative of ferulic acid deposition in the cell walls. Scale bars = 500 µm. (b) The same as in (a) but cross-sections were obtained from plants containing a bacterial load of approximately 105 CFU g −1 of R. solanacearum. Scale bars = 500 µm. (c) Green fluorescence from ferulate deposits in the xylem and surrounding parenchyma cells was measured using ImageJ. Data are represented with box and whiskers plots: whiskers indicate variability outside the upper and lower quartiles and boxes indicate second quartile, median and third quartile. Plots show data from a single representative experiment (n =6) out of a total of 3. Different letters indicate statistically significant differences (α=0.05, Fisher’s least significant difference test). Supports Figure 4 of the main manuscript. Fig. S4 Expression of suberin biosynthetic genes in xylem vasculature of taproots upon infection of R. solanacearum. Expression levels of tomato putative orthologs of the suberin fatty acid pathway were analyzed by qPCR in H7996 and Marmande plants infected with R. solanacearum or mock-treated. Xylem vascular tissue comprising of metaxylems and surrounding parenchyma cells was collected from infected plants with a R. solanacearum inoculum of 105 CFU g−1 in the taproot or mock-inoculated plants of a similar age. Relative expression values were calculated using the Elongation Factor 1 alpha (eEF1 α) gene as reference. Three biological replicates (n=3) were used, and taproots of 6 plants were used in each replicate. Data are represented with box and whiskers plots: whiskers indicate variability outside the upper and lower quartiles and boxes indicate second quartile, median and third quartile. Different letters indicate statistically significant differences (α=0.05, Fisher’s least significant difference test). Supports Figure 5 of the main manuscript. Fig. S5 Phylogeny of Feruloyl transferase (FHT) orthologues in different plant species and expression of the putative tomato FHT ortholog in response to Ralstonia solanacearum infection. (a) Protein homologs of potato FHT gene (PGSC0003DMG400031731) were obtained from www.phytozome.jgi.doe.gov and matches with more than 80 % similarity were used for phylogenetic analysis using www.phylogeny.fr. (b) Gene expression of the putative tomato FHT ortholog (Solyc03g097500) was analyzed by qPCR. Relative expression levels were calculated using the Elongation Factor 1 alpha (eEF1 α, Solyc06g005060) as the reference gene. H7996 and Marmande plants, containing a R. solanacearum inoculum of 105 CFU g−1 in the taproot were selected. Xylem vascular tissue, comprising of metaxylems and surrounding parenchyma cells was collected from taproots for RNA extraction and cDNA synthesis. Similarly, xylem tissue was collected from Marmande mock plants and H7996 mock plants. Three biological replicates (n=3) were used, and taproots of 6 plants were used in each replicate. Data are represented with box and whiskers plots: whiskers indicate variability outside the upper and lower quartiles and boxes indicate second quartile, median and third quartile. Different letters indicate statistically significant differences (α=0.05, Fisher’s least significant difference test). Supports Figure 5 of the main manuscript. Fig. S6 Phylogeny of tyramine hydroxycinnamoyl transferase (THT) orthologues in different plant species and expression of the tomato THT gene family members in response to R. solanacearum infection. (a) Protein homologs of