Received: 16 November 2020 | Revised: 31 January 2022 | Accepted: 13 February 2022 DOI: 10.1002/jnr.25036 RESEARCH ARTICLE BET protein inhibition in macrophages enhances dorsal root ganglion neurite outgrowth in female mice Georgina Palomés-­Borrajo | Xavier Navarro | Clara Penas Department of Cell Biology, Physiology and Immunology, Centro de Investigación Abstract Biomédica en Red sobre Enfermedades Peripheral nerve regeneration is limited after injury, especially in humans, due to the large Neurodegenerativas (CIBERNED), Institute of Neurosciences, Universitat distance the axons have to grow in the limbs. This process is highly dependent on the Autònoma de Barcelona, Bellaterra, Spain expression of neuroinflammatory factors produced by macrophages and glial cells. Given Correspondence the importance of the epigenetic BET proteins on inflammation, we aimed to ascertain Clara Penas, Department of Cell Biology, if BET inhibition may have an effect on axonal outgrowth. For this purpose, we treated Physiology and Immunology, Centro de Investigación Biomédica en Red sobre female mice with JQ1 or vehicle after sciatic nerve crush injury and analyzed target rein- Enfermedades Neurodegenerativas nervation. We also used dorsal root ganglion (DRG) culture explants to analyze the effects (CIBERNED), Institute of Neurosciences, Universitat Autònoma de Barcelona, of direct BET inhibition or treatment with conditioned medium from BET-­inhibited mac- 08193 Bellaterra, Spain. rophages. We observed that although JQ1 produced an enhancement of IL-­4, IL-­13, and Email: clara.penas@uab.cat GAP43 expression, it did not have an effect on sensory or motor reinnervation after crush Funding information This work was supported by grant injury in vivo. In contrast, JQ1 reduced neurite growth when interacting directly with DRG PID2019-­108496RA-­I 00 from Ministerio neurons ex vivo, whereas conditioned medium from JQ1-­treated macrophages promoted de Ciencia e Innovación and Agencia Estatal de Investigación of Spain, neurite outgrowth. Therefore, BET-­inhibited macrophages secrete pro-­regenerative fac- CIBERNED (CB06/05/1105) and TERCEL tors that induce neurite outgrowth, and that may counteract the direct inhibition of BET (RD16/0011/0014) funds from the Instituto de Salud Carlos III of Spain, proteins in neurons in vivo. Finally, we observed an activation of the STAT6 pathway in co-­funded by European Union (ERDF/ESF, DRG explants treated with conditioned medium from JQ1-­treated macrophages. In con- “Investing in your future”) clusion, this study demonstrates that BET protein inhibition in macrophages provides a mechanism to enhance axonal outgrowth. However, specific targeting of BET proteins to macrophages will be needed to efficiently enhance functional recovery after nerve injury. KEYWORDS BET proteins, cytokines, inflammation, neurite outgrowth, regeneration 1 | I NTRO D U C TI O N PNI affects 1.8% of subjects with traumatic limb injuries in Europe. Patients undergo prolonged rehabilitation and current treatments Peripheral nerve injuries (PNIs) result in the disconnection between produce a scarce functional outcome (Huckhagel et al., 2018). the neuronal soma and the distal axon stump, leading to the degen- Hence, it is important to find novel strategies that promote regener- eration of distal fibers and the eventual death of axotomized neu- ation and recovery after PNI. In fact, peripheral nerve regeneration rons. As a result, there is a partial or total loss of sensory, motor, is limited after injury, especially in humans, due to the large distances and autonomic functions (Allodi et al., 2012; Navarro et al., 2007). the axons have to grow. One way to overcome this problem is by Edited by Cristina Antonella Ghiani and Dena R Howland. Reviewed by Lynnette Montgomery, Megan Detloff and John Gensel This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. © 2022 The Authors. Journal of Neuroscience Research published by Wiley Periodicals LLC. J Neurosci Res. 2022;100:1331–1346.  wileyonlinelibrary.com/journal/jnr | 1331 1332 | PALOMÉS-­BORRAJO et al. promoting an acceleration of axonal regeneration (DeFrancesco-­ Lisowitz et al., 2015; Ma et al., 2011). Significance During Wallerian degeneration of the distal stump, a network We have found that inhibition of BET proteins in mac- of different cells, including infiltrating macrophages and Schwann rophages produce the expression of pro-­regenerative fac- cells, participate in axonal and myelin breakdown, through the re- tors by these cells. These factors promote neuronal neurite lease of different products. Between these molecules, cytokines growth. This finding may be important to promote nerve and chemokines are essential to regulate the microenvironment that regeneration after peripheral nerve injury. promotes axonal regeneration (Chen, Lin, et al., 2016; DeFrancesco-­ Lisowitz et al., 2015). Thus, Wallerian degeneration is a cascade of events that reassemble an immune-­like reaction, which can be di- vided in two main phases. The early phase is characterized by the outgrowth ex vivo, we treated dorsal root ganglion (DRG) neuronal synthesis of inflammatory cytokines and chemokines such as TNF-­α, explants with JQ1. In addition, we used conditioned medium from IL-­1α, IL-­1ß, IL-­6, and CCL2, inducing the recruitment of immune cells. JQ1-­treated macrophages, and assessed its effect on DRG neurite The late phase is defined by the increase in anti-­inflammatory cyto- growth. In summary, this study aims to determine the role of BET kines such as IL-­13, IL-­10, and IL-­4, and promotes the clearance of protein inhibition on axonal regeneration and functional recovery debris (Rotshenker, 2011; Vidal et al., 2013). Both processes are indis- after PNI. pensable for successful nerve regeneration. For instance, it has been demonstrated that the enhancement of the anti-­inflammatory phase attenuates pro-­inflammatory cytokine secretion, concludes degener- 2 | M ATE R I A L S A N D M E TH O DS ation, and increases axonal outgrowth (Fregnan et al., 2012; Siqueira Mietto et al., 2015; Vidal et al., 2013). Thus, to provide a favorable 2.1 | Animals and surgery environment for axonal growth, it is crucial to achieve a rapid transi- tion from the pro-­inflammatory phase toward the anti-­inflammatory All animal procedures were approved by the Universitat Autònoma phase of Wallerian degeneration. Experimental evidence has shown de Barcelona Animal Experimentation Ethical Committee (code that cytokines trigger JAK/STAT signaling pathways, which are as- 10306) and followed the European Commission Directive 2010/63/ sociated with neural plasticity. Particularly, IL-­4 and IL-­13 activate EU on the protection of animals used for scientific purposes. Female STAT6, leading to neuroprotection (Bhattarai et al., 2016; Deboy C57BL/6J mice (Charles River Laboratories) were used in all the ex- et al., 2006; Vidal et al., 2013). IL-­6 and IL-­10 activate the STAT3-­ periments, which were kept under a 12-­hr light cycle and had access mediated pathway, increasing regeneration and neuroprotection of to water and food at libitum. cortical neurons (Chen, Lin, et al., 2016; Dubovy et al., 2019). To perform nerve injury, 7-­week-­old female mice were anesthe- BET proteins are epigenetic readers of acetylated lysine res- tized by intraperitoneal injection of ketamine (90 mg/kg) and xyla- idues in histone and nonhistone proteins, and are associated with zine (10 mg/kg) in saline. Sciatic nerve crush injury was performed cellular growth, evasion of apoptosis, and inflammatory response on the right hind limb at 45 mm distance from the tip of the fourth (Filippakopoulos & Knapp, 2014). BET family comprises BRD2, digit. The lesion consisted on applying a tight pressure sing forceps BRD3, BRD4, and the