14390531, 2022, S5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/rda.14191 by Spanish Cochrane National Provision (Ministerio de Sanidad), Wiley Online Library on [18/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License Received: 16 March 2022 | Accepted: 21 June 2022 DOI: 10.1111/rda.14191 S H O R T C O M M U N I C AT I O N Cryoprotectant role of exopolysaccharide ID1 in the vitrification/in-­straw warming of in vitro-­produced bovine embryos Iris Martínez-­Rodero1 | Albert Salas-­Huetos2,3,4,5 | Alina Ordóñez-­León6 | Carlos Olegario Hidalgo7 | Marc Yeste2 | Elena Mercadé8 | Teresa Mogas1 1 Department of Animal Medicine and Surgery, Autonomous University of Abstract Barcelona, Cerdanyola del Vallès, Spain The cold-­adapted bacterium Pseudomonas sp. ID1 produces the extracellular exopoly- 2 Biotechnology of Animal and Human Reproduction (TechnoSperm), Girona, saccharide ID1 (EPS ID1) with cryoprotective activity. This study was designed to Spain optimize the vitrification/in-­straw warming protocol of in vitro-­produced (IVP) blas- 3 Department of Biology, University of tocysts by adding EPS ID1 to the vitrification media. Day 7-­expanded blastocysts Girona, Girona, Spain 4 were vitrified/warmed using the VitTrans device after the addition of 0 or 100 μg/ Instituto de Salud Carlos III, Madrid, Spain mL EPS ID1 to the vitrification media. Blastocysts vitrified by the Cryotop method 5 Department of Nutrition, Harvard T.H. and fresh non-­vitrified blastocysts served as controls. Outcomes were assessed in Boston, Massachusetts, USA 6 the warmed embryos in terms of survival rates and mRNA relative abundances of Brasuca In Vitro, Villahermosa, Mexico 7 Department of Animal Selection and BAX, BCL2, GPX1, and CDX2 genes. No differences in survival rates were observed Reproduction, SERIDA, Gijón, Spain at 3 h post-­warming between vitrification treatments. At 24 h post-­warming, the ad- 8 Department of Biology, Health and dition of EPS prior to vitrification with the VitTrans device produced similar survival Environment, University of Barcelona, Barcelona, Spain rates to Cryotop-­vitrified embryos and similar hatching rates to fresh non-­vitrified or Cryotop-­vitrified embryos. No differences emerged in BCL2 gene expression. Lower Correspondence Teresa Mogas, Department of Animal BAX (p < .05) and higher GPX1 (p < .05) and CDX2 (p < .1) gene expression were ob- Medicine and Surgery, Autonomous served in expanded and/or hatched blastocysts derived from VitTrans-­EPS-­vitrified University of Barcelona, Cerdanyola del Vallès, Spain. embryos when compared to those from the non-­supplemented group. In conclusion, Email: teresa.mogas@uab.cat addition of EPS not only promoted blastocyst survival and hatching after VitTrans vit- Funding information rification/warming but also modified the expression of genes associated with better Ministerio de Ciencia e Innovaci;n; embryo quality. Ministerio de Ciencia, Innovaci;n y Universidades; Ministry of Science, Innovation and Universities; Spanish KEYWORDS Ministry of Science and Innovation, Grant/ apoptosis, blastocyst, cell differentiation, cryopreservation, gene expression, oxidative stress, Award Number: PID2020-­116531RB-­I 00 survival rate 1 | I NTRO D U C TI O N approach for IVP embryos, which are more sensitive to cryoinjury than their in vivo counterparts (Rizos et al., 2001). Vitrification, Cryopreservation of in vitro-­produced (IVP) bovine embryos is a crit- however, requires a stereomicroscope during the stepwise warm- ical step to ensure the widespread reproduction and conservation ing procedure and trained personnel to examine embryos before of high-­value animals. Vitrification appears to be the most efficient transfer, limiting its application on a large scale. VitTrans is a device This is an open access article under the terms of the Creative Commons Attribution-­NonCommercial-­NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-­commercial and no modifications or adaptations are made. © 2022 The Authors. Reproduction in Domestic Animals published by Wiley-­VCH GmbH. Reprod Dom Anim. 2022;57(Suppl. 