tomato THT1-3 gene (Solyc08g068730) were obtained from www.phytozome.jgi.doe.gov and matches with more than 60 % similarity were used for phylogenetic analysis using the webpage www.phylogeny.fr. (b) Gene expression of the tomato THT gene family members was analyzed by qPCR. Relative expression levels were calculated using the Elongation Factor 1 alpha (eEF1 α, Solyc06g005060) as the reference gene. H7996 and Marmande plants, containing a R. solanacearum inoculum of 105 CFU g−1 in the taproot were selected. Xylem vascular tissue, comprising of metaxylems and surrounding parenchyma cells was collected from taproots for RNA extraction and cDNA synthesis. Similarly, xylem tissue was collected from Marmande mock plants and H7996 mock plants. Three biological replicates (n=3) were used, and taproots of 6 plants were used in each replicate. Data are represented with box and whiskers plots: whiskers indicate variability outside the upper and lower quartiles and boxes indicate second quartile, median and third quartile. Different letters indicate statistically significant differences (α=0.05, Fisher’s least significant difference test). Supports Figure 5 of the main manuscript. Fig. S7 Expression of phenylpropanoid pathway genes in xylem vasculature of taproots upon invasion of R. solanacearum. Expression levels of tomato putative orthologs of the phenylpropanoid pathway were analyzed by qPCR in H7996 and Marmande plants infected with R. solanacearum or mock-treated. Xylem vascular tissue comprising of metaxylems and surrounding parenchyma cells was collected from infected plants with a R. solanacearum inoculum of 105 CFU g−1 in the taproot or mock-inoculated plants of a similar age. Relative expression values were calculated using the Elongation Factor 1 alpha (eEF1 α) gene as reference. Three biological replicates (n=3) were used, and taproots of 6 plants were used in each replicate. Data are represented with box and whiskers plots: whiskers indicate variability outside the upper and lower quartiles and boxes indicate second quartile, median and third quartile. Different letters indicate statistically significant differences (α=0.05, Fisher’s least significant difference test). Supports Figure 5 of the main manuscript. Fig. S8 Immunoblots of SlFHT-HA in independent Marmande tomato lines expressing 35S::SlFHT-HA. Immunoblots using anti-HA antibody showing SlFHT-HA protein (predicted protein size: 49kDa) levels of independent transgenic lines stably overexpressing SlFHT-HA on a susceptible Marmande background (35S::SlFHT-HA). (a) Independent lines A, B, C and D. (b) Independent lines C (siblings CI and CIII) and G. Several wild-type Marmande are included as a control (WT lanes), to ensure specificity of the observed band. Coomasie blue staining showing similar protein load in all the lanes are included. Fig. S9 Fresh weight of 35S::SlFHT-HA plants. (a) Photographs of Wt Marmande and transgenic 35S::FHT-HA plants were taken 3 weeks after germination. (b) Fresh weight was measured at this point. Data are represented with box and whiskers plots: whiskers indicate variability outside the upper and lower quartiles and boxes indicate second quartile, median and third quartile. Different letters represent statistically significant differences (α=0.05, Fisher’s least significant difference test). Fig. S10 Fresh weight of 35S::SlTHT1-3 plants. (a) Photographs of Wt Marmande and transgenic 35S::THT-1-3 plants were taken 3 weeks after