testis-­specific protein BRDT. The most stud- (Dumont #5) at the sciatic nerve 3 times during 30 seconds, with ied member of this family is BRD4. BRD4 interacts with an acetyl- different orientations each. Then, the muscle and skin were closed ated p65/RELA subunit, triggering the recruitment of p-­TEFb in layers. To prevent reopening and later infection of the wound, complex and stimulating the transcription of NF-­kß genes (Hajmirza the skin was secured with staples and iodine was topically applied. et al., 2018). Inhibition of BET proteins through the small molecule Mice were kept in a warm environment until they recovered from JQ1 reduces the expression of inflammatory cytokines and prevents anesthesia. Operated animals were intraperitoneally administered TNF-­inducible gene expression in macrophages in vitro (Nicodeme with vehicle (saline with 5% DMSO and 5% Tween-­8 0), or with JQ1 et al., 2010). In addition, we have previously found that treatment (30 mg/kg, diluted in vehicle) starting at 2 hr (day 0) or at 4 days with the BET inhibitor JQ1 reduces inflammation, increases the pres- postoperation (dpo). Each cage of mice contained animals treated ence of anti-­inflammatory cytokines, and enhances functional out- with the different conditions, to minimize experimental bias. A total come after spinal cord injury (Sanchez-­Ventura et al., 2019). Given of 27 animals for in vivo studies (15 animals for functional testing the importance of BET proteins on inflammatory gene expression, and 12 for western blot and qPCR studies) were used. we hypothesized that BET inhibition could favor an early conclu- sion of Wallerian degeneration through the downregulation of pro-­ inflammatory cytokines and the upregulation of anti-­inflammatory 2.2 | Functional testing cytokines. Such a process may enhance axonal growth after PNI via JAK/STAT pathways. Evaluation of axonal regeneration and target reinnervation was We used the BET inhibitor JQ1 and analyzed its effects after PNI conducted through noninvasive electrophysiological tests at 14, in mice. To further analyze the effects of BET proteins on neuronal 21, and 28 dpo (n = 5 animals per condition). Prior to the functional PALOMÉS-­BORRAJO et al. | 1333 test, mice were anesthetized by intraperitoneal injection with 2.4 | Analysis of mRNA expression in sciatic nerve 0.04 ml of ketamine/xylazine mixture. For assessment of periph- eral nerve conduction, the sciatic nerve was stimulated with single Seven days after the crush injury, mice were perfused with sterile sa- electrical pulses of 0.02-­ms duration up to supramaximal intensity, line (n = 3 or 4 mice per group). Then, injured sciatic nerves were re- delivered by needles inserted percutaneously at the sciatic notch. moved and snap-­frozen. Tissue was homogenized with QIAzol lysis Compound muscle action potentials (CMAPs) of the tibialis anterior reagent (QIAGEN), and RNA was extracted using the RNeasy Mini Kit and plantar muscles were recorded by means of needle electrodes, (QIAGEN) following the manufacturer's guidelines. RNA was quan- amplified and displayed on the oscilloscope to measure the ampli- tified with a Thermo Fisher NanoDrop 1000 Spectrophotometer tude and the latency of the M wave (Navarro, 2016). For sensory (http://tools.thermofisher.com/content/sfs/manuals/nd-1000-v3.8- nerve conduction, the digital nerve was stimulated similarly, with users-manual-8%205x11.pdf, RRID:SCR_016517) and reverse-­ short-­duration electrical pulses of increasing intensity delivered at transcribed using an Applied Biosystems kit (Thermo Fisher Scientific). the sciatic notch. The evoked compound nerve action potentials Then, the expression of target sequences was quantified by RTqPCR (CNAPs) were recorded distally at the fourth digit. Functional tests using SYBR Green QPCR Master Mix (Agilent Technologies) and the were also performed in the contralateral hind limb as control values corresponding primers (Table 2). Glyceraldehyde-­3-­phosphate dehy- for each group. drogenase (GAPDH) was used as a housekeeping gene. 2.3 | Analysis of skin reinnervation 2.5 | Bone marrow-­derived macrophage (BMDM) primary culture Animals were intraperitoneally anesthetized with 0.2 ml of 1:1 pentobarbital-­saline mixture at 28 dpo and perfused with 4% para- Mice were euthanized with pentobarbital diluted in saline (1:1) and formaldehyde (PFA) (n = 5 animals per condition). The distal plantar cleaned with ethanol 70%. Femur and tibial bones were dissected, pads of the hind paw were carefully excised and postfixed with 4% bone epiphyses removed, and bone marrows flushed with chilled paraformaldehyde for an hour to be later cryopreserved in sucrose PBS using a 10-­ml syringe and 25G needle. Cells were centrifuged 30% solution. Pads 1, referred as the most distal and medial pads at 500 RCF for 10 min, to be later cultured in 100 ml Petri plates that belong to the innervation territory of the sciatic and saphenous with DMEM/F12 medium that contained 10% fetal bovine serum, nerves, and Pads 2, referred as the most distal and lateral pads that 1% penicillin–­streptomycin, and L-­glutamine. Macrophage colony-­ belong only to the innervation territory of the sciatic nerve, were cut stimulating factor (M-­C SF) was added at 10 ng/ml. Medium was re- longitudinally at 40 μm thickness in a Leica CM190 cryostat (https:// placed every 3 days with the correspondent addition of M-­C SF. At drp8p5tqcb2p5.cloudfront.net/fileadmin/downloads_lbs/Leica%20 8 days in vitro (div), adherent cells were reseeded in 6-­well plate in CM1950/User%20Manuals/Leica_CM1950_IFU_2v1N_en.pdf, a density of 1.6 × 106 cells/well with the medium mentioned above, RRID:SCR_018061). Free-­floating samples were washed with PBS but without the differentiating factor. Cells were treated at 10 div and PBS-­0.3% Tween, and later incubated overnight at 4°C with with vehicle containing DMSO or JQ1 1,000 nM for 6 hr (n = 3 in- PBS-­0.3%Triton, 1.5% normal donkey serum, and rabbit anti-­PGP9.5 dependent experiments). Then, conditioned medium was harvested antibody (Table 1). Samples were washed with PBS-­0.3% Tween and and snap-­frozen with liquid nitrogen. again incubated overnight at 4°C with PBS 0.3% Triton, normal don- Media from treated-­BMDM cells were filtered through 10 kDa key serum 5% and Alexa fluor 594 donkey anti-­rabbit (Table 1) Pad ultrafiltration filters (Merck Millipore). Samples were centrifuged at slices were washed with PBS-­0.3% Tween, PBS, incubated 1/5,000 4°C and 10 000× g for 1 hr. A concentrated medium volume of 50 μl in DAPI-­PB for 2 min and washed in PB 1x. Samples were then was obtained from each 1 ml medium sample, thus concentrated heated at 37°C until dry and mounted with Fluoromount. 