SCIENCE ADVANCES | RESEARCH ARTICLE CANCER Copyright © 2022 The Authors, some A somatic mutation in moesin drives progression into rights reserved; exclusive licensee acute myeloid leukemia American Association for the Advancement of Science. No claim to Ouyang Yuan1*, Amol Ugale1,2, Tommaso de Marchi3, Vimala Anthonydhason4, original U.S. Government Anna Konturek-Ciesla1, Haixia Wan1, Mohamed Eldeeb1, Caroline Drabe1, Maria Jassinskaja1,5, Works. Distributed Jenny Hansson1, Isabel Hidalgo1, Talia Velasco-Hernandez6, Jörg Cammenga1, under a Creative Jeffrey A. Magee7,8, Emma Niméus3,9, David Bryder1* Commons Attribution License 4.0 (CC BY). Acute myeloid leukemia (AML) arises when leukemia-initiating cells, defined by a primary genetic lesion, acquire subsequent molecular changes whose cumulative effects bypass tumor suppression. The changes that underlie AML pathogenesis not only provide insights into the biology of transformation but also reveal novel therapeutic opportunities. However, backtracking these events in transformed human AML samples is challenging, if at all possible. Here, we approached this question using a murine in vivo model with an MLL-ENL fusion protein as a primary molecular event. Upon clonal transformation, we identified and extensively verified a recurrent codon-­ changing mutation (Arg295Cys) in the ERM protein moesin that markedly accelerated leukemogenesis. Human Downloaded from https://www.science.org at Universitat Autnoma de Barcelona on January 19, 2023 cancer-associated moesin mutations at the conserved arginine-295 residue similarly enhanced MLL-ENL–driven leukemogenesis. Mechanistically, the mutation interrupted the stability of moesin and conferred a neomorphic activity to the protein, which converged on enhanced extracellular signal–regulated kinase activity. Thereby, our studies demonstrate a critical role of ERM proteins in AML, with implications also for human cancer. INTRODUCTION activate signals that drive proliferation, without excluding that the Acute myeloid leukemia (AML) arises from genetic and/or epigenetic secondary mutations can also contribute to enhanced survival and/or events in immature hematopoietic cells that lead to the formation of further inhibit differentiation. However, in pediatric MLLr acute leukemia-initiating cells (LICs) (1). LICs gain a competitive advan- lymphoblastic leukemia (ALL), the frequency of secondary mutations tage over normal hematopoietic progenitors and progress into AML is lower and these mutations are often subclonal and frequently lost upon additional genetic perturbations that further promote prolif- upon relapse (7). This has challenged the generality of the two-step eration and/or inhibit differentiation (1–3). The identity of secondary model of MLLr leukemia by suggesting that these fusion products mutations can thereby shed light on the biology of leukemic trans- can drive leukemia by itself in a target cell-dependent manner and/or formation and provide molecular candidates for therapeutic targeting. that genetic predisposition can replace for somatically acquired Balanced chromosomal translocations that involve the mixed secondary mutations. lineage leukemia–1 (MLL1/KMT2A) gene can form chimeric fusion The powerful oncogenic activity of MLL fusion proteins has been proteins with novel gene regulatory properties. These MLL re- frequently exploited in mouse models to explore the pathogenesis arrangements (MLLr) represent recurrent initiating events in AML of leukemic initiation, evolution, therapy resistance, and relapse. In and comprise 35 to 50% of AML cases in infants (4). In older children most of such work, MLL fusions have been introduced by viral and adults, MLLr can be found in ∼3% of de novo AML cases (5). In delivery to immature murine hematopoietic cells, followed by their general, MLLr AML associate with a poor prognosis (6) and a sub- transplantation into recipient mice (8). Using these approaches, a stantial fraction of these leukemias harbor somatic mutations believed few recent attempts have been made to map secondary mutations in to drive transformation, with activating mutations in RAS, FLT3, MLL-AF9–driven AML (9, 10). Consistent with data from human PTPN11, and BRAF being the most common (5). This has lent sup- patients, there have been reports on secondary genetic/activating port to a two-step model of leukemogenesis in which the initial MLLr lesions in KRAS, BRAF, CBL, PTPN11, and GNB2 upon transformation. act to mainly inhibit differentiation and the secondary mutations In support of the relevance of these mutations for AML development, their coexpression with different MLL fusions can accelerate leuke- 1 mogenesis and produce more aggressive and rapid AML (9, 11, 12). Division of Molecular Hematology, Department of Laboratory Medicine, Lund Stem Cell Center, Faculty of Medical, Lund University, 221 84 Lund, Sweden. However, substantial differences exist between mutation patterns in 2 Department of Microbiology, Immunobiology and Genetics, Center for Molecular human leukemic samples and the few murine studies executed to Biology of the University of Vienna, Max F. Perutz Laboratories, Vienna Biocenter date. Most notably, these differences relate to the exact types of (VBC), 1030 Vienna, Austria. 3Division of Surgery, Oncology, and Pathology, Depart- ment of Clinical Sciences, Lund University, Solvegatan 19, 223 62, Lund, Sweden. secondary mutations identified and their observed frequencies, with 4 Sahlgrenska Center for Cancer Research, University of Gothenburg, Medicinaregatan extensive subclonality observed in murine studies. While this ob- 1F, 413 90, Gothenburg, Sweden. 5York Biomedical Research Institute, Department of viously could be a real observation, the possibility remains that the Biology, University of York, Wentworth Way, York YO10 5DD, UK. 6Josep Carreras Leukaemia Research Institute, 08036 Barcelona, Spain. 7Department of Pediatrics, modeling of leukemia initiation in murine models does not accurately Division of Hematology and Oncology, Washington University School of Medicine, reflect the monoclonality of human AML. St. Louis, MO 63110, USA. 8Department of Genetics, Washington University School As an alternative to viral delivery, we previously generated an of Medicine, St. Louis, MO 63110, USA. 9Department of Surgery, Skåne University inducible transgenic mouse strain in which a human MLL-ENL Hospital, Entrégatan 7, 222 42 Lund, Sweden. *Corresponding author. Email: ouyang.yuan@med.lu.se (O.Y.); david.bryder@med. fusion gene can be induced by doxycycline (iMLL-ENL mice) (13). lu.se (D.B.) The rationale for this approach was to circumvent several of the Yuan et al., Sci. Adv. 8, eabm9987 (2022) 20 April 2022 1 of 15 SCIENCE ADVANCES | RESEARCH ARTICLE experimental caveats associated with viral delivery of MLL fusions, their isolation with a lentiviral barcode library (19) and transplanted including poor delivery, unphysiological expression levels caused the cells as before into WT recipients under MLL-ENL induction by the strong promoters typically associated with viral vectors, and (Fig. 1B). Upon disease, we extracted genomic DNA (gDNA) from insertional mutagenesis. In addition, the iMLL-ENL model has donor-derived AML cells, which was followed by Sanger sequencing allowed us to firmly establish the precise identity of hematopoietic of the introduced barcodes. In four of the six analyzed leukemic samples, progenitor cells capable of initiating AML, without having to sub- we recovered a single dominant barcode (Fig. 1B). In the remaining ject candidate cells to any form of in vitro culture before assessment two cases, we observed a more crowded barcode sequence, indicating of their leukemic capacity (13, 14). either a polyclonal origin or possibly a leukemic clone that originally Here, we set out to dissect the stepwise AML progression in the was provided with more than one barcode (Fig. 1B). Together, these iMLL-ENL model. We demonstrate a three-phase progression of results demonstrated selection and evolution of predominant/driver evolving AML, in which preleukemic cells initially expand, which clones during the development of murine MLL-ENL–driven AML, was followed by a contraction and later transformation into AML in a similarity to that observed in human patients. a clonal-dependent manner. To clarify