germination. (b) Fresh weight was measured at this point. Data are represented with box and whiskers plots: whiskers indicate variability outside the upper and lower quartiles and boxes indicate second quartile, median and third quartile. Different letters represent statistically significant differences (α=0.05, Fisher’s least significant difference test). Fig. S11 Overexpression of SlTHT1-3 in tomato results in restricted colonization by R. solanacearum. (a) Growth of R. solanacearum GMI1000 in planta was monitored in leaves of 35S::THT1-3 transgenic plant compared with Wt Moneymaker tomato lines over time. The bacterium was vacuum infiltrated into the leaves at a concentration of ~1x105 CFU/ml and growth was recorded at 0, 3 and 6 dpi. Data are represented with box and whiskers plots: whiskers indicate variability outside the upper and lower quartiles and boxes indicate second quartile, median and third quartile. Plots show data of 6 to 8 independent plants (n=6-8) from a representative experiment out of 3. Asterisk indicates statistically significant difference between Wt and overexpression line in a paired Student´s t-test (* corresponds to p-value of p < 0.05). (b) Representative images of tomato stem cross-sections showing colonization by the R. solanacearum GMI1000 GFP reporter strain at 6 dpi. R. solanacearum was directly injected into the xylem vasculature of the first internode through the petiole at a concentration of 10 5 CFU ml −1 . Colonization progress was analyzed at the point of inoculation, at higher (+0.5, +1, +2 and +3 cm) and lower -0.5, -1, -2 and -3 cm) sections. Images from a representative experiment out of 3 with n=5 plants each. Scale bar = 2 mm. Supports Figure 7 of the main manuscript. Table S1 List of primers used for cloning and qPCR analysis Gene Gene ID Primers Sequence Usage Origin FHT Solyc03g097500 part7FHTF1 GGCCCGGGATGGAGAATGGTAAACACAGT Cloning This paper GTTGC part7FHTHAR1 GGGGATCCTTAAGCGTAGTCTGGGACGTCG TATGGGTAGATCTCCATAAGTTCCTC FHT Solyc03g097500 qSlFHT F1 GGTGGCTCAGGTGACAAAGT qPCR This paper qSlFHT R1 CCTCTCGCAATTTCACCCCA THT 1-3 Solyc08g068730 qTHT1-3F1 CCCCTTTTGACGAACCTAAA qPCR (Campos et al., qTHT1-3R1 TTTGGATCGGAATTCCTCAA 2014) EF Solyc06g005060 qeEF1αF1 CCACCTCGAGATCCTAATGG qPCR (Campos et al., qeEF1αR1 ACCCTCACGTATGCTTCCAG 2014) PAL1 Solyc09g007920 qSlPAL1 F1 TACGTGTTTGCCTATGCTGATG qPCR (Rahim et al., qSlPAL1 R1 CGGCCTTTAATTCGTCCTC 2019) COMT Solyc03g080180 qSlCOMT F1 GGTGGTGGAACAGGGGCTACT qPCR (Rahim et al., qSlCOMT R1 TAAACAATGCTCATCGCTCCAATC 2019) CCoAOM Solyc02g093270 qSlCCOAOMT1 F1 GAGAGCCTGAAGCCATGAAAGAGC qPCR (Rahim et al., T1 qSlCCOAOMT1 R1 GAGCCATGGCAGTAGCAAGCAGAG 2019) CCoAOM Solyc01g107910 qSlCCOAOMT6 F1 ATTTTCGAGAGGGCCCTGCTTTAC qPCR (Rahim et al., T6 qSlCCOAOMT6 R1 ATCCGATCACACCACCAACTTTCA 2019) HCT Solyc03g117600 qSlHCT F1 CCCTCCTCCGTGCTCGTGA qPCR (Rahim et al., qSlHCT R1 CCCGGGTTAGTTTGAAGATTGACA 2019) C3H Solyc01g096670 qSlC3H F1 CTGCAATGCGTGGCCAAGGAAGC qPCR (Rahim et al., qSlC3H R1 TCGCGAGCAACAGCCCAGACATT 2019) 4CL Solyc12g094520 qSL4CL F1 CGA GCA TGG AAG GGA AAA TTG qPCR (Rigano et al., qSL4CL R1 TCA GAG TCT AGA GTG GAA GCA G 2016) C4H TC93956 qSlC4H F1 CTAGCTAACAACCCCGCCCA qPCR (Zhang et al., qSlC4H R1 AACTCCTCCTGCCAACACCG 2019) THT 7-8 Solyc08g068780 qSLTHT 7-8 F1 GGAAACTGATAAGGAGAAGGTGG qPCR This paper qSLTHT 7-8 R1 GTTTGCACGGCGTATGGAG THT like 4 Solyc08g068710 qSLTHT4 F1 AGTTTAGGTATGGCAAATTGCATGG qPCR This paper qSLTHT4 R1 AAGAAAACACACAGTAGCTAACAGC THT