20×. Concentrated media were snap-­frozen in liquid nitrogen. Intraepidermal nerve fiber (IENF) density and the number of Meissner corpuscles were estimated using a Olympus BX51 Fluorescence Microscope (https://www.olympus-lifescience.com/en/microscope-​ 2.6 | DRG explant culture with or without resource/primer/techniques/fluorescence/bx51fluorescence/, BMDM-­conditioned media RRID:SCR_018949). IENFs were counted on the lateral area of the pads, whereas Meissner’s corpuscles are found on the apex. To Mice were euthanized with pentobarbital diluted in saline (1:1) and determine the number of IENFs per mm length, the basal layer was washed in 70% ethanol. All DRGs were extracted using sterilized localized by the observation of DAPI staining. The ocular 40× grid surgery tools and preserved in cold Gey’s balanced solution with was oriented following the basal layer to determine the number 0.6% glucose. DRG roots were removed and nervous tissue was ex- of nerve fibers that crossed it. A total of two fields per slice were posed. DRGs were placed in a 24-­well plate between two droplets counted. The number of Meissner's corpuscles was also determined of collagen mixture in Neurobasal-­A medium with 1% penicillin–­ at 400× magnification. streptomycin, 1x B-­27, 0.5% glucose, 0.5% glutamax, and murine 1334 | PALOMÉS-­BORRAJO et al. TA B L E 1 Antibody list Used concentration, Name of primary antibody Immunogen Manufacturer, catalog number, RRID, host application RT-­97 H-­Neurofilament DSHB Cat# rt97, RRID:AB_528399, mose, 1/200, IHC monoclonal PGP 9.5 (UCHL1) PGP 9.5 (CEDARLANE Cat# CL7756AP, 1/500, IHC RRID:AB_2792979, rabbit, polyclonal Stat3 (79D7) Stat3 Cell Signaling Technology Cat# 4904, 1/1,000, WB RRID:AB_331269, rabbit, monoclonal Phospho-­Stat3 (Tyr705) (D3A7) Phospho-­Stat3 (Tyr705) (Cell Signaling Technology Cat# 9145, 1/1,000, WB RRID:AB_2491009), rabbit, monoclonal Stat6 (D3H4) Stat6 (Cell Signaling Technology Cat# 5397, 1/1,000, WB RRID:AB_11220421), rabbit, monoclonal Phospho-­STAT6 (Tyr641) (46H1L12) Phospho-­STAT6 (Tyr641) (Thermo Fisher Scientific Cat# 700247, 1/250, WB RRID:AB_2532305), rabbit, monoclonal Monoclonal Anti-­α-­tubulin antibody α-­Tubulin (Sigma-­Aldrich Cat# T9026,RRID:AB_477593) 1/10,000 WB produced in mouse mouse, monoclonal Used concentration, Name of secondary antibody Immunogen Manufacturer, catalog number, RRID, Host application Donkey Anti-­Rabbit IgG (H + L) Rabbit IgG (H + L) (Molecular Probes Cat# A-­21207, 1/200, IHC Antibody, Alexa Fluor 594 RRID:AB_141637), donkey Conjugated Donkey Anti-­Mouse IgG (H + L) Mouse IgG (H+L) (Molecular Probes Cat# A-­21203, 1/200, IHC Antibody, Alexa Fluor 594 RRID:AB_141633), donkey Conjugated Goat Anti-­Rabbit IgG (H L)-­HRP Goat Rabbit IgG (H + L) (Bio-­Rad Cat# 170–­6515, RRID:AB_11125142), 1/3,000, WB Conjugate antibody goat Goat Anti-­Mouse IgG (H L)-­HRP Goat Mouse IgG (H + L) (Bio-­Rad Cat# 170–­6516, RRID:AB_11125547), 1/3,000, WB Conjugate antibody goat DAPI (Sigma-­Aldrich Cat#D9564-­10MG) 1/5,000 in Pads; 1/1,000 in DRGs TA B L E 2 Primer list Gene Forward primer: 5′-­3′ Reverse primer: 5′-­3′ Mouse BDNF TGCAGGGGCATAGACAAAAGG CTTATGAATCGCCAGCCAATTCTC Mouse CD68 CCAATTCAGGGTGGAAGAAA ATGGGTACCGTCACAACCTC Mouse GAPDH TGGCCTTCCGTGTTCCTAC GAGTTGCTGTTGAAGTCG Mouse GAP43 CTGCTGTCACTGATGCTGCT GGTTTGGCTTCGTCTACAGC Mouse GDNF ATTTTATTCAAGCCACCATTA GATACATCCACACCGTTTAGC Mouse IL-­4 GGCTTTCCTCTTTCCCACTC AGCCGCCATGAGAGCTAAG Mouse IL-­10 GCTGAGACTTTCGCTCCTCTC AGCTCCAAGGCACCTGTTC Mouse IL-­13 TCCAATTGCAATGCCATCTA TGGGCTACTTCGATTTTGGT Mouse iNOS GGCCAGCCTGTGAGACCTTT TTGGAAGTGAAGCGTTTCG Mouse NGF CAAGGACGCAGCTTTCTATACTG CTTCAGGGACAGAGTCTCCTTCT Mouse SCG-­10 TTCTCGTGGAGTGTGTGCTTCACT TAGCTTTGTGTTTGTGTTCGGCCC β-­NGF (100 ng/ml, Peprotech). The collagen mixture used for the For DRG explant culture with BMDM-­conditioned medium, the pro- culture consisted in 446.43 μl of rat collagen type 1 (Corning), 50 μl cedure was the same except for the preparation of the collagen mixture. of MEM 10X medium, 2 μl of 7.5% sodium bicarbonate (Gibco), and In this case, half of the MEM 10x medium was substituted with con- 1.57 μl of PBS. Either JQ1 (500 or 1,000 nM) or DMSO was added ditioned medium and the amount of sodium bicarbonate added to the into the collagen and into the medium. The culture was maintained mixture was 8 μl. Provided that JQ1 is a small compound that is filtered for 2 div before fixation and immunohistochemical analysis. during medium concentration, JQ1 or DMSO was also added to collagen PALOMÉS-­BORRAJO et al. | 1335 to obtain a 500 nM concentration. This procedure resulted in four ex- before proceeding with the mechanical digestion. Cells were then perimental culture groups: DMSO-­treated DRGs with conditioned me- filtered within a 70-­μm sterile filter to remove myelin fragments. dium from DMSO-­treated macrophages (D + mD), DMSO-­treated DRGs Dissociated ganglia underwent a centrifugation at 900 rpm for 7 min with conditioned medium from JQ1-­treated macrophages (D + mJQ1), and neurons were counted with a Neubauer chamber. A total of eight JQ1-­treated DRGs with conditioned medium from DMSO-­treated mac- wells were seeded per animal in a 96-­multiwell plate pretreated with rophages (JQ1 + mD), and JQ1-­treated DRGs with conditioned medium Poly-­d-­lysine (0.01 mg/ml) and laminin (2 μg/ml). Each well held be- from JQ1-­treated macrophages (JQ1 + mJQ1) (n = 3 independent ex- tween 5000 and 6000 neurons that were maintained in Neurobasal-­A periments). The cultures were also maintained 2 div before fixation. medium with 2% B-­27, 2% glucose at 30%, 1% glutamine, and 1% peni- cillin and streptomycin. After 2 hr, medium was replaced. At 2 div, cells were treated in duplicates with vehicle containing 2.7 | Determination of neurite outgrowth in DMSO, JQ1 500 nM, JQ1 1000 nM, or cisplatin 5 μg, used as a posi- DRG explants tive control. At 4 div, an MTT (3-­[4,5-­dimethylthiazol-­2-­yl]-­2,5-­dipheny ltetrazolium bromide) assay was performed to determine cell viability. After 2 div, DRG explants were fixed for 30 min with PFA 4%. Then, For this purpose, media was replaced with media containing 0.15 mg/ samples underwent several washes with TBS-­0.1% Tween before ml MTT. Next, the culture was maintained at 37°C for 2 hr, to finally being incubated for an hour in citrate buffer (pH = 6.4) heated until obtain cells lysed with DMSO. Absorbance was read out through a boiling temperature, and washed again in TBS-­0.1% Tween. DRGs spectrophotometer (Bio-­tek) at 560 nm and 600 nm wavelength using were incubated in increasing concentrations of methanol (50%, 70%, KC Junior software. Readings were normalized against control to ob- and 100%), washed in TBS-­0.1% Tween and incubated for 48 hr tain the percentage of survival. In total, there were five independent at 4°C in TBS-­0.3% Triton, 5% normal donkey serum, and anti-­H-­ cultures. Neurofilament antibody (Table 1). DRGs were washed with TBS-­0.1% Tween and incubated overnight at 4°C with TBS-­0.3% Triton, 5% nor- mal donkey serum, and Alexa fluor 594 Donkey anti-­mouse (Table 1). 2.9 | Western blot Samples were washed, dried, and mounted with Fluoromont. DRG samples were observed under a fluorescence microscope Protein samples for western blot analysis were obtained from DRG (Olympus BX51). Images of overlapping territories of each DRG were explant cultures treated with conditioned medium from DMSO-­ or taken with 20X objective, the microscope camera (Olympus PD37) JQ1-­treated macrophages. At 2 div, collagen layers encapsulating and CellSens Entry Olympus software (https://www.selectscience. the ganglia were removed using forceps (Dumont #5). DRGs were net/products/cellsens-entry---microscopy-imaging-software/?​ collected in a cryovial according to the treatment and were immedi- prodID=172461, RRID:SCR_014551). DRG images were recon- ately snap-­frozen in liquid nitrogen. Next, DRGs were homogenized structed with Photoshop. Maximum neurite length and the number with modified RIPA buffer with protease (100 X) (Sigma) and phos- of neurites of different lengths were measured with the Image J phatase (20X) (Roche) inhibitors. Samples underwent sonication plugin Neurite J (Torres-­E spin et al., 2014). The software provided and centrifugation at 14,000 rpm for 20 min at 4°C. Protein con- the number of neurite intersections every 25 μm, and the longest centration of the supernatant was determined with a bicinchoninic neurite value for each DRG. Number of analyzed samples per group acid assay (Pierce). SDS-­PAGE was conducted in a 7.5% acrylamide was between five and seven DRGs in the BET inhibition study, and gel, where 20 μg of protein was loaded from each sample. Proteins between seven and 12 in the conditioned medium study, obtained were transferred to a PVDF membrane, that was blocked in 3% BSA from three independent cultures in both cases. The analysis of neur- prior to an