5):53–57.  wileyonlinelibrary.com/journal/rda | 53 | 14390531, 2022, S5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/rda.14191 by Spanish Cochrane National Provision (Ministerio de Sanidad), Wiley Online Library on [18/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 54 MARTÍNEZ-­RODERO et al. that allows field-­warming/dilution and embryo transfer directly to 2.3 | RNA extraction, reverse transcription, and female recipients. Vitrification of IVP day 7 bovine blastocysts using quantitative Real-­Time PCR analysis the VitTrans vitrification/warming device and short exposure to the CPA equilibration solution results in post-­warming outcomes com- Surviving vitrified/warmed blastocysts at 24 h post-­warming were parable to those of fresh non-­vitrified blastocysts (Martinez-­Rodero classified as expanded or hatching blastocysts, pooled up to 5 et al., 2021). blastocysts, snap-­frozen in liquid nitrogen, and kept at −80°C until Under hostile marine conditions, microorganisms produce sev- RNA isolation and RT-­qPCR analysis were performed. Total RNA eral secondary metabolites and exopolysaccharides (EPS) as a part was extracted using RNeasy Kit (Qiagen,) following the manufac- of their survival strategy. Exopolysaccharide ID1 (EPS ID1) is pro- turer’s instructions. RNA concentration and quality were deter- duced by Pseudomonas sp., a cold-­adapted bacterium isolated from mined using the Epoch spectrophotometer (BioTek,). The resulting marine sediments in Antarctica. Not only does EPS ID1 cryoprotec- RNA was reverse transcribed according to the high-­capacity cDNA tive activity benefit the cold-­adapted bacterial producer, but also Reverse Transcription Kit (Applied Biosystems,) instructions. The non-­producing cells (Carillo et al., 2015). Arcarons et al. (2019) found qPCR was performed using a 7500 Real Time PCR System (Applied that the addition of EPS ID1 to the vitrification/warming media con- Biosystems,), and a reaction mixture consisting of 10 μl of Fast SYBR fers significant cryoprotection to in vitro matured bovine oocytes, Green Master Mix (Thermo Fisher,), 1.2 μl of each primer (300 nM; by preserving spindle/chromosome dynamics and improving embry- Thermo Fisher; Table 1), and 2 μl of the cDNA template. The relative onic developmental competence. abundance of four target genes (BAX, BCL2, GPX1, and CDX2) was This study aimed to optimize vitrification and in-­straw warming measured by the Livak method (Livak & Schmittgen, 2001), using of bovine IVP embryos by adding EPS ID1 to the vitrification solu- the PPIA housekeeping gene as normalizer. Fold differences in rela- tions. Outcomes were assessed in the warmed embryos in terms of tive transcript abundance were calculated for target genes assuming survival rates, and relative abundances of mRNAs of genes with a an amplification efficiency of 100% and using the formula 2−(ΔΔCt). role in apoptosis, oxidative stress, and cell differentiation. Calculation of ΔΔCt involved the subtraction of the ΔCt value for the fresh embryo control group from all the other ΔCt sample values. The experiment was repeated independently five times. 