the molecular pathogenesis that drives the transformation process, we subjected multiple inde- iMLL-ENL AMLs associate with a highly recurrent point pendent AMLs to exome sequencing. This revealed a highly recur- mutation in the X-linked gene moesin that leads rent de novo mutation in the X-linked ezrin-radixin-moesin (ERM) to an arginine-295–to–cysteine substitution protein moesin that leads to cysteine change at the evolutionary Given the pattern of leukemic development in the AML model (Fig. 1), conserved arginine-295 residue. Detailed functional studies revealed we hypothesized that transformation into AML associate with the Downloaded from https://www.science.org at Universitat Autnoma de Barcelona on January 19, 2023 that R295C mutant MSN markedly accelerated leukemogenic trans- acquisition of secondary driver mutations. We therefore next set out formation, with human cancer-associated mutations at the same to identify these mutations. residue having similar effects on the transformation process. Thereby, We previously showed that AML can originate from several dif- our work provides new insights into the molecular pathogenesis of ferent types of hematopoietic progenitor cells in the iMLL-ENL model, disease progression in MLLr AML. including common lymphoid progenitors (CLPs; Lin −IL7Ra +​ Flt3+Sca1lowc-kitlow), granulocyte-macrophage-lymphoid progenitors (GMLPs; Lin−Sca1+ckit+CD48+CD150−: these cells are mostly positive RESULTS for CD34 and Flt3), and pGMs (13). Building on this and to explore A triphasic and monoclonal disease pattern underlie whether any distinct secondary mutation patterns might associate transformation into MLL-ENL–driven AML with different cell types of origin (for instance, related to inherent To explore mechanisms underlying development into AML, we used differences in proliferation or lineage potential), we designed a first a transplantation-based mouse model in which a human MLL-ENL experiment where we assessed secondary somatic driver mutations fusion gene can be conditionally induced in defined murine LICs by in AML samples derived from different LIC types. We isolated administration of doxycycline (13). We previously showed that CLPs, GMLPs, and pGMs from iMLL-ENL mice and transplanted myeloid-oriented pre-granulocyte/macrophage progenitors (pGMs; the cells to new recipients in conjunction with induction of MLL- Lin−Sca1−kit+CD41−CD150−CD105−) are potent LICs in the iMLL-­ ENL. Upon transformation, we isolated gDNA from leukemic cells ENL model (13). Building on these previous observations, we isolated and subjected samples to exome sequencing (the general strategy pGMs from iMLL-ENL mice and transplanted the cells into wild-­ for detection of secondary mutations is outlined in Fig. 2A). Fol- type (WT) recipients under continuous doxycycline/MLL-ENL lowing filtering (see methods for details), we could extract 40 candi- induction. The use of different congenic CD45 markers allowed date somatic variants in this first experiment, out of which nine for monitoring of transplanted cells and host/competitor cells in mutations were recurrent (Fig. 2B and table S1). From subsequent peripheral blood (PB) over time. sequencing experiments (below), three of these mutations (in Flrt1, We observed a pattern of leukemic development in which MLL- Polr3e, and Mcts2) could be classified as germline rather than somatic. ENL–induced pGM cells initially (4 weeks after transplantation) Out of the other six recurrent mutations, only a C883T mutation in yielded a high level of myeloid contribution in transplanted hosts moesin was confirmed as somatically acquired at high variant allele (Fig. 1A). WT pGMs provide only marginal, if any, myeloid recon- frequency (VAF) (>0.3) and across multiple samples. This mutation stitution at this point (15). After this, we observed declines in leads to an amino acid change of arginine-295 to cysteine (R295C). myeloid contribution, which was consistent among individual To extend our first sequencing experiment, we focused on AML hosts but varied between mice as for magnitude (Fig. 1A). Later, we derived from pGM cells. This is because of the similarity in muta- observed rapid rebounds in iMLL-ENL–derived myeloid cells that tion spectra across initiating cell types in our first experiment (Fig 2B continued to elevate (Fig. 1A) and coincided with AML diagnosis and fig. S1) and because pGM are more easily accessible/frequent according to the Bethesda classification for murine myeloid malig- than GMLPs and CLPs. In subsequent experiments, we also re- nancies (16). Compared to retroviral MLL-fusion models, the ini- designed our approach slightly such that AML was initiated from tial (pre)leukemogenic pattern from iMLL-ENL cells was different, individual mice for which we, at initiation of experimentation, also in that (pre)leukemogenic cells with retrovirally delivered MLLr generated appropriately matched/paired control samples. This was appear to continuously elevate following their initial detection (17). done to identify somatic mutations acquired upon AML transformation In most murine AML models, including the iMLL-ENL model, more easily. Thus, we conducted three additional sequencing exper- AML is initiated from a pool of candidate LICs (18). However, human iments in which three separate founder mice were used to generate 13 AML typically have a monoclonal origin (1). This led us to next in- additional leukemic samples (3 AML samples from founder 2, 6 AML vestigate the clonal composition of AMLs developing from iMLL-ENL samples from founder 3, and 4 AML samples from founder 4). The LICs. For this, we transduced iMLL-ENL LICs immediately after only recurrently mutated genes across these three cohorts were Msn Yuan et al., Sci. Adv. 8, eabm9987 (2022) 20 April 2022 2 of 15 SCIENCE ADVANCES | RESEARCH ARTICLE A B Genetically barcode iMLL-ENL cells iMLL-ENL myeloid cells (%) 100 BC_1 BC_2 BC_3 50 BC_4 BC_5 0 - Monitor disease 4 8 12 16 20 BC_6 - Harvest leukemic cells Time (weeks) upon transformation - Determine barcodes 20-nt barcode Fig. 1. Disease characteristics of the iMLL-ENL model. (A) pGMs were isolated from iMLL-ENL mice and transplanted competitively into lethally irradiated recipients (n = 10). Colored symbols and connecting lines show levels of donor-derived myeloid in individual recipients over time. (B) Left: Strategy used to evaluate the clonal composition of iMLL-ENL transformed AML using lentiviral barcoding. Right: Sanger sequencing of DNA barcodes after transformation, demonstrating clonality in a ma- Downloaded from https://www.science.org at Universitat Autnoma de Barcelona on January 19, 2023 jority of individual AMLs. (9 of 13 samples) and Ptpn11 (2 of 13, G60V and E76K) (Fig. 2C). select for such cells. This hypothesis was further entertained by the Taking all four cohorts (22 sequenced AML samples) into account, detection of a low VAF of the mutation in one of the founder mice the R295C Msn mutation was by far the most frequently secondary (Fig. 2C and table S1). To explore this possibility, we performed mutation (detected in 14 samples). Other recurrently mutated ultradeep targeted sequencing of hematopoietic progenitors isolated genes were Ptpn11 (3), Cdh11 (3), Cdk4 (2), Fbxo22 (2), Sh2d1b1 from both WT C57BL/6 and uninduced iMLL-ENL mice (three in- (2), and Exo1 (2) (fig. S1). Ptpn11 and Cdk4 mutations have been dividual mice per genotype). As controls for the detection sensitivity, shown previously to activate RAS signaling and cell cycle regulation, we used synthesized oligonucleotide templates of either WT, 0.1%, respectively, in human AML (11, 20). Single-­mutant cases were ob- or 1% spike-in C833T/R295C mutant Msn sequences. With an average served for several genes (fig. S1 and table S1), including for instance sequencing depth of approximately 40,000 reads per sample (table in Hras and Braf, that have also previously been reported to be mu- S2), we could recover 0.12 and 0.88% mutant sequences in the 0.1 tated in AML (6, 10, 11, 20–31). Last, to determine whether the and 1% spike-in controls, respectively. However, the frequency of C883T/R295C was dependent on the transplantation setting, we inter- C833T substitution in WT C57BL/6 or uninduced iMLL-ENL sam- rogated 10 separate iMLL-ENL AML samples derived from an alterna- ples was not higher than the