overnight incubation with the appropriate primary an- ite outgrowth was performed by a blinded examiner. tibodies. Several washings with TBS-­Tween 0.1% were performed and the correspondent secondary antibodies incubated during 2 hr at room temperature. Finally, membranes underwent multiple 2.8 | Cell viability assay from dissociated washes with TBS-­Tween 0.1% and TBS, before image acquisition DRGs' culture with Bio-­Rad Chemidoc XRS Gel Imaging System (https://www.bio- rad.com/en-us/product/chemidoc-xrs-system?ID=NINJHRKG4, Mice were euthanized with pentobarbital and saline mixture (1:1). All RRID:SCR_019690). Quantification was then assessed using the dorsal root ganglia were extracted with sterilized tools and kept in cold ImageLab software (http://www.bio-rad.com/en-us/sku/1709690- Gey’s balanced solution with 2% glucose. DRG roots were cut to dis- image-lab-software, RRID:SCR_014210). Protein levels were close nervous tissue. Then, cleaned ganglia underwent an enzymatic analyzed considering the relative intensities of the bands of the digestion with trypsin 1x, collagenase 1x, and DNase (1 mg/ml) diluted phosphorylated protein forms, which were later compared to total in Hank’s Balanced Salt Solution (HBSS, Gibco) for 20 min at 37°C. non-­phosphorylated protein. Then, results were normalized to con- Next, enzymatic digestion was arrested with DMEM/F12 medium trol. Primary and secondary antibodies used for western blot are in containing 10% FBS, 1% penicillin and streptomycin, and L-­glutamine, Table 1. There were three blots per protein analysis. 1336 | PALOMÉS-­BORRAJO et al. 2.10 | Statistical analysis treatment started at 0 dpo. We further studied the effects of JQ1 in neurotrophic factor expression. We did not observe changes of Data were expressed as mean ± standard deviation (SD) as minimum glial-­derived neurotrophic factor (GDNF) (F2,7 = 0.137, p = 0.874) and to maximum in Box and Whisker plots. Data distribution and outliers brain-­derived neurotrophic factor (BDNF) (F2,7 = 1.833, p = 0.229) ex- were determined using the GraphPad Prism software. Results were pression, whereas we found a reduction of nerve growth factor (NGF) analyzed with GraphPad Prism 7 software, and significant differences with the treatment starting at 0 dpo (F2,7 = 14.400, p = 0.003), prob- considered when p < 0.05. For electrophysiological tests, CMAP values ably due to the reduced infiltration of macrophages. were analyzed by two-­way ANOVA followed by Tukey's correction for We then wanted to ascertain if the transcriptional alterations multiple comparisons, with day and amplitude or latency as factors. The promoted by JQ1 produced an effect on axonal growth markers CNAP results were compared with an unpaired t test since only a final expression (Figure 1c). We did not observe an alteration in the su- value was recorded. Histological data of pad reinnervation were ana- perior cervical ganglion-­10 protein (SGC-­10) (F2,6 = 1.833, p = 0.229), lyzed by unpaired t test. For statistical analysis of mRNA expression, whereas we found an enhanced expression of the Growth associated maximum neurite length of DRG explants treated with increasing doses protein 43 (GAP43) when the treatment started at 4 dpo (F2,6 = 6.698, of JQ1, and cell viability assay, one-­way ANOVA followed by a multiple p = 0.0270). Therefore, we planned to further study the effects of comparison test with Tukey’s correction was performed, since only the axonal regeneration in vivo by a delayed treatment with JQ1. level of the mRNA, the number of neurites. and % of viable cells were analyzed within the different conditions. The number of neurites at var- iable distances was analyzed through a two-­way ANOVA followed by 3.2 | BET protein inhibition does not enhance Sidak’s correction for multiple comparisons, using the distance growth nerve regeneration after sciatic nerve crush and treatments as factors. Maximum neurite length for the conditioned medium experiment was also analyzed using a two-­way ANOVA fol- The analysis of functional and histological outcome was performed lowed by Sidak's correction, in which conditioned media and treatment in mice with delayed treatment of vehicle and JQ1. Motor nerve con- were factors. For WB analysis, a paired t test was conducted, to com- duction tests determine muscle reinnervation, as recorded CMAPs, pare the level of the protein between treatments. by regenerated axons after injury. CMAPs were first recorded in the tibialis anterior and plantar muscles at 14 dpo, being of small amplitude and increased latency (Figure 2). At later time points, the 3 | R E S U LT S latency time decreased indicating axonal enlargement and remyeli- nation after reinnervating the muscle fibers. No differences were 3.1 | Delayed treatment with JQ1 promotes found between vehicle and JQ1-­treated animals (F2,14 = 1.380, enhanced expression of anti-­inflammatory cytokines p = 0.280 for tibialis anterior and F2,14 = 0.057, p = 0.945 for plantar and the axonal growth marker GAP43 after sciatic muscle). Regarding the amplitude of the CMAP, which determines nerve crush the amount of innervated muscle fibers, as indicator of nerve regen- eration, at 14 dpo the M amplitude was very low in both muscles, Since BET protein inhibition by JQ1 alters macrophage transcrip- around 5% of control values in the tibialis anterior muscle (Figure 2a) tional state (Nicodeme et al., 2010; Sanchez-­Ventura et al., 2019) and and 2.5% in the plantar muscle (Figure 2b). At 21 and 28 dpo, the macrophage infiltration after PNI occurs early after injury, we com- CMAP amplitude increased in both muscles recorded. However, pared the effect between an early and a delayed treatment with JQ1 there were not significant differences between JQ1-­treated and in sciatic nerve (Figure 1a). We observed a reduced expression of vehicle-­treated groups (F2,14 = 0.354, p = 0.708 for tibialis anterior the macrophage marker Cluster of differentiation 68 (CD68) when the and F2,14 = 0.596, p = 0.565 for plantar muscle). treatment started at 0 dpo, indicating a reduction on macrophage For the sensory nerve conduction test, CNAPs of the digital nerve infiltration (F2,7 = 4.637, p = 0.052). The expression of inducible ni- were recorded only at 28 dpo. The CNAP latency was increased in tric oxide synthase (iNOS) and CD206, which correspond to M1 and the two groups of mice (t7 = 2.516, p = 0.040). Regarding CNAP am- M2 macrophage markers, respectively, was also reduced within this plitude, although JQ1-­treated group showed a tendency to be higher treatment, probably due also to a lessened macrophage infiltration (30%) compared to the vehicle-­treated group (25%), the difference (iNOS, F2,6 = 14.170, p = 0.004) (CD206, F2,6 = 13.660, p = 0.006). was not statistically significant (Figure 2c) (t7 = 1.126, p = 0.297). However, when the treatment started at 4 dpo, we did not observe To further study the effects of BET inhibition on axonal regen- changes in CD68, iNOS, or CD206 mRNA expression compared to eration, we analyzed skin reinnervation of the hind paw. Regarding vehicle-­treated animals, indicating that the delayed treatment al- IENF density, JQ1-­treated animals showed a tendency of higher num- lowed macrophages to infiltrate, and that JQ1 does not affect M1/M2 ber of IENFs/mm (Figure 3b), compared to vehicle-­treated animals. macrophage polarization. IL-­4 and IL-­13 anti-­inflammatory cytokine However, no statistical differences were found. This was observed in expression was statistically enhanced within animals treated with medial Pads 1 (Vehicle: 47.58 ± 5.39; JQ1: 61.17 ± 1.64) (t5 = 2.082, JQ1 from 4 dpo (IL-­4, F2,6 = 20.380, p = 0.002) (IL-­13, F2,6 = 10.520, p = 0.092), as well as in lateral Pads 2 (Vehicle: 45.05 ± 2.10; JQ1: p = 0.011), whereas IL-­10 was not altered (F2,7 = 