2 | M ATE R I A L S A N D M E TH O DS 2.1 | In vitro embryo production 2.4 | Statistical analysis Procedures for in vitro maturation, in vitro fertilization, and in vitro The software IBM SPSS Version 25.0 (IBM Corp.,) was used to per- culture are thoroughly described elsewhere (Martinez-­ Rodero form all statistical tests. Normal distribution and homogeneity of et al., 2021). variances were checked with Shapiro–­Wilk and Levene tests, re- spectively. Survival and hatching rates were compared by ANOVA and Bonferroni tests. The relative abundance of genes was analysed 2.2 | Embryo vitrification and warming by Kruskal–­Wallis, and Mann–­Whitney tests. The level of statistical significance was set at p ≤ .05. Day 7-­expanded blastocysts were randomly allocated into three groups: (1) Cryotop, blastocysts were vitrified/warmed follow- ing the short equilibration protocol of the Cryotop method (Rizos 3 | R E S U LT S et al., 2001; Walton et al., 2017); (2) VitTrans, blastocysts were vitrified/warmed following the short equilibration VitTrans pro- Vitrification by the VitTrans method led to a significant reduction in tocol described in Martinez-­ Rodero et al. (Martinez-­ Rodero embryo survival rates recorded at 3 h post-­warming when compared et al., 2021) (Figure 1); (3) VitTrans-­EPS ID1, blastocysts were to fresh control blastocysts, regardless of the EPS ID1 treatment. At vitrified/warmed by the VitTans protocol but vitrification media 24 h post-­warming, addition of EPS ID1 to the media prior to VitTrans were supplemented with 100 μg/mL EPS ID1 as already described vitrification of bovine blastocysts produced equivalent embryo sur- in Ordóñez-­León et al. (2022). Non-­v itrified blastocysts served as vival than when blastocysts were vitrified by the Cryotop method. the fresh control. After warming, blastocysts were transferred to Hatching rates after VitTrans-­EPS ID1 vitrification were similar to SOF culture medium and incubated at 38.5°C in a 5% CO2 and 5% those for fresh control and Cryotop-­vitrified blastocysts (Table 2). O2 humidified atmosphere. Survival rates were expressed as rates The levels of BAX gene expression of apoptosis-­related genes of re-­expanded blastocysts at 3 h and 24 h post-­warming. Hatching BAX and were higher in expanded blastocysts derived from VitTrans rates were defined as the proportions of hatching/hatched blasto- embryos than in those derived from the Cryotop or VitTrans-­EPS ID1 cysts at 24 h post-­warming. Five independent experiments were group (Figure 2). Neither the level of expression of the apoptosis-­ conducted. related gene BCL2 nor the BAX/BCL2 ratio differed significantly | 14390531, 2022, S5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/rda.14191 by Spanish Cochrane National Provision (Ministerio de Sanidad), Wiley Online Library on [18/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License MARTÍNEZ-­RODERO et al. 55 F I G U R E 1 Graphical description of VitTrans vitrification/in-­straw warming method. The device comprises a carrier where the embryo is loaded, a hard plastic handle with an inner channel into which warming solution is introduced to dilute the cryoprotectant and transport the embryo to the straw for transfer, and a Luer syringe connector to connect the device to the warming solution source. The straw acts as a cover to protect the device from mechanical damage during storage. During warming, it serves as a 0.5 mL straw for sample dilution and direct embryo transfer TA B L E 1 Primers used for reverse Amplicon GenBank transcription-­quantitative polymerase Symbol Primer sequences (5′-­3′) size (bp) accession n° chain reaction BAX Fw: ACCAAGAAGCTGAGCGAGTG 116 NM_173894.1 Rv: CGGAAAAAGACCTCTCGGGG BCL2 Fw: GGCCCCTGTTTGATTTCTCCT 99 NM_001166486.1 Rv: ACTTATGGCCCAGATAGGCAC GPX1 Fw: CTGAAGTACGTCCGACCAGG 153 NM_174076.3 Rv: GTCGGTCATGAGAGCAGTGG CDX2 Fw: TGGACTCTGCTAGAACCCTCA 89 NM_001206299.1 Rv: TTTGTTTCTGCTCGGAGGGC PPIA Fw: CATACAGGTCCTGGCATCTTGTCC 108 NM_178320.2 Rv: CACGTGCTTGCCATCCAACC between vitrification groups and the control fresh group (Figure 2). 