negative (WT) controls (Fig. 2G). tive, non–transplantation-based model system (32). We observed a Collectively, while our attempts to identify relevant driver muta- high frequency (7 of 10) of the C883T/R295C Msn mutation also in tions revealed that MLL-ENL–driven murine AMLs associate with these samples (Fig. 2D). few dominant and recurrent secondary mutations (table S1), which We previously observed that pGM cells give rise to a small fraction seem to be in agreement with the situation also in human MLL of lymphoid cells upon transplantation (15). To further confirm the fusion–driven leukemia (7, 31, 33), one notable exception was a specificity of the C883T/R295C Msn mutation to AML, we isolated C833T mutation in the Msn gene that leads to an R295C substitu- donor-derived T and B cells at the same time as AML cells and subjected tion. This mutation was found in 21 of 32 (65.6%) of the AML samples gDNA from these cell subsets to Sanger sequencing. This revealed evaluated by exome sequencing and mostly at high VAF, without the presence of the mutation only in the fraction of AML cells (Fig. 2E). any apparent restriction as for cell of origin or to the transplanta- The Msn gene is located on the X chromosome. Given the very tion setting. This X-linked mutation was further found to associate high VAF of the C883T/R295C mutation in male AML cells with the active X chromosome and to form in response to MLL- (Fig. 2, B to D), the observed mutation presented as hemizygously ENL expression, rather than existing as a preexisting somatic muta- dominant in male leukemic cells. To extend our interrogations to tion subsequently selected for by coexpression of MLL-ENL. female cells, we applied Sanger sequencing for both gDNA and cDNA from female leukemic samples (the AML samples of experiment C295 mutant MSN leads to a marked acceleration of pGM_2 in Fig. 2C). Both WT Msn and the mutant C833T/R295C AML progression allele could be retrieved in gDNA from samples in which the muta- Given the high recurrence of the C295 MSN mutation (Fig. 2), we tion had been detected by Illumina sequencing (Fig. 2F). By con- wanted to determine whether this mutation had any functional trast, only the mutant Msn allele could be detected upon analysis of consequences on AML progression and/or propagation. For this, we cDNA (Fig. 2F). This demonstrated that the mutant allele localizes transplanted iMLL-ENL LICs transduced with either WT or C295 to the active X chromosome in female cells. mutant MSN into lethally irradiated congenic recipients and assessed Given the high recurrence of the C833T/R295C Msn mutation, leukemic progression (Fig. 3A). We observed that mice transplanted we hypothesized that this mutation perhaps could be somatically with C295 mutant MSN developed AML with a notably shortened acquired in a small fraction of hematopoietic cells as part of normal latency (median latency, 28 days) compared to LICs with WT MSN mouse biology and that the onset of MLL-ENL expression might (median latency, 90 days; Fig. 3B). Yuan et al., Sci. Adv. 8, eabm9987 (2022) 20 April 2022 3 of 15 SCIENCE ADVANCES | RESEARCH ARTICLE A B Save reference genome samples CLP GMLP pGM_1 iMLL-ENL mice Gene AA change (for pGM_2–4) 1 2 3 1 2 3 1 2 3 Flrt1 R186W Polr3e R460W Isolate Msn R295C defined HPCs Cdh11 Multiple #1 Cdk4 A23T - Transplant Exo1 G79R - Induce MLL-ENL Fbox22 G252V - Monitor disease Sh2d1b1 G23S Mcts2 P119L - Harvest leukemic cells - Exome sequencing VAF ≥ 0.3 VAF = 0.1–0.3 C D AA pGM_2 pGM_3 pGM_4* Downloaded from https://www.science.org at Universitat Autnoma de Barcelona on January 19, 2023 9998 9755 Gene 456 465 467 486 468 464 515 change 611 4 5 6 7 8 9 10 11 12 13 14 15 16 Msn R295C Ptpn11 Multiple #2 E F G pGM_2 Sample Frequency Myeloid cells Negative control 0.02% (leukemic) gDNA C G G C G C A 5 C G G T G C 0.1% spike-in 0.12% 1% spike-in 0.88% cDNA C G G C G C A WT C57BL/6 #1 0.02% T cells C G G C G C WT C57BL/6 #2 0.02% pGM_2 WT C57BL/6 #3 0.01% gDNA C G G C/T G C A 4 iMLL-ENL #1 0.01% B cells iMLL-ENL #2 0.01% C G G C G C cDNA C G G T G C A iMLL-ENL #3 0.02% R294 R295C Fig. 2. iMLL-ENL cells associate with a recurrent codon-changing point mutation in moesin upon AML transformation. (A) Experimental strategy to identify secondary mutations that associate with transformation into MLL-ENL–driven AML. (B) Predicted deleterious mutations identified in AML samples originating from dif- ferent LIC subsets. (#1) Three different missense variants were detected in Cdh11: p.G86V, p.I100F, and p.V147D. AA, amino acid. (C) The presence of the MSN R295C mutation in AML samples derived from pGM cells from three separate founders. (#2) Two different missense variants were detected in Ptpn11: p.G60V and p.E76K. *The founder mouse in pGM_4 was found to harbor a low AF of the MSN R295C mutation. (D) The presence of the MSN R295C mutation in AML samples derived from a non– transplantation-based model system. In (B) to (D), each column represents an individual leukemic sample, with dark gray boxes indicating a gain of mutation with an allele frequency (AF) > 0.3 and light gray boxes indicating a gain of mutation with an AF of 0.1 to 0.3. (E) Sanger sequencing chromatograms depicting the Msn missense C>T mutation (leading to the R295C substitution) in leukemic cells and in B and T cells from the same sample. (F) Sanger sequencing of Msn from gDNA and cDNA from two female leukemic samples derived from the same founder mouse, demonstrating that, in Msn mutant cells (experiment pGM_2, mouse 4), Msn expression is derived from the active X chromosome in female cells. The same results were obtained from AML sample mouse 6 in experiment pGM_2, which also presented with the Msn mutation. (G) Ultradeep targeted sequencing results of the Msn C883T substitution in WT C57BL/6 and uninduced iMLL-ENL cells. To further characterize the influence of the C295 mutant MSN MSN LICs and increased gradually after transplantation (Fig. 3D upon AML progression, we analyzed PB, bone marrow (BM), and and fig. S2A). Fluorescence-activated cell sorting (FACS) analysis spleen at 14, 21, and 28 days after transplantation of iMLL-ENL for the differentiation-associated markers CD36 and Gr1 revealed LICs ± C295 mutant MSN (Fig. 3, C to E). We observed that C295 lower expression on C295 MSN mutant AML cells (fig. S2B). Quan- mutant MSN increased the engraftment in a time-dependent manner titative reverse transcription polymerase chain reaction (qRT-PCR) in PB (Fig. 3C). This co-occurred with marked increases in spleen demonstrated that iMLL-ENL cells with WT MSN exhibited re- sizes (Fig. 3D). Morphological analyses showed that the frequency duced expression of the MLL-fusion AML-associated genes Hoxa9 of leukemic blasts/undifferentiated cells derived from C295 mutant and Meis1 over time. By contrast, C295 mutant MSN sustained high MSN LICs was significantly higher than that observed from WT expression of these genes (fig. S2C). Yuan et al., Sci. Adv. 8, eabm9987 (2022) 20 April 2022 4 of 15 SCIENCE ADVANCES | RESEARCH ARTICLE A B 100 WT MSN iMLL-ENL Event-free survival (%) MSN C295 Evaluate leukemia development 50 P < 0.0001 Transduce with WT or 0 C295 MSN (Fig. 3, B to E) 0 50 100 150 Days after transplantation C D E Peripheral blood Bone marrow 10 6 P < 0.0001 100 P < 0.0001 P < 0.001 GFP+ cells/microliter 10 5 80 WT MSN P < 0.05 Blasts (%) 4 60 n.s. 10 Downloaded from https://www.science.org at Universitat Autnoma de Barcelona on January 19, 2023 MSN C295 40 n.s. 103 20 2 10 0 d14 d21 d28 WT MSN MSN C295 d14 d21 d28 F G Msn shNRA Scramble Leukemia with C295 MSN Leukemia with C295 MSN 100 100 kDa M Scramble Event-free survival (%) Event-free survival (%) MLL-ENL on 80 Msn shRNA MSN MLL-ENL off 65 50 50 ACTB P < 0.005 P < 0.0001 30 0 0 0 50 100 150 0 50 100 150 Days after transplantation Days after transplantation Fig. 3. AML progression is markedly accelerated by C295 mutant MSN and associates with diminished differentiation. (A) Outline of the experimental strategy used to explore the kinetics of MLL-ENL–driven AML development as a consequence of C295 mutant MSN. (B) Kaplan-Meier survival curves depicting event-free survival of recipients transplanted with iMLL-ENL LICs transduced with either WT (n = 25) or C295 mutant MSN (n = 20). (C) Count of green fluorescent protein–positive (GFP+) cells (transduced LICs) in