4.023, p = 0.069) 48.28 ± 1.81) (t7 = 1.166, p = 0.280). Regarding the number of (Figure 1b). A mild increase of IL-­4 also was observed when the Meissner’s corpuscles (Figure 3c), no significant differences were PALOMÉS-­BORRAJO et al. | 1337 F I G U R E 1 Delayed BET inhibition with JQ1 increases anti-­inflammatory cytokine and GAP43 transcription in vivo. (a) Early treatment with JQ1 at 0 dpo significantly decreases macrophage infiltration detected with CD68. Neither of the treatments alters M1/M2 polarity as detected with iNOS (M1) and CD206 (M2). (b) Delayed BET inhibition increases the transcription of IL-­4 and IL-­13 anti-­inflammatory cytokines. (c) Immediate administration of JQ1 at 0 dpo decreases NGF mRNA expression. (d) BET inhibition at 4 dpo increases GAP43 transcription, while not altering the mRNA levels of SGC-­10. *p < 0.05 and **p < 0.01 as calculated by one-­way ANOVA followed with a multiple comparison with Tukey’s correction. Data are shown as minimum to maximum box and whisker graphs found between treatments in Pads 1 (Vehicle: 3.04 ± 1.14; JQ1: 3.3 | BET protein inhibition reduces DRG 3.53 ± 0.37) (t5 = 0.350, p = 0.741) or Pads 2 (Vehicle: 1.02 ± 0.33; neurite outgrowth JQ1: 1.14 ± 0.47) (t7 = 0.202, p = 0.845). Therefore, the results of in vivo tests showed that JQ1 adminis- We analyzed the effects of BET protein inhibition on neurite out- tration did not have any significant effect on axonal regeneration in growth in DRG explants ex vivo, by adding to the medium variable the mice. doses of JQ1 or DMSO as control. Two parameters were analyzed in 1338 | PALOMÉS-­BORRAJO et al. F I G U R E 2 BET proteins do not affect nerve regeneration after sciatic nerve crush assessed by electrophysiological tests. No significant differences were found between BET-­inhibited animals (JQ1) and control animals (DMSO) in the electrophysiological recordings of the latency and amplitude of the CMAP of tibialis anterior muscle (a), CMAP of plantar muscle (b), and CNAP of the digital nerve (c). Data shown as mean ± SD and minimum to maximum in box and whisker graphs this study: maximum neurite length and number of neurites of dif- to 125 μm in length (Upper Figure 4c), compared to DMSO-­treated ferent lengths. ganglia (F16,340 = 2.280, p = 0.004). The decrement in neurite growth DMSO-­treated DRGs had a mean maximal neurite length of was more pronounced with JQ1 at 1000 nM, showing a significant 313 μm, whereas JQ1 500 nM and JQ1 1000 nM treatment led reduction on the amount of neurites from 0 μm to 150 μm compared to a significant decrease on the maximum neurite length, reach- with DMSO (Lower Figure 4c) (F16,374 = 16.840, p < 0.001). ing mean values of 175 μm and 58 μm, respectively (Figure 4a,b) Therefore, BET inhibition produced a significant decrease on (F2,14 = 34.610, p < 0.001). The number of neurites grown at dif- DRG neurite outgrowth, that was dependent on the JQ1 concen- ferent lengths showed that DRGs treated with 500 nM JQ1 had a tration. To determine if this decrease was due to compound toxic- significant decrease on the number of neurites ranging from 50 μm ity, we performed an MTT assay (Figure 4d). Results showed that PALOMÉS-­BORRAJO et al. | 1339 F I G U R E 3 BET protein inhibition does not modify sensory reinnervation after sciatic nerve crush. (a) Microphotographs of hind paw pads at ×10 magnification of vehicle and JQ1-­treated animals immunolabeled against PGP9.5. Arrow tips point IENFs, whereas arrows exhibit the location of Meissner’s corpuscles. Scale bar = 100 μm. (b) No significant differences were found in IENFs density of vehicle and JQ1-­treated mice in medial pad 1 and lateral pad 2. (c) No significant differences were found in the number of Meissner’s corpuscles of vehicle and JQ1-­ treated animals in pad 1 and pad 2. Data shown as minimum to maximum in box and whisker graphs 500 or 1,000 nM of JQ1 did not produce cell death, whereas the we hypothesized that these differences might be produced by mac- positive control cisplatin led to 60.07% of cell death (F3,14 = 12.330, rophages, which infiltrate the nerve after lesion in vivo, but were p < 0.001). missing in the DRG cultures. To assess the effects that BET-­inhibited macrophages have on neurons ex vivo, we cultured DRG explants with conditioned medium from JQ1 or DMSO-­treated macrophages 3.4 | BET protein-­inhibited macrophages secrete added into the collagen matrix. pro-­regenerative factors Control DRGs treated with DMSO-­conditioned medium (D + mD) had a maximum neurite length of 258 μm in average. A significant Results obtained from in vivo and ex vivo data indicated contradic- increase in neurite outgrowth was found when DRGs were treated tory effects of BET protein inhibition on axonal growth. Therefore, with JQ1 conditioned medium (D + mJQ1), with a mean maximal 1340 | PALOMÉS-­BORRAJO et al. F I G U R E 4 BET protein inhibition reduces DRG neurite outgrowth ex vivo. (a) Representative images from DRG explants at ×20 magnification show that BET protein inhibition decreases neurite outgrowth proportionally to JQ1 concentration. Scale bar = 100 μm. (b) BET inhibition with JQ1 reduces maximum neurite length. (c) JQ1 at 500 nM and 1000 nM significantly diminish the number of neurites of different lengths when compared to DMSO-­treated ganglia. (d) The different concentrations of JQ1 used in vitro do not produce cell death. *p < 0.05, #p < 0.01, %p < 0.001, and $p < 0.0001 as calculated by one-­way ANOVA with Tukey’s multiple comparison test and two-­way ANOVA analysis followed by Sidak’s correction of multiple comparisons. Data shown as mean ± SD or minimum to maximum in box and whisker graphs neurite length of 370 μm (Figure 5a,b). Since conditioned media from into the collagen and the medium of DRG explants. When JQ1 was macrophages was concentrated by filtration, this media contained 20 administered in the collagen, it reduced neurite outgrowth, despite times less of JQ1 small compound while increased the concentration the conditioned media added (Figure 5a,b). Significant differences of high molecular weight molecules secreted by macrophages. Thus, were observed between D + mD (258 μm) and J + mD (107 μm), we can discard any direct effect of JQ1 on the cultured neurons. and between D + mJ (370 μm) and J + mJ (109 μm). In addition, Therefore, these results indicate that BET-­inhibited macrophages contrarily to what we expected, JQ1 conditioned medium did not secrete pro-­regenerative factors that stimulate neurite outgrowth. overcome the detrimental effects of direct BET inhibition on neu- Then, we wanted to assess if these pro-­regenerative factors rons, since there were no differences between J+ mD (107 μm) and were also able to counteract the effects produced by direct BET J + mJ (109 μm) (Interaction F1,34 = 2.974, p = 0.0937; Row factor protein inhibition on DRG neurons. For this purpose, JQ1 was added (conditioned media) F1,34 = 3.221, p = 0.0816; and Column factor PALOMÉS-­BORRAJO et al. | 1341 F I G U R E 5 Conditioned media from BET-­inhibited macrophages enhance DRG neurite outgrowth. (a) Representative images from DRG explants at ×20 magnification show that media from BET-­inhibited macrophages enhances neuritogenesis. Scale bar = 100 μm. (b) Conditioned media from BET-­inhibited macrophages increases maximum neurite length in vitro. From left to right: DMSO in collagen + DMSO-­conditioned medium (D + mD), DMSO in collagen + JQ1-­conditioned medium (D + mJ), JQ1 in collagen + DMSO-­ conditioned medium (J + mD), and JQ1 in collagen + JQ1-­conditioned medium (J + mJ). (c) Conditioned media from JQ1-­treated macrophages increases the number of neurites of different lengths when DMSO is in collagen (upper graph). No significant differences are found between treatments regarding the number of neurites