4 | DISCUSSION Surviving hatched blastocysts derived from the VitTrans-­EPS ID1 group, however, displayed significantly higher GPX1 expression than This study aimed to investigate how adding EPS ID1 to the vit- those derived from hatched blastocysts vitrified using the Cryotop rification media affects post-­ warming outcomes in bovine D7 or VitTrans methods. Although not significant, a trend (p = .06) to expanded blastocysts vitrified using the vitrification/in straw-­ upregulation of the CDX2 gene was identified in both expanded and warming VitTrans technique. Non-­EPS ID1 supplementation re- hatched blastocysts derived from the VitTrans-­EPS ID1 group when sulted in significantly lower survival and hatching rates, whereas compared to blastocysts vitrified using the Cryotop or VitTrans the addition of EPS ID1 prior to VitTrans vitrification produced method. similar survival rates than those observed in embryos vitrified/ | 14390531, 2022, S5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/rda.14191 by Spanish Cochrane National Provision (Ministerio de Sanidad), Wiley Online Library on [18/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 56 MARTÍNEZ-­RODERO et al. TA B L E 2 Effects of adding EPS ID1 Post-­warming to the VitTrans vitrification solutions on Survival (%) Survival (%) Hatching rate (%) post-­warming survival and hatching rates Treatment n (3 h) (24 h) (24 h) a a Fresh 52 100 100 32.40 ± 3.96a Cryotop 51 50.88 ± 6.80 b 79.95 ± 3.52b 30.66 ± 5.51a b c VitTrans 63 47.71 ± 5.26 67.45 ± 2.33 14.09 ± 2.60 b VitTrans-­EPS ID1 67 51.90 ± 5.18b 78.98 ± 0.43b 32.00 ± 4.79a a,b Values within columns with different superscripts differ significantly (p < .05); Data are shown as mean ± standard error of the mean (SEM). F I G U R E 2 Box plots showing relative post-­warming gene expression levels of (a) BAX, (b) BCL-­2, (c) BAX/BCL-­2 ratio, (d) GPX1, (e) CDX2 in bovine expanded and hatched blastocysts derived from blastocysts vitrified/warmed using Cryotop, VitTrans or VitTrans-­EPS ID1 protocols. The solid line indicates the mean, and floating bars represent minimum to maximum values. a,bBars labelled with diferent letters indicate a significant difference between treatments within blastocyst stage (p < .05). *,#Bars labelled with different symbols indicate a trend towards a significant difference between treatments within blastocyst stages (p < .1 and >.05). BAX, BCL-­2 associated X apoptosis regulator; BCL-­2, BCL-­2 apoptosis regulator; GPX1, glutathione peroxidase 1; CDX2, caudal type homeobox 2 warmed by the Cryotop methodology and similar hatching rates specific composition and antifreeze properties of EPS ID1 have than those of fresh non-­v itrified embryos. When compared to pre- been described (Carrión et al., 2015), it is difficult to understand vious studies where the VitTrans method was used to vitrify IVP how this EPS ID1 provides cryoprotection to cells due to a lack bovine embryos, the addition of EPS ID1 to the vitrification media of knowledge about its exact primary and secondary structure. resulted in greater post-­warming outcomes (González et al., 2019; Because EPS ID1 is characterized by