PB of recipients at 14, 21, or 28 days after transplantation (n = 5 mice per group/time point). n.s., not significant. (D) Rapid development of spleno- megaly in recipients transplanted with C295 mutant MSN LICs. The image show spleens harvested from recipients 28 days after transplantation. (E) Blast cell frequency at 14, 21, and 28 days after transplantation of iMLL-ENL LICs with WT or C295 mutant MSN (n = 5 mice per group/time point). See also fig. S2. (F) AML with C295 mutant MSN continues to rely on MLL-ENL expression. Event-free survival of secondary recipients of iMLL-ENL and C295 mutant MSN expressing leukemic cells as a consequence of MLL-ENL expression (n = 5 mice per group). (G) Knockdown of C295 mutant MSN restricts the propagation of MLL-ENL–driven AML. Left: MSN expression was measured by Western blot following short hairpin RNA (shRNA)–mediated Msn knockdown. Right: Event-free survival in secondary recipients of MLL-ENL + C295 mutant MSN fol- lowing shRNA-mediated Msn knockdown (n = 10 per group). A scrambled shRNA was used as control. ACTB, beta-actin. Because of the high pathogenicity of C295 mutant MSN, we next delayed AML progression (Fig. 3G, right). Together, these data demon- tested whether MLL-ENL leukemic blasts with C295 mutant MSN strate that the C295 MSN mutation collaborate with MLL-ENL to remained dependent on MLL-ENL expression. For this, we trans- promote a rapid transformation into AML that is characterized by a planted C295 mutant MSN leukemic blasts to secondary hosts in pronounced inhibition of differentiation. the presence or absence of MLL-ENL expression. All mice with MLL-ENL induction presented with AML within 4 weeks, while mice C295 mutant MSN does not affect normal hematopoiesis without MLL-ENL induction showed no signs of disease develop- Having established a potent leukemia-promoting activity of the ment (Fig. 3F). C295 MSN variant (Fig. 3), we next explored the influence of the To determine the role of C295 mutant MSN for AML maintenance, mutant protein on normal hematopoiesis. For this, we transduced we applied a short hairpin RNA (shRNA) approach. After verifica- normal candidate hematopoietic stem cells (HSCs) with either WT tion of an effective shRNA that targets Msn (Fig. 3G, left), we intro- or C295 mutant MSN, which was followed by competitive trans- duced it to C295 MSN–bearing MLL-ENL AML cells and evaluated plantation. We observed a highly similar multilineage contribution AML propagation in secondary hosts. Reducing the expression of from WT or C295 MSN–transduced HSCs (Fig. 4A), without any C295 mutant MSN significantly impaired AML cell repopulation and apparent signs of disease development. This suggested that the Yuan et al., Sci. Adv. 8, eabm9987 (2022) 20 April 2022 5 of 15 SCIENCE ADVANCES | RESEARCH ARTICLE C295 MSN mutation is not pathogenic by itself but rather a cooper- between LICs carrying the scramble shRNA and the Msn shRNA ating event with MLL-ENL. (Fig. 4B). It is well established that phosphorylation of MSN threonine-558 MSN is dispensable for MLL-ENL AML and its effects are (T558) plays a crucial role for the activity of MSN (34). To investi- independent on T558 phosphorylation gate whether this phosphorylation might play a role in AML develop- In a next set of experiments, we investigated whether MSN function ment, we transplanted iMLL-ENL LICs with phosphoinactive (T558A) was essential for the initiation of MLL-ENL leukemogenesis. For this, or phosphomimetic (T558D) MSN variants (34) and assessed leu- we reduced normal Msn expression in iMLL-ENL LICs before their kemic progression. Somewhat unexpectedly, these two variants did transplantation. In this setting, disease latency was indistinguishable not differ as for disease latency (Fig. 4C). Next, we investigated the A Normal Lin−Sca+Kit+ cells B 25 100 n.s. n.s. 100 n.s. Event-free survival (%) 20 % of GFP+ cells % of GFP+ cells n.s. 15 50 n.s. 50 Downloaded from https://www.science.org at Universitat Autnoma de Barcelona on January 19, 2023 10 Msn shRNA 5 Scramble 0 0 0 B T My 0 50 100 150 WT MSN C295 MSN Days after transplantation C D 100 D558 100 Event-free survival (%) Event-free survival (%) A558 50 n.s. 50 P < 0.0001 C295 + A558 C295 + D558 0 0 0 50 100 150 0 20 40 60 80 100 Days after transplantation Days after transplantation E R R R 293 294 295 100 WT CGT CGG CGC: Murine WT Event-free survival (%) C295 P < 0.0001 CGT CGG TGC: C295 MSN C293 n.s. CGC CGT CGC: Human WT 50 TGC CGT CAC: C293 MSN (UCEC, GA, MA) C294 n.s. CGC TGT CAC: C294 MSN (LC) H295 P < 0.001 CGC CGT CAC: H295 MSN (UCEC) S295 P < 0.0001 0 CGC CGT AGC: S295 MSN (UCEC, LC) 0 50 100 150 Days after transplantation Fig. 4. Human cancer-associated MSN mutations accelerate AML progression. (A) The C295 mutant MSN does not affect normal HSC function or multilineage devel- opment. Left: Engraftment of normal candidate HSCs expressing WT or C295 mutant MSN (GFP+) in PB at 28 weeks after transplantation. Right: Hematopoietic lineage distribution from WT or C295 mutant MSN (n = 7 to 8 mice per group). (B) MSN is dispensable for disease progression from iMLL-ENL LICs. Kaplan-Meier survival curves depict event-free survival of recipients transplanted with iMLL-ENL LICs transduced with either a scramble shRNA or an shRNA against Msn (n = 10 mice per group). (C) Event-free survival of recipients transplanted with iMLL-ENL LICs transduced with either a phosphoinactive mutant construct (MSN T558A) or a phosphomimetic mutant (MSN T558D) (n = 10 mice per group). (D) Leukemic propagation of C295 mutant MSN AML is impaired by the phosphomimetic T558D mutation. Kaplan-Meier survival curves depict event-free survival of recipients transplanted with iMLL-ENL LICs expressing C295 MSN together with either phosphoinactive T558A (C295 + A558) or phos- phomimetic T558D (C295 + D558) variants (n = 10 mice per group). (E) R295 mutant MSN-variants identified in human cancers accelerate MLL-ENL–driven AML progres- sion. Left: MSN variants adjacent to the R295 residue from The Cancer Genome Atlas (TCGA) and Catalog of Somatic Mutations in Cancer databases. UCEC, uterine corpus endometrial carcinoma; GA, gastric adenocarcinoma; MA, melanoma; LC, large intestine carcinoma. Right: Kaplan-Meier survival curves depict event-free survival of re- cipients transplanted with iMLL-ENL LICs transduced with C293, C294, H295, or S295 MSN variants (n = 5 mice per group). iMLL-ENL LICs cells transduced with WT or C295 MSN (same as in Fig. 3B) are included for reference. Yuan et al., Sci. Adv. 8, eabm9987 (2022) 20 April 2022 6 of 15 SCIENCE ADVANCES | RESEARCH ARTICLE potential role of the phosphorylation status of T558 on C295 mutant decreased (approximately half) dimer formation and increased MSN. For this, we generated compound mutant variants of C295 (approximately threefold) monomer formation compared to WT MSN together with the phosphoinactive T558A (C295 + A558) or MSN (Fig. 5C). Together, these results suggested that the C295 mu- phosphomimetic T558D (C295 + D558) variants. Notably, mice re- tation in MSN leads to structural changes in the protein that impair ceiving LICs transduced with the phosphomimetic C295 + D558 the ability of MSN to form self-inactivating homodimers. MSN developed AML with a significantly longer latency (median, 68 days) compared to mice receiving cells transduced with the phos- Interactome analysis reveals minor alterations between WT phoinactive C295 + A558 MSN (median, 28 days; P < 0.0001; Fig. 4D). and C295 mutant MSN Together, modulation of the phosphorylation status of WT MSN To explore potential changes in interactomes between WT and C295 at T558 had little effect on the latency of MLL-ENL–driven trans- mutant MSN, we next used mass spectrometry (MS) to identify pro- formation. This was markedly different in the context of the C295 teins that bind to WT and C295 mutant MSN. WT and C295 mutant mutation, where mimicking T558 phosphorylation abrogated most FLAG-tagged MSN–transduced LICs were subjected to FLAG immuno- of its leukemia-propagating activity. precipitation followed by MS analysis, with empty vector–transduced LICs as a background control. By comparing the abundance of spe- Human cancer-associated MSN mutations at the R295 cific peptides between the background control and FLAG-tagged residue accelerates AML progression MSN samples, we