of different lengths when JQ1 is in collagen (lower graph). *p < 0.05, #p < 0.01, and $p < 0.0001 as calculated by two-­way ANOVA with Sidak’s correction of multiple comparisons. Data shown as mean ± SD or minimum to maximum in box and whisker graphs 1342 | PALOMÉS-­BORRAJO et al. (treatment) F1,34 = 41.86, p < 0.0001) (Figure 5b). Hence, this experi- Overall, BET inhibition after sciatic nerve crush injury in mice did ment confirmed our hypothesis that cultured macrophages secreted not produce any effect on axonal regeneration. In contrast, direct factors that stimulated neurite growth when treated with JQ1. inhibition of BET proteins in neurons ex vivo produced a decrease To further corroborate our findings, we determined the number in neuritogenesis. However, BET-­inhibited macrophages secrete of neurites of different lengths. We found that DMSO-­treated DRGs pro-­regenerative factors that promoted neurite outgrowth in DRG with JQ1 conditioned medium (D + mJ) had a significant increase in cultures, at least by enhancing the STAT6 pathway. Thus, specific the number of neurites ranging from 0 μm to 200 μm (Figure 5c, top), targeting of BET proteins in macrophages may be needed to effi- when compared to DMSO-­treated ganglia with DMSO-­conditioned ciently enhance axonal regeneration and functional recovery after medium (D + mD) (Interaction F23,504 = 8.631, p < 0.0001; Row factor PNI. (length) F23,504 = 48.89, p < 0.0001; and Column factor (treatment) The effects of JQ1 treatment on axonal growth were first ana- F1,504 = 152.6, p < 0.0001). However, no significant differences were lyzed after sciatic nerve crush injury in mice. Results of the mRNA found between JQ1-­treated DRGs with DMSO-­conditioned me- expression analysis demonstrated a reduced infiltration of macro- dium (JQ1 + mD) and JQ1-­treated DRGs with JQ1-­conditioned me- phages when JQ1 treatment started at 2 hr postinjury, whereas a dium (JQ1 + mJQ1) (Figure 5c, bottom) (Interaction F23,312 = 0.1894, delayed treatment did not. In addition, an enhanced expression of p > 0.9999; Row factor (length) F23,312 = 11.91, p < 0.0001; and IL-­4 and IL-­13 and GAP43 was found with the delayed treatment of Column factor (treatment) F1,312 = 0.6133, p = 0.4342). These results JQ1. It is known that BET protein inhibition reduces chemokine ex- are consistent with the maximum neurite length analysis, as it demon- pression in macrophages (Nicodeme et al., 2010; Sanchez-­Ventura strates that JQ1-­treated macrophages conditioned medium increased et al., 2019), which are essential for macrophage infiltration. Thus, neurite outgrowth. Nonetheless, JQ1-­conditioned medium did not we hypothesized that an early treatment with JQ1 would reduce overcome the negative effects of direct BET inhibition, probably due macrophage infiltration, negatively affecting the development of to the high concentration of JQ1 used in the ex vivo explants. Wallerian degeneration and consequently hindering future out- come. Therefore, we used a delayed treatment with JQ1 since it allows an early macrophage infiltration, which may be useful for 3.5 | Conditioned medium from BET-­inhibited further experiments. However, electrophysiological and histolog- macrophages induce STAT6 phosphorylation in ical results showed that the delayed treatment with JQ1 did not DRG explants have any effect on sensory or motor reinnervation after injury. Mice were treated with 30 mg/kg/24 hr, which is the same dose Our previous experimental study described that BET-­inhibited mac- we previously reported to have beneficial effects after spinal cord rophages increase anti-­inflammatory cytokine expression of IL-­4, IL-­ injury (Sanchez-­Ventura et al., 2019). Besides, increasing doses of 10, and IL-­13 (Sanchez-­Ventura et al., 2019). Moreover, former qPCR JQ1 could not be used since long-­term administration of higher analysis demonstrates that JQ1 treatment at 4 dpo after sciatic nerve doses of JQ1 produce a reduction of body weight and eventual crush increases IL-­4 and IL-­13 cytokine transcription. As experi- death of mice (data not shown). Further, it has been reported by mental evidence points that anti-­inflammatory cytokines promote other authors that doses over 50 mg/kg led to detrimental side neurite outgrowth through acting on JAK/STAT pathways (Vidal effects on mice (Korb et al., 2015; Matzuk et al., 2012). Since no et al., 2013), we aimed to determine the activation state of these changes on nerve regeneration were observed in mice, to better pathways. For this purpose, DRG explants were treated with condi- decipher the action of BET proteins on axonal regeneration in neu- tioned media from JQ1 or DMSO-­treated macrophages. We found rons, we used DRG ex vivo cultures. that ganglia treated with conditioned medium from BET-­inhibited We observed that JQ1 reduced neurite growth when interact- macrophages displayed a significant increase in the phosphorylation ing directly with neurons in culture. The mechanisms producing of STAT6 (Figure 6a,b, Figure S1), being 2.46 times higher than in neurite outgrowth inhibition are not known. Cell viability assay DRGs treated with conditioned medium from DMSO-­treated mac- demonstrated that JQ1 was not toxic at the used concentrations, rophages (t3 = 3.278, p = 0.046). However, no significant differences confirming the results of other authors in human mesenchymal between treatments were found regarding the activation of STAT3 stem cells and neurons (Bakshi et al., 2018; Li et al., 2020). It has pathway (Figure 6c,d, Figure S1) (t3 = 1.903, p = 0.153). Thus, condi- been previously reported that treatment with JQ1 on cortical tioned medium from BET-­inhibited macrophages led to an increased neurons produce gene repression of immediate early genes such phosphorylation of STAT6, probably through an enhanced release of as Arc and Fos Nr4a1 in response to BDNF external stimulation IL-­4 and IL-­13 anti-­inflammatory cytokines. (Korb et al., 2015). Thus, it seems appropriate to hypothesize that JQ1 prevents the expression of genes associated with neu- rite growth in neurons. However, an exhaustive study remains 4 | DISCUSSION to be performed to determine which neuronal genes are directly affected by BET inhibition. In addition, several authors have re- In the present study we have analyzed the effects of BET inhibi- ported that JQ1 treatment leads to a decrease in mTOR phosphor- tion on nerve regeneration in vivo and neurite outgrowth ex vivo. ylation (Jang et al., 2017; Li et al., 2019; Li et al., 2020). Therefore, PALOMÉS-­BORRAJO et al. | 1343 F I G U R E 6 STAT6 phosphorylation in DRG explants is produced by conditioned media from BET-­inhibited macrophages. (a) Representative images obtained from western blots against p-­STAT6 and STAT6 of DRGs treated with conditioned media from macrophages treated with JQ1 or vehicle. (b) Quantification of (a) showing that DRGs treated with conditioned media from BET-­inhibited macrophages increase STAT6 phosphorylation relative to STAT6, compared to ganglia treated with conditioned media from DMSO-­treated macrophages (DMSO). (c) Representative images from western blots against p-­STAT3 and STAT3 of DRGs treated with conditioned media from macrophages treated with JQ1 or vehicle. (d) Quantification of (c) showing that there were no significant differences regarding the protein levels of p-­STAT3 relative to STAT3 of DRGs treated with conditioned media from DMSO-­treated macrophages and BET-­inhibited macrophages. *p < 0.05 as calculated by a paired t test. Data shown as minimum to maximum in box and whisker graphs since it has been described that mTOR activation leads to neurite Further studies demonstrated that the discrepancy of the JQ1 ef- outgrowth and peripheral nerve regeneration (Abe et al., 2010; fect on axonal