amino acids decoration, and Morató & Mogas, 2014). It has already been established that add- amino acids have been shown to be important for ice interac- ing EPS ID1 to the vitrification media of in vitro matured bovine tions in EPSs (Carillo et al. 2015), we could hypothesize that EPS oocytes has positive benefits (Arcarons et al., 2019). Although the ID1 confers cryoprotection by limiting ice recrystallization. To | 14390531, 2022, S5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/rda.14191 by Spanish Cochrane National Provision (Ministerio de Sanidad), Wiley Online Library on [18/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License MARTÍNEZ-­RODERO et al. 57 corroborate this hypothesis, more information about the molecu- R., Marino, G., Parrilli, M., Randazzo, A., Tutino, M. L., & Corsaro, lar primary and secondary structure of EPS ID1 is required. M. M. (2015). A unique capsular polysaccharide structure from the psychrophilic marine bacterium Colwellia psychrerythraea 34H Increased BAX expression in expanded blastocysts derived from that mimics antifreeze (Glyco)proteins. Journal of the American embryos vitrified without EPS may be related to poor quality or frag- Chemical Society, 137, 179–­189. https://doi.org/10.1021/ja507​5954 mented embryos (Yang & Rajamahendran, 2002). Addition of EPS, on Carrión, O., Delgado, L., & Mercadé, E. (2015). New emulsifying and the other hand, restored BAX levels to those of the Cryotop group. cryoprotective exopolysaccharide from Antarctic Pseudomonas sp. ID1. Carbohydr. Polym., 117, 1028–­1034. https://doi.org/10.1016/J. Higher GPX1 expression in hatching/hatched embryos derived from CARBP​OL.2014.08.060 the VitTrans-­EPS ID1 is linked to better embryo quality (Cebrian-­ Cebrian-­Serrano, A., Salvador, I., Garcia-­Rosello, E., Pericuesta, E., Perez-­ Serrano et al., 2013), whereas a tendency of a higher CDX2 expression Cerezales, S., Gutierrez-­Adan, A., Coy, P., & Silvestre, M. A. (2013). in embryos from the VitTrans-­EPS ID1 group is associated with im- Effect of the bovine oviductal fluid on in vitro fertilization, devel- opment and gene expression of in vitro-­produced bovine blasto- proved pregnancy rates after embryo transfer (El-­Sayed et al., 2006). cysts. Reproduction in Domestic Animals, 48, 331–­338. https://doi. In conclusion, the addition of exopolysaccharide ID1 to the vitri- org/10.1111/j.1439-­0531.2012.02157.x fication media improves the cryotolerance of IVP bovine blastocysts El-­Sayed, A., Hoelker, M., Rings, F., Salilew, D., Jennen, D., Tholen, E., to VitTrans vitrification by increasing embryo post-­warming survival Marc-­André, S., Schellander, K., & Tesfaye, D. (2006). Large-­scale transcriptional analysis of bovine embryo biopsies in relation to preg- and hatchability. Furthermore, EPS ID1 addition may improve post-­ nancy success after transfer to recipients. Physiological Genomics, 28, warming quality of blastocysts by preserving BAX and upregulating 84–­96. https://doi.org/10.1152/physi​olgen​omics.00111.2006 GPX1 and CDX2 gene expression, keeping the embryo´s potential for González, N., Scherzer, J., Reichenbach, M., Otzdorff, C., & Zerbe, H. J. R. implantation after one-­step warming and direct transfer. (2019). Survival rates of vitrified biopsied bovine in vitro-­produced blastocysts using the VitTrans device. Fertility, & Development, 31, 138–­138. https://doi.org/10.1071/RDv31​n1Ab24 AU T H O R C O N T R I B U T I O N S Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene ex- I.M.-­R . and T.M. conceived and designed the experiments; I.M.-­R ., pression data using real-­time quantitative PCR and the 2−(ΔΔCT). A.S.