identified 116 proteins enriched in the FLAG-tagged We next assessed MSN gene mutations in human cancer samples MSN samples (Fig. 5E and table S3). The identified interacting proteins derived from the TCGA (The Cancer Genome Atlas) and Catalog of included ezrin-radixin-moesin binding phosphoprotein-50 (EBP50), Downloaded from https://www.science.org at Universitat Autnoma de Barcelona on January 19, 2023 Somatic Mutations in Cancer databases. This revealed MSN gene CD44 Antigen (CD44), Radixin (RDX), and Nucleoporin 93 (NUP93), variants involving the R295 itself (H295 and S295) or in the RRRK- which have previously been found to bind to ERM proteins (40). More PDT motif (positions 293 to 299), a motif that has previously been generally, an interactome analysis revealed the interacting proteins suggested to be involved in human tumorigenesis (35). Specifically, to be enriched in biological pathways such as cytoskeleton cell move- cancers with such mutations included for endometrial carcinoma, ment, migration, and inflammation, which are all functionally relevant melanoma, gastric adenocarcinoma, and large intestinal carcinomas to previously attributed functions of MSN (Fig. 5D). However, no and these variants (Fig. 4E, left) were all predicted to be deleterious, obvious alterations were detected when comparing the proteins bound to damaging, or pathogenic by Sorting Intolerant From Tolerant (SIFT) WT or C295 mutant MSN (Fig. 5E). Together, these results strongly (36), PolyPhen (37), or Functional Analysis through Hidden Markov suggested that the disease-promoting activities of C295 mutant MSN is not Models (FATHMM) (38). To functionally test whether these muta- via a pronounced disruption of the ability to interact with other proteins. tions might also associate with alterations in AML progression, we transplanted iMLL-­ENL LICs retrovirally transduced with each of C295 mutant MSN activates ERK signaling in a these variants into lethally irradiated recipients and assessed leu- pMEK-independent manner kemia progression. This showed that S295 MSN expressing LICs Alterations in the mitogen-activated protein kinase (MAPK)/extra- succumbed to leukemia with kinetics very comparable to LICs with cellular signal–regulated kinase (ERK) pathway have frequently been the aggressive/murine C295 variant (median latency, 25 days for S295 implicated in leukemia (41), and the subclass of MLLr leukemia ap- and 28 days for C295). Mice transplanted with H295 mutant MSN also pears to have a particular propensity for activating mutations in this displayed a pronounced shortening of disease development (median pathway (33, 42). Therefore, to test whether C295 mutant MSN dys- survival, 74 days as compared to 90 days for WT MSN). The disease regulates the MAPK/ERK pathway, we lastly assessed the ERK activity progression from LICs with variants outside the R295 residue did in WT or C295 mutant MSN–transduced LICs by Western blotting. not differ significantly from WT MSN. Together, these experiments This revealed that C295 mutant MSN associated with a significant revealed that variants that lead to alterations of the R295 residue of increase of ERK phosphorylation compared to WT MSN [Fig. 6 (left MSN seem to be particularly pathogenic, with a potential involve- and right, summary of data)], which in vivo extended to a persistent ment of these MSN mutations as codrivers also in human cancer. up-regulation of the ERK targets Myc and Ccnd1 (Fig. 6, B and C). To test whether the observed up-regulation of ERK phosphoryl­ The R295C mutation modulates the structural dynamics ation associated with activation of MAPK kinase (MEK), we evalu- and dimerization of moesin ated the activity of MEK. Somewhat unexpectedly, no increase of The pathogenicity of the alterations at the R295 residue led us to next phosphorylated MEK (pMEK) was observed in C295 mutant MSN explore the structural effects of the C295 mutation. We first assessed compared to WT MSN–transduced LICs. By contrast, a constitutively the protein conformation of WT and C295 MSN using molecular active RAS mutation (HRAS Q61L) resulted in significant increase dynamics simulation (MDS). This revealed that the 5C site at the in pERK and pMEK (Fig. 6). Together, these results established that 4.1 protein, ezrin, radixin, moesin (FERM) C-terminal domain of leukemogenic activity of C295 mutant MSN, similar to the class of the WT protein was transformed to a random coil structure in C295 activating RAS mutations that are well established for MLLr AML, mutant MSN (Fig. 5A). This secondary structural element is highly converges on enhanced ERK activity. conserved in MSN from different species as well as among other ERM proteins and has been previously suggested to be functionally import- ant for MSN dimerization (39). DISCUSSION To try to functionally assess whether the C295 mutation affects One way to gain insights into the stepwise processes in which MSN dimerization, we evaluated the WT or C295 mutant MSN dimer/ normal cells become LICs is to build on the rich genetic informa- monomer status in vivo using nondenaturing gel electrophoresis tion available from studies on human AML and explore such genetic (Fig. 5B). This showed that C295 mutant MSN associated with a circuits using relevant animal models. In the work described here, Yuan et al., Sci. Adv. 8, eabm9987 (2022) 20 April 2022 7 of 15 SCIENCE ADVANCES | RESEARCH ARTICLE A B C C295 MSN WT MSN 1.5 Ratio (C295 to WT MSN) M FERM C-terminal 1 domain P < 0.001 WT Glu244 kDa MSN Ser243 0.5 250 Trp242 MSN, dimeric 150 (native) 0 Dimeric Phe250 Asn251 100 4 P < 0.0001 Ratio (C295 to WT MSN) C295 Glu244 MSN 75 3 Ser 243 MSN, monomeric Trp242 2 (native) 50 1 Phe250 100 Asn251 MSN 75 0 Downloaded from https://www.science.org at Universitat Autnoma de Barcelona on January 19, 2023 (denaturating) Monomeric D E 2.0 Imidazoles 1.5 −Log10(P value) Antigen 1.0 Cyclin-depedent Canine Cortical Neurite Cytoskeleton Cell movement Migration 0.5 Inflammatory Inflammation NUP93 RDX CD44 SLC9A3R1 Neurodegenerative Cos-cells 0.0 Cercopithecus-aethiops −2.0 −1.0 0.0 1.0 2.0 Scaled Log2Ratio Fig. 5. The R295C mutation alters the structural dynamics of MSN, while the MSN interactomes is preserved in C295 mutant MSN. (A) Simulation of molecular dynamics of WT and C295 mutant MSN. Secondary structural changes at the FERM C-terminal domain of mutant MSN are shown in blue. In the C295 mutant structure, the highlighted region (composed of the amino acids Trp242, Ser243, Glu244, Phe250, and Asn251) has transformed from a  sheet and  helix to a random coil structure. (B) Nondenaturing gel electrophoresis of WT and C295 mutant MSN. Western blot with an anti-FLAG antibody was performed using nondenaturing (top) and denaturing (bottom) gel electrophoresis. (C) Densitometry profile showing the mean ratios ± SD of monomeric and dimeric MSN in cells transduced with WT or C295 mutant MSN in three independent experiments. (D) Enriched biological terms associated with MSN interactomes. (E) Volcano plot representation of abundance of interacting proteins of C295 mutant versus WT MSN from five biological replicates. The significance threshold (P < 0.05) is indicated with a dashed line at the y axis and fold change indicated at the x axis. we explored an inducible model of MLL-ENL (13) with the aim of mutations (44). Activating Ras mutations also have a strong impact identifying secondary mechanisms that underlie transformation into in murine models of MLLr leukemia (9, 14), although the degree to overt AML. In the initial stages of our work, we established that clonality, which these mutations arise spontaneously in murine models is less a hallmark of human AML, is a key feature of AML also in the model known. Among the somatic mutations identified in our work that used. Next, we set out to identify potential secondary mutations that could be unequivocally linked to the RAS pathway were activating could explain the disease pattern of MLL-ENL–associated AML. mutations in Hras, Ptpn11, and Braf. These results further support Secondary somatic mutations have been reported in human AML the use of murine models to identify relevant biological pathways in several studies (31, 43), and the subclass of MLLr leukemia have that underlie disease progression in human cells. Other mutations, a particular propensity for