like 5 Solyc08g068690 qSLTHT6 F1 TCAGTCGATGGAATAGTAGCAGTT qPCR This paper qSLTHT6 R1 TCCTCAATTTCCCCCTTGTTATG CYP86A1 Solyc06g076800 qSlCYP86A1 F1 GGTCTACTGGTGTATCCGCA qPCR This paper qSlCYP86A1 R1 CCTTTAGGATAGTTATCGAACCTGG KCS1 Solyc10g009240 qSlKCS1 F1 GTCGTAGGGGTGTCACTAGC qPCR This paper qSlKCS1 R1 GTCATGAAAAACCTGAATTGCTCAG GPAT5 Solyc04g011600 qSlGPAT5 F2 CCCTAGGCCAATGTATGAGGTAAC qPCR This paper qSlGPAT5 R2 GTTGCTGCCAAAATCCTCTGG DAISY/KC Solyc05g009280 qDAISY F1 TCCGAGTTCATCCCAAGTCG qPCR This paper S2 qDAISY R1 AACAGTATGGCTGCACCTCC FAR3 Solyc06g074390 qSlFAR3 F1 TGGTGCTACTGGATTTCTTGC qPCR This paper qSlFAR3 R1 TGCCACAGCCTCATTGTTGA THT 7-1 Solyc08g068700 qSlTHT7-1 F1 GCTTGAACGCTTGGTTAGTGG qPCR This paper qSlTHT7-1 R1 AGTCCTCCTTAGAGGGCTTGC CY986B1 Solyc02g014730 qSlCYP86B1 F1 TCCGTTGATTTTCAAGCCAGC qPCR This paper qSlCYP86B1 R1 TCGTCTTCAACAACCTCTTTGTG Table S2 Assignments of the correlation signals in the 2D HSQC spectra. Label δC/δH (ppm) Assignment Ty7 34.2/2.62 C7/H7 in amides of tyramine (Ty) Ty8 40.5/3.29 C8/H8 in amides of tyramine (Ty) Bβ 53.3/3.43 Cβ/Hβ in phenylcoumarans (B) Cβ 53.5/3.05 Cβ/Hβ in β–β´resinols (C) MeO 55.3/3.72 C/H in aromatic methoxy group Aγ 59.7/3.23, 3.58 Cγ/Hγ in β–O–4´ alkyl-aryl ethers (A) Iγ 61.5/4.06 Cγ/Hγ in cinnamyl alcohol end-groups (I) Bγ 62.6/3.70 Cγ/Hγ in phenylcoumarans (B) Cγ 71.1/3.80, 4.17 Cγ/Hγ in β–β´resinols (B) Aα 71.3/4.79 Cα/Hα in β–O–4ʹ alkyl-aryl ethers (A) AβG 83.9/4.27 Cβ/Hβ in β–O–4ʹ alkyl-aryl ethers (A) linked to a G unit Cα 84.9/4.67 Cα/Hα in β–β´resinols (C) AβS 83.6/4.28 Cβ/Hβ in β–O–4ʹ alkyl-aryl ethers (A) linked to a S unit Bα 86.9/5.45 Cα/Hα in phenylcoumarans (B) S2,6 104.0/6.68 C2/H2 and C6/H6 in syringyl units (S) S′2,6 106.3/7.29 C2/H2 and C6/H6 in Cα-oxidized syringyl units (S′) G2 111.1/6.97 C2/H2 in guaiacyl units (G) Ty3,5 114.8/6.64 C3/H3 and C5/H5 in amides of tyramine (Ty) G5/6 114.9/6.79 C5/H5 and C6/H6 in guaiacyl units (G) G6 119.0/6.76 C6/H6 in guaiacyl units (G) Iβ 128.2/6.21 Cβ/Hβ in cinnamyl alcohol end-groups (I) Iα 128.6/6.43 Cα/Hα in cinnamyl alcohol end-groups (I) Ty2,6 129.3/6.92 C2/H2 and C6/H6 in amides of tyramine (Ty) UF 129.4/5.31 -CH=CH- in unsaturated fatty acid structures (UF) FAm7 138.6/7.31 C7/H7 in feruloyl amides (FAm) SUPPLEMENTAL REFERENCES Campos, L., Lisón, P., López-Gresa, M.P., Rodrigo, I., Zacarés, L., Conejero, V., and Bellés, J.M. (2014). Transgenic tomato plants overexpressing tyramine N - hydroxycinnamoyltransferase exhibit elevated hydroxycinnamic acid amide levels and enhanced resistance to Pseudomonas syringae . Mol. Plant-Microbe Interact. 27: 1159–1169. Rahim, M.A., Zilani Rabbi, A.K.M., Shazia Afrin, K., Jung, H.-J., Kim, H.-T., Park, J.-I., Nou, I.-S. (2019). Differential expression pattern of lignin biosynthetic genes in dwarf Cherry tomato (Solanum lycopersicum var. cerasiforme). Plant Breed. Biotech. 7: 229-236. Rigano, M.M., Raiola, A., Docimo, T., Ruggieri, V., Calafiore, R., Vitaglione, P., Ferracane, R., Frusciante, L., Barone, A. (2016). Metabolic and molecular changes of the phenylpropanoid pathway in tomato (Solanum lycopersicum) lines carrying different Solanum pennellii wild chromosomal regions. Front Plant Sci. 7: 1484. Zhang, Y., Zhang, W., Han, L., Li, J., Shi, X., Hikichi, Y., and Ohnishi, K. (2019). Involvement of a PadR regulator PrhP on virulence of Ralstonia solanacearum by controlling detoxification of phenolic acids and type III secretion system. Mol. Plant Pathol. 20: 1477– 1490.