-­H. and A.O.-­L . performed the experiments; C.O.-­H., M.Y. E.M. Methods, 25, 402–­4 08. https://doi.org/10.1006/meth.2001.1262 and T.M. provided the resources, I.M.-­R ., A.S.-­H. and M.Y. analysed Martinez-­Rodero, I., Garcia-­Martinez, T., Ordonez-­Leon, E. A., Vendrell-­ Flotats, M., Olegario Hidalgo, C., Esmoris, J., Mendebil, X., Azcarate, the data; I.M.-­R . and T.M. wrote the manuscript. S., López-­Bejar, M., Yeste, M., & Mogas, T. (2021). A shorter equili- bration period improves post-­warming outcomes after vitrification AC K N OW L E D G E M E N T S and in straw dilution of in vitro-­produced bovine embryos. Biology, This study was supported by the Spanish Ministry of Science and 10(2), 142. https://doi.org/10.3390/biolo​g y100​20142 Morató, R., & Mogas, T. (2014). New device for the vitrification and in-­ Innovation (Project Project PID2020-­116531RB-­I00). Ms Martínez-­ straw warming of in vitro produced bovine embryos. Cryobiology, Rodero was awarded a scholarship from the Spanish Ministry of 68, 288–­293. https://doi.org/10.1016/j.cryob​iol.2014.02.010 Science, Innovation and Universities (BES-­2017-­0 81962). Ordóñez-­León, E. A., Martínez-­Rodero, I., García-­Martínez, T., López-­Béjar, M., Yeste, M., Mercade, E., & Mogas, T. (2022). Exopolysaccharide ID1 improves post-­ warming outcomes after C O N FL I C T O F I N T E R E S T vitrification of in vitro-­produced bovine embryos. Int. J. Mol. Sci., None of the authors have any conflict of interest to declare. 2022(23), 7069 https://doi.org/10.3390/ijms2​3137069 Rizos, D., Ward, F., Boland, M., & Lonergan, P. (2001). Effect of culture DATA AVA I L A B I L I T Y system on the yield and quality of bovine blastocysts as assessed by survival after vitrification. Theriogenology, 56, 1–­16. https://doi. The data that support the findings of this study are available from org/10.1016/s0093​-­691x(01)00538​-­6 the corresponding author upon reasonable request. Walton, S., Catt, S., & Taylor-­Robinson, A. W. (2017). A comparative analysis of the efficacy of three cryopreservation protocols on the ORCID survival of in vitro-­derived cattle embryos at pronuclear and blas- tocyst stages. Cryobiology, 77, 58–­63. https://doi.org/10.1016/j. Iris Martínez-­Rodero https://orcid.org/0000-0001-7057-2045 cryob​iol.2017.05.007 Albert Salas-­Huetos https://orcid.org/0000-0001-5914-6862 Yang, M. Y., & Rajamahendran, R. (2002). Expression of Bcl-­2 and Bax Carlos Olegario Hidalgo https://orcid.org/0000-0002-9810-1517 proteins in relation to quality of bovine oocytes and embryos Marc Yeste https://orcid.org/0000-0002-2209-340X produced in vitro. Anim. Reprod. Sci., 70, 159–­169. https://doi. Elena Mercadé https://orcid.org/0000-0001-7828-2210 org/10.1016/S0378​-­4320(01)00186​-­5 Teresa Mogas https://orcid.org/0000-0002-6733-1328 How to cite this article: Martínez-­Rodero, I., Salas-­Huetos, A., REFERENCES Ordóñez-­León, A., Hidalgo, C. O., Yeste, M., Mercadé, E., & Arcarons, N., Vendrell-­Flotats, M., Yeste, M., Mercade, E., Lopez-­Bejar, Mogas, T. (2022). Cryoprotectant role of exopolysaccharide M., & Mogas, T. (2019). Cryoprotectant role of exopolysaccharide of Pseudomonas sp. ID1 in the vitrification of IVM cow oocytes. ID1 in the vitrification/in-­straw warming of in vitro-­produced Reprod Fertil Dev, 31(9), 1507–­1519. https://doi.org/10.1071/ bovine embryos. Reproduction in Domestic Animals, RD18447 57(Suppl. 5), 53–57. https://doi.org/10.1111/rda.14191 Carillo, S., Casillo, A., Pieretti, G., Parrilli, E., Sannino, F., Bayer-­Giraldi, M., Cosconati, S., Novellino, E., Ewert, M., Deming, J. W., Lanzetta,