activating mutations in the RAS pathway including such affecting phosphatidylinositol 3-kinase–AKT, Janus (33, 42). Furthermore, RAS-mutant clones are dominant at both kinase–signal transducers and activators of transcription, and re- AML progression and relapse (33, 42). The molecular cross-talk be- ceptor tyrosine kinase signaling pathways might also be relevant for tween the activation of RAS/RAF/MAPK cascade and aberrant ex- AML progression, especially in the Msn WT cases (fig. S1). pression of HOX genes induced by MLL fusions appears to have a A most prominent finding in our work was the identification key role in the cooperative leukemogenesis of MLL fusions and Ras and verification of a highly recurrent MSN R295C mutation upon Yuan et al., Sci. Adv. 8, eabm9987 (2022) 20 April 2022 8 of 15 SCIENCE ADVANCES | RESEARCH ARTICLE A 10 5 C295 MSN P < 0.0001 WT MSN P < 0.0001 RAS* 8 4 pMEK/total MEK pERK/total ERK pERK P < 0.01 6 3 Total ERK 4 2 n.s. pMEK 2 1 Total MEK ACTB 0 0 SN SN SN SN * * AS AS M M M M R R T T 5 5 W W 29 29 C C B Myc C Ccnd1 0.006 0.0004 P < 0.05 P < 0.01 P < 0.05 P < 0.01 WT MSN Downloaded from https://www.science.org at Universitat Autnoma de Barcelona on January 19, 2023 0.0003 P < 0.05 C295 MSN Relative expression P < 0.05 Relative expression 0.004 0.0002 0.002 0.0001 0.000 0.0000 D14 D21 D28 D14 D21 D28 Days after transplantation Days after transplantation Fig. 6. C295 mutant MSN increases ERK phosphorylation in a pMEK-independent manner. (A) C295 mutant MSN increases ERK phosphorylation but not MEK phos- phorylation. Left: Representative immunoblotting analysis showing the levels of pERK, pMEK, total ERK, and total MEK in WT (n = 5), C295 mutant MSN (n = 5), or HRAS L61 (n = 2) transduced LICs.  actin immunoblotting was used as loading control. Right: Summary of the ERK and MEK activity. Graphs show mean pERK/total ERK ± SD and mean pMEK/total MEK ± SD in two to five independent experiments. (B and C) mRNA expression of Myc and Ccnd1 in GFP+ MLL-ENL in LICs with WT or C295 mutant MSN at different time points after transplantation. Data show means ± SD from three biological replicates (individual mice) per time point. transformation. Surveying the literature, we observed that the MSN human AML (data from TCGA). Still, increasing evidence suggests R295C mutation was previously identified in one case of a clathrin that the dysregulation of cell signaling resulting from both altered assembly lymphoid myeloid (CALM)/AF10 mouse model (45) and, MSN expression and its subcellular localization play crucial roles more recently, as a recurrent somatic mutation in AML using a ret- during progression of oral squamous cell carcinoma, melanoma, and roviral model of MLL-AF9 (10). In the work by Kotani et al. (10), it breast cancer (48–51), and an MSN-anaplastic lymphoma kinase was proposed that the MSN R295C mutation is frequently “swept (ALK) fusion, resulting from a (X;2)(q11–12;p23) translocation, under- out” by other driver mutations in the process of clonal evolution of lies the pathogenesis of anaplastic large cell lymphoma (52). AML, perhaps suggesting the MSN R295C mutation to be more of A germline R171W mutation leads to loss of MSN expression a “passenger” than a “driver” mutation. This interpretation is not com- and associates with an X-linked immunodeficiency syndrome (53). patible with our results, which demonstrate that C295 mutant MSN Our results demonstrate that the R295C mutation is clearly different plays a crucial role in both leukemia initiation and maintenance. Rather, and relies on continuous MLL-ENL expression to propagate trans- we believe that the retroviral model system as used by Kotani et al. formed cells. While it is well established that phosphorylation on (10) might be characterized by a higher LIC polyclonality than the the highly conserved T558 is associated with activation of MSN model system used here. Thereby, clonal competition eventually selects (34), we were somewhat puzzled that the phosphorylation on T558 against MSN R295C mutant cells in favor of LICs carrying even more impaired the transforming ability of the C295 mutant MSN. How- aggressive secondary mutations. Regardless, to our knowledge, no ever, we note that a previous study observed that T558 phosphoryl­ functional information on the consequence of the MSN R295C muta- ation of MSN in human myeloid cells led to diminished activation tion on AML development has been provided previously. of the Rho guanosine triphosphatase CDC42 (54). This is likely of MSN, a member of ERM family that also include ezrin and relevance also to MLLr AML, which relies on CDC42 activity to radixin, is best known for its involvement in regulating cell polarity, promote LIC self-renewal (55). adhesion, and migration (46). In hematopoiesis, both MSN and MSN contains a FERM domain with cloverleaf conformation of ezrin are expressed, whereas radixin is mostly absent. MSN is the its F1, F2, and F3 subdomains (56). Notably, interactions mediated quantitatively dominant ERM protein in human blood cells and the by the R295 residue in F3 and E87 in the F1 domain has been only ERM family member expressed in platelets (47). However, neither proposed to maintain the FERM domain stability (56). Disruption expression levels nor mutations have to date been associated with of interactions between F3 and F1, on the other hand, leads to F3 Yuan et al., Sci. Adv. 8, eabm9987 (2022) 20 April 2022 9 of 15 SCIENCE ADVANCES | RESEARCH ARTICLE subdomain movements and destabilizes the FERM domain MATERIALS AND METHODS conformation (56). The F3 subdomain, which contains secondary Mice structures including strand 5C (residues 245 to 251) and 1C helix The generation and characterization of the iMLL-ENL model has (residues 274 to 297), is crucial for the function of MSN (39). The been described previously (13). MLL-ENL expression was induced interaction between strand 5C and the FERM C-terminal residues in vivo by administration of doxycycline in the food (2000 mg/kg; (residues 295 to 304) was suggested to maintain homodimerization, an Ssniff Spezialdiäten GmbH). Eight to 12-week-old female C57BL/6N mice important mechanism for the stabilization and inactivation of MSN were used as recipients (Taconic; RRID: MGI:6196877), and iMLL-ENL (39). Our protein simulation data provided support that the C295 mice were used at 8 to 14 weeks of age. Mice were maintained in the mutation perturbs the secondary structures and stability of FERM animal facilities at the Biomedical Center of Lund University, and domain in MSN. In addition, the R295C mutant MSN appears to all animal experiments were performed with the approval of a local exhibit a pronounced reduction in the amount of homodimers and ethics committee. increase in the amount of monomers, which further supported the notion of a disturbed FERM domain conformation in C295 mutant Evolution into AML from iMLL-ENL pGMs MSN. Notably and of relevance to MSN mutations found in human A total of 5000 pGMs were isolated from iMLL-ENL mice (CD45.1+) cancer, we observed that two mutations identified in human can- using cell sorting (FACSAria II or III cell sorters; Becton Dickinson) cer, S295 and H295, also associated with pathogenicity in the mu- and transplanted together with 300,000 unfractionated CD45.2+ BM rine MLL-ENL model. The correlation between the pathogenicity cells into lethally irradiated (900 rads) CD45.2+ mice. Recipients were and the positive charge on the substituted residue supported that the put on a doxycycline-containing diet 5 days before transplantation to Downloaded from https://www.science.org at Universitat Autnoma de Barcelona on January 19, 2023 mutation might function by perturbing the salt bridge interaction ensure expression of MLL-ENL immediately after transplantation. normally associated with R295. On the other hand, substitutions on residues R293 and R294 did not reveal any functional consequence Assessment of clonality of developing leukemias for transformation, perhaps proposing a specific role for the substi- A lentiviral guide RNA (gRNA) library containing 87,897 individual tuted R295 residue. gRNA sequences was repurposed here for cellular barcoding. The While our proteomic data failed to reveal any apparent changes genome-wide mouse lentiviral CRISPR gRNA library was a gift from in the protein interactome