growth between the in vivo and ex vivo experimental Chen, Lu, et al., 2016; Liu et al., 2019), it is also possible that BET settings could be accounted to the effect of BET inhibition in macro- inhibition in neurons could reduce the intrinsic regenerative ca- phages in vivo. Conditioned medium from JQ1-­treated macrophages pacity of neurons by decreasing the activation of mTOR pathway. enhanced neurite outgrowth in DRG neurons, thus indicating that Nonetheless, deeper research should be performed to confirm the BET-­inhibited macrophages secrete pro-­regenerative factors that former hypothesis. induce neuritogenesis. We have previously shown that treatment 1344 | PALOMÉS-­BORRAJO et al. with JQ1 to activated macrophages reduced the expression of pro-­ Finally, it should be also pointed out that we have only used fe- inflammatory cytokines, such as IL-­6, IL-­1b, and TNFα, and promoted males in this study, which may be a limitation for deciphering po- the expression of anti-­inflammatory cytokines IL-­4, IL-­10, and IL-­13 tential sex differences. Since differential regenerative capacities (Sanchez-­Ventura et al., 2019). In this study, we further corroborated between males and females is controversial (Kovacic et al., 2004; an enhancement of the expression of IL-­4 and IL-­13 after crush in- Wood et al., 2012), a further study with male mice may be performed jury with JQ1. Importantly, anti-­inflammatory cytokines, secreted in to obtain a complete vision of the results obtained. the denervated distal nerve stump, have a clear role increasing the In conclusion, this study demonstrates that BET protein inhi- capacity of proximal axons to cross the lesion zone. It is known that bition in macrophages provides a suitable condition to enhance animals lacking IL-­10 regenerate worse than WT animals (Siqueira axonal outgrowth, and brings insight on the relevance of the anti-­ Mietto et al., 2015), and that the administration of IL-­4 and IL-­10 inflammatory cytokines IL-­13 and IL-­4 and the STAT6 pathway in enhance axonal regeneration (Atkins et al., 2007; Vidal et al., 2013). axonal regeneration. Thus, BET proteins are an effective target to Therefore, our results suggest that BET inhibition leads to an increase improve axonal regeneration. However, a specific targeting of BET of anti-­inflammatory cytokines that compensates the detrimental ef- inhibition in macrophages would be needed to efficiently enhance fects that JQ1 has on neurons in vivo by activating pathways able functional recovery after PNI. to increase axonal regeneration. In the ex vivo studies, conditioned medium from JQ1-­treated macrophages was not able to overcome the inhibitory signaling of JQ1 present in the collagen matrix embed- DECLARATION OF TRANSPARENCY ding the DRG, thus acting directly on neurons. We hypothesize that within these cultures, JQ1 is in higher concentrations than in the in The authors, reviewers and editors affirm that in accordance to the vivo study in mice, producing a stronger effect on neuronal BET pro- policies set by the Journal of Neuroscience Research, this manuscript teins in the culture than in vivo. presents an accurate and transparent account of the study being re- To determine if cytokines are the potential mediators promoting ported and that all critical details describing the methods and results neurite growth of DRG explants, STAT3 and STAT6 phosphorylation are present. was assessed. We did not observe any changes on STAT3 phosphor- ylation in DRG samples treated with conditioned media from BET-­ AC K N OW L E D G M E N T S inhibited macrophages. STAT3 is activated through IL-­6 and IL-­10. In The authors acknowledge Dr. James Bradner and Dana-­Farber fact, IL-­6 and IL-­10 have been reported to produce neuronal regener- Cancer Institute (DFCI) for kindly providing the compound ation through phosphorylation and concomitant activation of STAT3 JQ1. They thank the technical help of Monica Espejo and (Chen, Lin, et al., 2016; Vidal et al., 2013). However, since our previ- Jessica Jaramillo. The RT-­97 antibody was obtained from the ous studies demonstrated that JQ1 reduces the expression of IL-­6, Developmental Studies Hybridoma Bank, developed under the which may compensate for the IL-­10-­enhanced expression (Sanchez-­ auspices of the NICHD and maintained by the University of Iowa, Ventura et al., 2019), we did not observe an effect on this pathway Department of Biology. to explain the enhanced neuritogenesis. In contrast, we found an enhanced phosphorylation of STAT6 in DRG samples treated with C O N FL I C T O F I N T E R E S T conditioned media from BET-­inhibited macrophages. The best known The authors declare that they have no conflict of interest. activators of STAT6 are IL-­13 and IL-­4 (Mori et al., 2016) which are, in turn, strongly induced by STAT6 itself (Czimmerer et al., 2018). In fact, AU T H O R C O N T R I B U T I O N S we previously found that BET-­inhibited macrophages secrete these GP and CP performed methodology, investigation and formal analy- cytokines (Sanchez-­Ventura et al., 2019), and we confirmed these sis. GP, XN and CP performed writing and manuscript preparation. results after a crush injury in sciatic nerve. Since there are previous XN and CP did funding acquisition. CP performed study conception reports showing that these cytokines promote axonal regeneration and supervision. (Vidal et al., 2013), the enhanced neuritogenesis in DRG explants observed by the secreted factors from BET-­inhibited macrophages PEER REVIEW could be attributed, at least in part, to this pathway. It should be also The peer review history for this article is available at https://publo​ considered that macrophages have two variants of IL-­4 receptor (IL-­ ns.com/publo​n/10.1002/jnr.25036. 4R) that are able to induce STAT6 phosphorylation. Type I IL-­4R can also lead to IRS-­2 phosphorylation and consequently to the activa- DATA AVA I L A B I L I T Y S TAT E M E N T tion of PIP3/Akt and Erk pathways (Czimmerer et al., 2018), which are The raw data can be found in the Universitat Autònoma de Barcelona also related to axonal regeneration (Hausott & Klimaschewski, 2019; repository, https://ddd.uab.cat/recor​d/243396 Saijilafu et al., 2013). Therefore, further studies should be performed, to also analyze the implication of the PIP3/Akt and ERK pathways on ORCID the neural outgrowth induced by BET-­inhibited macrophages. Xavier Navarro https://orcid.org/0000-0001-9849-902X PALOMÉS-­BORRAJO et al. | 1345 extremity: Evaluation of 60,422 leg injured patients from the REFERENCES TraumaRegister DGU(R) between 2002 and 2015. Scandinavian Abe, N., Borson, S. H., Gambello, M. J., Wang, F., & Cavalli, V. (2010). Journal of Trauma, Resuscitation and Emergency Medicine, 26(1), 40. Mammalian target of rapamycin (mTOR) activation increases ax- Jang, J. E., Eom, J. I., Jeung, H. K., Cheong, J. W., Lee, J. Y., Kim, J. S., & onal growth capacity of injured peripheral nerves. The Journal of Min, Y. H. (2017). AMPK-­ULK1-­mediated autophagy confers resis- Biological Chemistry, 285(36), 28034–­28043. tance to BET inhibitor JQ1 in acute myeloid leukemia stem cells. Allodi, I., Udina, E., & Navarro, X. (2012). Specificity of peripheral Clinical Cancer Research, 23(11), 2781–­2794. nerve regeneration: Interactions at the axon level. Progress in Korb, E., Herre, M., Zucker-­Scharff, I., Darnell, R. B., & Allis, C. D. (2015). Neurobiology, 98(1), 16–­37. BET protein Brd4 activates transcription in neurons and BET in- Atkins, S., Loescher, A. R., Boissonade, F. M., Smith, K. G., Occleston, N., hibitor Jq1 blocks memory in mice. Nature Neuroscience, 18(10), O’Kane, S., Ferguson, M. W. J., & Robinson, P. P. (2007). Interleukin-­10 1464–­1473. reduces scarring and enhances regeneration at a site of sciatic nerve