as a consequence of the R295C mutation, K. Yusa (Addgene, no. 50947) (19). For the lentivirus production, we were able to establish induction of ERK signaling and its targets 3 g of a lentiviral vector, 9 g of ViraPower Lentiviral Packaging Myc and Ccnd1 downstream of the mutation. This finding links Mix (Invitrogen), and 12 l of PLUS Reagent were added to 3 ml of previous observations, including mutations in Braf, Ras, and Opti-MEM and incubated for 5 min at room temperature. Thirty-six Ptpn11, as prominent secondary mutations in both human and microliters of the LTX reagent was then added to this mixture and murine MLLr AML models (9, 10) and reinforces the promising further incubated for 30 min at room temperature. The transfection prospect of ERK targeting in AML (57). While it seems that MSN complex was added to 80% confluent human embryonic kidney 293-FT mutant MLL-ENL–driven AML always associate to active ERK, (American Type Culture Collection, PTA-5077; RRID: CVCL_6911) we have observed instances of MLL-ENL AMLs with WT MSN in cells in a 10-cm dish and incubated for 3 hours. The medium was which ERK activation is less pronounced. Thus, while frequent, ERK replaced with fresh medium 24 hours after transfection (19). Viral activation might not be an absolute requirement for MLLr AML. supernatant was harvested 48 hours after transfection and stored at While further analysis will be required to explore how C295 −80°C. pGMs from iMLL-ENL mice were isolated and transduced mutant MSN stimulate the ERK signaling to accelerate AML pro- with lentivirus by centrifugation of the lentivirus (2 hours, 1200g, gression, the ERM family protein ezrin was previously proposed to and 32°C) over RetroNectin (Takara Bio)–coated plates according facilitate the encounter of RAS with its activating enzyme, thereby to the manufacturer’s instructions and coculture of the cells over mediating spatiotemporal regulation of RAS activity (58, 59). Our the virus-coated wells overnight at 37°C. Transduction rates were interactome analysis revealed direct binding between MSN and aimed <30% to minimize the risk of infection of individual cells with ERK. Therefore, C295 mutant MSN might affect ERK activity by multiple barcodes. Forty-eight hours after transduction, 5000 trans- regulating the encounter of ERK with its phosphorylating or de- duced cells [blue fluorescent protein (BFP)] were sorted and transplant- phosphorylating enzymes. Surveying the literature, we also noted ed into lethally irradiated (900 rads) WT recipients (CD45.2+) together that the RRRKPDT motif at residues 293 to 299, which is affected by with 300,000 unfractionated BM cells (CD45.2+). At leukemic transfor- the R295C mutation, has been implicated previously in propagation mation, gDNA was purified from individual leukemic recipient BM of human lung cancer via its direct regulation by a small RNA, piR-L-163 cells using the PureLink Genomic DNA Isolation Kit (Thermo Fisher (35). R295 mutants might thereby function by altering the binding Scientific) and the 20–base pair (bp) barcodes were amplified by of small MSN regulatory RNAs, although how this would be con- PCR. Barcodes were amplified using Q5 High-Fidelity DNA Poly- nected to ERK activity is less clear. merase (New England Biolabs) with the following cycling conditions: We report here on the stepwise development of AML in a murine 30 s at 98oC, 32 cycles of 10 s at 98oC, 30 s at 65oC, and 30 s at 72oC, MLL-ENL model. Our study provides new insight into the evolu- followed by a final 2-min extension at 72oC. Primers used were tionary trajectories in murine MLLr AML, with the specific identi- ACGATACAAGGCTGTTAGAGAGA (forward) and CGGTGC- fication of a recurrent MSN R295C mutation and its function in CACTTTTTCAAGTT (reverse). Following PCR, Sanger sequencing leukemogenesis. We reveal a potential involvement of variants that of the barcodes was performed (Eurofins). lead to alterations of the R295 residue of MSN as codrivers also of human cancer. We believe that a better understanding of the bio- Retroviral production and transduction logical roles and specific mechanisms of ERM proteins can be used An Msn cDNA was cloned using Gibson assembly (New England for therapeutic benefit in human cancer, including AML. Biolabs) into an Eco RI and Xho I linearized MigR1 retroviral vector Yuan et al., Sci. Adv. 8, eabm9987 (2022) 20 April 2022 10 of 15 SCIENCE ADVANCES | RESEARCH ARTICLE (60) to generate the Msn-WT–green fluorescent protein (GFP) con- WT recipients (CD45.2+). Where relevant, recipients were put on a struct. Other Msn variants vectors were generated by using a Q5 doxycycline-containing diet 5 days before transplantation to ensure Site-Directed Mutagenesis kit (New England Biolabs) from the continuous expression of MLL-ENL. Survival rates were plotted using Msn-WT constructs. An shRNA targeting Msn were selected from a the Kaplan-Meier method (GraphPad Prism). Mortality, rapid ele- mouse genome-wide sensor-based shRNA predictions library and cloned vations in donor myeloid chimerism, and signs of morbidity according into the retroviral-based shRNA expression vector LENG, as previously to ethical guidelines were considered events for plotting event-free described (61). LENG was a gift from J. Zuber (Addgene, plasmid survival. Cells were sorted on a FACSAria II or III cell sorter (Becton no. 111162). Replication-­incompetent retroviruses were produced Dickinson). The following antibodies were used for flow cytometry: by transfecting the vectors into Plat-E packaging cells (RRID: CVCL_ anti-mouse CD117 (c-Kit)-APC (BioLegend, catalog no. 105812; RRID: B488) using Lipofectamine LTX Reagent with PLUS Reagent (Thermo AB_1282964), anti-mouse/human B220 Biotin (BioLegend, catalog Fisher Scientific). Virus-­containing supernatants were harvested no. 103203; RRID: AB_312988), anti-mouse CD4-Biotin (SONY, 48 hours after transfection. Retroviral transductions were performed catalog no. 1102020; RRID: AB_1848918), anti-mouse CD8-­Biotin by centrifugation of the retrovirus (2 hours, 1200g, and 32°C) over (SONY, catalog no. 1103520; RRID: AB_962670), anti-mouse Ly-6G/ RetroNectin (Takara Bio)–coated plates according to the manufac- Ly-6C (Gr-1)-Biotin (BioLegend, catalog no. 108404; RRID: AB_313369), turer’s instructions and coculture of the cells over the virus-coated anti-mouse TER-119-Biotin (BioLegend, catalog no. 116203; RRID: wells for 48 hours at 37°C. AB_313704), SAv-Brilliant Violet 605 (SONY, catalog no. 2626145), anti-mouse Ly-6A/E (Sca-1)–Pacific Blue (BioLegend, catalog no. 122520; Transduction and transplantation of LICs clone E13-161.7), anti-mouse CD48–fluorescein isothiocyanate (FITC; Downloaded from https://www.science.org at Universitat Autnoma de Barcelona on January 19, 2023 To assess the role of C295 MSN in normal hematopoiesis, we trans- BioLegend, catalog no. 103404; RRID: AB_313018), anti-mouse CD150-PE duced BM LSK (Lin−Sca1+cKit+) cells from WT C57BL/6 mice (BioLegend, catalog no. 115904; RRID: AB_313683), anti-mouse (CD45.2+) with either WT or R295C mutant MSN containing retro- CD105-PE-Cy7 (Thermo Fisher Scientific, catalog no. 25-1051-82; virus. Cells were cultured in StemSpan serum-free expansion media RRID: AB_2573379), anti-mouse CD16/CD32–Alexa Fluor 700 (STEMCELL Technologies) supplemented with gentamicin (50 ng/ml; (Thermo Fisher Scientific, catalog no. 56-0161-82; RRID: AB_493994), Invitrogen), 100 M 2-mercaptoethanol (Thermo Fisher Scientific), anti-mouse CD36-APC (BioLegend, catalog no. 102612; RRID: mouse Interleukin-3 (mIL-3) (5 ng/ml), human Flt3-Ligand (hFlt3) AB_2072639), anti-mouse Gr-1–Brilliant Violet 711 (SONY, catalog (20 ng/ml), mouse thrombopoietin (mTPO) (10 ng/ml), mouse stem no. 1142215; clone RB6-8C5), anti-mouse CD127 (IL7Ra)-FITC cell factor (mSCF) (50 ng/ml; all from PeproTech), and doxycycline (Thermo Fisher Scientific, catalog no. 11-1271-85; RRID: AB_465196), (1 g/ml; Sigma-Aldrich). and anti-mouse CD135 (Flt3)-PE (Thermo Fisher Scientific, catalog Forty-eight hours after transduction, 2000 donor cells were no. 12-1351-83; RRID: AB_465860) All flow cytometry and FACS competitively transplanted into lethally irradiated WT recipient hosts data were analyzed using FlowJo software (version 10.3, Tree Star). (CD45.1+) together with 300,000 unfractionated CD45.1+ BM cells per mouse. At the