Kovacic, U., Zele, T., Osredkar, J., Sketelj, J., & Bajrovic, F. F. (2004). repair. Journal of the Peripheral Nervous System, 12(4), 269–­276. Sex-­related differences in the regeneration of sensory axons and Bakshi, S., McKee, C., Walker, K., Brown, C., & Chaudhry, G. R. (2018). recovery of nociception after peripheral nerve crush in the rat. Toxicity of JQ1 in neuronal derivatives of human umbilical cord Experimental Neurology, 189(1), 94–­104. mesenchymal stem cells. Oncotarget, 9(73), 33853–­33864. Li, F., Yang, C., Zhang, H. B., Ma, J., Jia, J., Tang, X., Zeng, J., Chong, T., Bhattarai, P., Thomas, A. K., Cosacak, M. I., Papadimitriou, C., Wang, X., He, D., & Guo, P. (2019). BET inhibitor JQ1 suppresses Mashkaryan, V., Froc, C., Reinhardt, S., Kurth, T., Dahl, A., Zhang, cell proliferation via inducing autophagy and activating LKB1/ Y., & Kizil, C. (2016). IL4/STAT6 signaling activates neural stem cell AMPK in bladder cancer cells. Cancer Medicine, 8(10), 4792–­4805. proliferation and neurogenesis upon amyloid-­beta42 aggregation Li, Y., Xiang, J., Zhang, J., Lin, J., Wu, Y., & Wang, X. (2020). Inhibition in adult zebrafish brain. Cell Reports, 17(4), 941–­948. of Brd4 by JQ1 promotes functional recovery from spinal cord in- Chen, H., Lin, W., Zhang, Y., Lin, L., Chen, J., Zeng, Y., Zheng, M., Zhuang, jury by activating autophagy. Frontiers in Cellular Neuroscience, 14, Z., du, H., Chen, R., & Liu, N. (2016). IL-­10 promotes neurite out- 555591. growth and synapse formation in cultured cortical neurons after Liu, S., Jia, J., Zhou, H., Zhang, C., Liu, L., Liu, J., Lu, L., Li, X., Kang, Y., the oxygen-­glucose deprivation via JAK1/STAT3 pathway. Scientific Lou, Y., Cai, Z., Ren, Y., Kong, X., & Feng, S. (2019). PTEN modu- Reports, 6, 30459. lates neurites outgrowth and neuron apoptosis involving the PI3K/ Chen, W., Lu, N., Ding, Y., Wang, Y., Chan, L. T., Wang, X., Gao, X., Jiang, Akt/mTOR signaling pathway. Molecular Medicine Reports, 20(5), S., & Liu, K. (2016). Rapamycin-­resistant mTOR activity is required 4059–­4 066. for sensory axon regeneration induced by a conditioning lesion. Ma, C. H., Omura, T., Cobos, E. J., Latrémolière, A., Ghasemlou, N., eNeuro, 3(6), 0358-­16. Brenner, G. J., van Veen, E., Barrett, L., Sawada, T., Gao, F., Coppola, Czimmerer, Z., Daniel, B., Horvath, A., Rückerl, D., Nagy, G., Kiss, M., G., Gertler, F., Costigan, M., Geschwind, D., & Woolf, C. J. (2011). Peloquin, M., Budai, M. M., Cuaranta-­Monroy, I., Simandi, Z., Accelerating axonal growth promotes motor recovery after pe- Steiner, L., Nagy, B., Jr., Poliska, S., Banko, C., Bacso, Z., Schulman, ripheral nerve injury in mice. The Journal of Clinical Investigation, I. G., Sauer, S., Deleuze, J. F., Allen, J. E., … Nagy, L. (2018). The tran- 121(11), 4332–­4347. scription factor STAT6 mediates direct repression of inflammatory Matzuk, M. M., MR, M. K., Filippakopoulos, P., Li, Q., Ma, L., Agno, J. E., enhancers and limits activation of alternatively polarized macro- Lemieux, M. E., Picaud, S., Yu, R. N., Qi, J., Knapp, S., & Bradner, J. E. phages. Immunity, 48(1), 75–­90.e6. (2012). Small-­molecule inhibition of BRDT for male contraception. Deboy, C. A., Xin, J., Byram, S. C., Serpe, C. J., Sanders, V. M., & Jones, Cell, 150(4), 673–­684. K. J. (2006). Immune-­mediated neuroprotection of axotomized Mori, S., Maher, P., & Conti, B. (2016). Neuroimmunology of the interleu- mouse facial motoneurons is dependent on the IL-­4/STAT6 signaling kins 13 and 4. Brain Sciences, 6(2), 1–­18. pathway in CD4(+) T cells. Experimental Neurology, 201(1), 212–­224. Navarro, X. (2016). Functional evaluation of peripheral nerve regenera- DeFrancesco-­Lisowitz, A., Lindborg, J. A., Niemi, J. P., & Zigmond, R. E. tion and target reinnervation in animal models: A critical overview. (2015). The neuroimmunology of degeneration and regeneration in The European Journal of Neuroscience, 43(3), 271–­286. the peripheral nervous system. Neuroscience, 302, 174–­203. Navarro, X., Vivo, M., & Valero-­C abre, A. (2007). Neural plasticity after Dubovy, P., Hradilova-­Svizenska, I., Klusakova, I., Brazda, V., & Joukal, peripheral nerve injury and regeneration. Progress in Neurobiology, M. (2019). Interleukin-­6 contributes to initiation of neuronal re- 82(4), 163–­201. generation program in the remote dorsal root ganglia neurons Nicodeme, E., Jeffrey, K. L., Schaefer, U., Beinke, S., Dewell, S., Chung, after sciatic nerve injury. Histochemistry and Cell Biology, 152(2), C. W., Chandwani, R., Marazzi, I., Wilson, P., Coste, H., White, 109–­117. J., Kirilovsky, J., Rice, C. M., Lora, J. M., Prinjha, R. K., Lee, K., & Filippakopoulos, P., & Knapp, S. (2014). Targeting bromodomains: Tarakhovsky, A. (2010). Suppression of inflammation by a synthetic Epigenetic readers of lysine acetylation. Nature Reviews. Drug histone mimic. Nature, 468(7327), 1119–­1123. Discovery, 13(5), 337–­356. Rotshenker, S. (2011). Wallerian degeneration: The innate-­immune re- Fregnan, F., Muratori, L., Simoes, A. R., Giacobini-­Robecchi, M. G., & sponse to traumatic nerve injury. Journal of Neuroinflammation, 8, 109. Raimondo, S. (2012). Role of inflammatory cytokines in peripheral Saijilafu, H. E. M., Liu, C. M., Jiao, Z., Xu, W. L., & Zhou, F. Q. (2013). nerve injury. Neural Regeneration Research, 7(29), 2259–­2266. PI3K-­GSK3 signalling regulates mammalian axon regeneration by Hajmirza, A., Emadali, A., Gauthier, A., Casasnovas, O., Gressin, R., & inducing the expression of Smad1. Nature Communications, 4, 2690. Callanan, M. B. (2018). BET family protein BRD4: An emerging actor Sanchez-­Ventura, J., Amo-­Aparicio, J., Navarro, X., & Penas, C. (2019). in NFkappaB signaling in inflammation and cancer. Biomedicine, BET protein inhibition regulates cytokine production and pro- 6(1), 1–­16. motes neuroprotection after spinal cord injury. Journal of Hausott, B., & Klimaschewski, L. (2019). Promotion of peripheral nerve Neuroinflammation, 16(1), 124. regeneration by stimulation of the extracellular signal-­regulated ki- Siqueira Mietto, B., Kroner, A., Girolami, E. I., Santos-­Nogueira, E., Zhang, nase (ERK) pathway. Anatomical Record, 302(8), 1261–­1267. J., & David, S. (2015). Role of IL-­10 in resolution of inflammation Huckhagel, T., Nuchtern, J., Regelsberger, J., Gelderblom, M., Lefering, and functional recovery after peripheral nerve injury. The Journal of R., & TraumaRegister DGU. (2018). Nerve trauma of the lower Neuroscience, 35(50), 16431–­16442. 1346 | PALOMÉS-­BORRAJO et al. Torres-­Espin, A., Santos, D., Gonzalez-­Perez, F., del Valle, J., & Navarro, X. FIGURE S1 Uncropped images of WB from DRGs treated with media (2014). Neurite-­J: An image-­J plug-­in for axonal growth analysis in from DMSO-­(marked as V) and JQ1-­treated macrophages (referred organotypic cultures. Journal of Neuroscience Methods, 236, 26–­39. as J). (a) Pictures of samples from the first and second culture. (b) Vidal, P. M., Lemmens, E., Dooley, D., & Hendrix, S. (2013). The role of “anti-­inflammatory” cytokines in axon regeneration. Cytokine & Membranes belonging to the third culture Growth Factor Reviews, 24(1), 1–­12. Transparent Science Questionnaire for Authors Wood, K., Wilhelm, J. C., Sabatier, M. J., Liu, K., Gu, J., & English, A. W. (2012). Sex differences in the effectiveness of treadmill train- ing in enhancing axon regeneration in injured peripheral nerves. How to cite this article: Palomés-­Borrajo, G., Navarro, X. & Developmental Neurobiology, 72(5), 688–­698. Penas, C. (2022). BET protein inhibition in macrophages enhances dorsal root ganglion neurite outgrowth in female S U P P O R T I N G I N FO R M AT I O N mice. Journal of Neuroscience Research, 100, 1331–1346. Additional supporting information may be found in the online https://doi.org/10.1002/jnr.25036 version of the article at the publisher’s website.