experimental end point (28 weeks after trans- Phenotypic analyses of the AML development plantation), reconstitution was assessed by FACS analysis of PB. To Diseased mice were subjected to automated blood counting (Sysmex assess the influence of MSN variants for MLL-ENL leukemia pro- KX-21N) analyses. Morphological analysis of GFP+ BM cells were gression, GMLPs and pGMs (LICs) were isolated as described pre- spun on a glass slide using a Shandon Cytospin (Thermo Scientific) viously (13) from iMLL-ENL mice and transduced with retroviruses and air-dried. Slides were stained for 5 min in May-Grünwald stain- expressing WT, C295, A558, D558, C295 + D558, or C295 + A558 ing solution (Sigma-Aldrich), washed for 5 min in phosphate-buffered MSN. Forty-eight hours after transduction, 6000 GFP+ transduced saline, and stained for 17 min in Giemsa stain (Sigma-Aldrich) diluted cells were sorted and transplanted into lethally irradiated (900 rads) 1:20 in deionized water. Slides were rinsed in deionized water, air- WT recipients (CD45.2+) together with 300,000 unfractionated dried, and visualized under a Nikon TE2000-S microscope. For each BM. To assess the influence of MSN for MLL-ENL leukemia progres- sample, four to five images were taken by a QImaging camera and sion, GMLPs and pGMs (LICs) were transduced with retroviruses QCapture Pro software (Fryer Company Inc.). Two hundred cells from expressing a scramble or Msn-targeting shRNA. Following trans- each sample were evaluated to quantify blasts and differentiated cells. duction, 3000 GFP+ transduced cells were sorted and transplanted into lethally irradiated (900 rads) WT recipients (CD45.2+) together Whole-genome and whole-exome sequencing with 300,000 unfractionated BM cells to ensure survival of trans- gDNA was extracted from donor and recipient BM with the PureLink planted hosts. To assess the leukemogenic activity of MSN variants Genomic DNA Kit (Invitrogen) for whole-genome sequencing (WGS) H295, S295, C294, and C293 identified in human cancers, we trans- or whole-exome sequencing (WES). WES (Agilent SureSelect whole planted 6000 transduced iMLL-ENL LICs per mouse into lethally exome capture 50 Mb, mouse) was performed on nine independent irradiated (900 rads) WT recipients (CD45.2+) together with 300,000 leukemia derived from different types of LICs and two additional unfractionated BM. For secondary transplantations, leukemic blasts donor-recipient pairs (cohort pGM_3 and pGM_4). In addition, we were collected from primary AML samples with the C295 mutant subjected 10 independent leukemias from a non–transplantation-­ MSN. For evaluation of MLL-ENL dependence, 100,000 candidate based MLL-ENL model (32) to WES. WGS was performed on one AML cells were transplanted to secondary recipients with or with- donor-recipient pair (cohort pGM_2), but analysis was restricted to out MLL-ENL induction. For evaluation of the impact of the C295 exonic regions. Samples were sequenced using Illumina instruments. MSN on AML propagation, primary AML cells were transduced Raw reads were checked for quality with FastQC (v.0.11.2) (62) and with retroviruses expressing Msn shRNA or scramble shRNA. mapped to mouse reference genome GRCm38 using BWA mem Forty-eight hours after transduction, 100,000 GFP+ leukemic blasts (v. 0.7.10) (63). Duplicated reads were removed with SAMtools were sorted and transplanted into sublethally irradiated (450 rad) (v. 0.1.19) (64). Mapped reads were further realigned, and bases Yuan et al., Sci. Adv. 8, eabm9987 (2022) 20 April 2022 11 of 15 SCIENCE ADVANCES | RESEARCH ARTICLE were recalibrated with genome analysis toolkit GATK using known 300 K. The equilibrated systems were then subjected to MDS for 100 ns. variants from C57BL/6NJ, 129S1/SvImJ for the detection of single-­ For every 5 ns, the trajectory files were saved for further analysis. nucleotide variations (SNVs), insertions and deletions (indel), and copy number variations/alterations (65). All functional annotations Western blot analysis were based on ENSEMBL genes. SNV and indel calling were performed Native (nondenaturing) conditions on a donor–single recipient basis using GATK MuTect2 (65). SNVs FLAG-tagged sequences [3x FLAG(DYKDDDDK)] were cloned and indels detected by the above software were subsequently filtered into the WT and C295 MSN at the C terminus by using Q5 Site-­ by a homemade pipeline, (i) excluding all the reported mutations Directed Mutagenesis (New England Biolabs). WT-MSN-3xFLAG with low depth (allele depth, <15); (ii) selecting the protein coding and C295-MSN-3xFLAG retroviruses were produced and transduc- mutations; (iii) selecting the missense and frameshift mutations; ed into NIH 3T3 (CLS, catalog no. 400101/p677_NIH-3T3; RRID: (iv) excluding mutations with low allele frequency (allele frequency, CVCL_0594) cells. Two days after the transduction, transduced <0.1); (v) excluding germline mutations detected from reference sam- cells were isolated and expanded in vitro for five more days. A total ples in cohorts pGM_2, pGM_3, and pGM_4; (vi) excluding common of 107 cells were lysed in 1 ml of ice-cold radioimmunoprecipitation single-nucleotide polymorphisms reported in mouse strains mgp. assay lysis buffer [150 mM NaCl, 1% NP-40, 0.5% sodium-deoxycholate, v4-C57BL/6NJ-129S1/SvImJ-129S5SvEvBrd and PROVEAN (66). 0.1% SDS, and 10 mM tris-HCl (pH 8)] supplemented with a protease (vii) All the somatic missense mutations were annotated by SnpEff, inhibitor cocktail (Roche). Lysates were cleared by centrifugation at and their functional consequences were evaluated using PROVEAN 15,000 rpm for 15 min at 4°C, and supernatants were removed and (66) and SIFT (36). FASTQ files were deposited at the Sequence assayed for protein concentration using the Quick Start Bradford Downloaded from https://www.science.org at Universitat Autnoma de Barcelona on January 19, 2023 Read Archive (SRA) with the dataset identifier PRJNA799845. Protein Assay Kit (Bio-Rad). Each sample was aliquoted into two parts. One aliquot was mixed with Novex Tris-Glycine Native Sam- Ultradeep targeted sequencing ple Buffer (2×) (Thermo Fisher Scientific) without denaturation, and gDNA was extracted from female uninduced iMLL-ENL and WT equal amounts of protein from WT and C295 mutant MSN samples C57BL/6 ckit+ cells. Six hundred nanograms of gDNA from ~100,000 cells were subjected to 4 to 20% Tris-Glycine Gels (Invitrogen) and (200,000 alleles) was used to generate the sequencing libraries for transferred to polyvinylidene difluoride membranes (Bio-Rad). The each sample. For the synthesized WT and MUT Msn oligo controls, other aliquot was denatured by mixing with an appropriate amount an input estimated to contain 200,000 copies was used. Amplicons of NuPAGE LDS Sample Buffer (4×) (Thermo Fisher Scientific) of ∼180 bp containing the region of interest were amplified using containing 2.5% 2-mercaptoethanol and boiling at 95°C for 5 min. PCR with custom primers. The amplified PCR products were cleaned Equal amounts of proteins from WT and C295 mutant MSN sam- up using SPRIselect beads (Beckman Coulter). A second PCR was ples were subjected to SDS–polyacrylamide gel electrophoresis as then performed to add index and sequencing adapters. The ampli- reference for total input levels of the FLAG-tagged proteins. The fied final libraries were cleaned up using SPRIselect beads (Beckman 3xFLAG-Tag was detected with a rabbit anti-FLAG antibody (1:1000; Coulter). Purified libraries were run on Agilent High Sensitivity Invitrogen, PA1-984B; RRID: AB_347227). Horseradish peroxidase– DNA Kit chip (Agilent Technologies) to verify desired size distribu- conjugated donkey anti-rabbit immunoglobulin G (1:5000; GE tion, quantified by Qubit dsDNA HS Assay Kit (Thermo Fisher Healthcare, NA934) was used as the secondary antibody. The antibody-­ Scientific), and pooled at equimolar concentrations. Pooled libraries labeled proteins were illuminated with SuperSignal West Femto Maximum were loaded on an Illumina MiSeq Reagent Nano Kit v2 flow cell Sensitivity Substrate (Thermo Fisher Scientific) and exposed to following protocols for single-end 50-cycle sequencing. Sequencing imaging films on the ChemiDoc MP Imaging System (Bio-Rad). data were downloaded as FASTQ files that were further assessed Denaturing conditions with the quality control tool FastQC (v.0.11.2) (62), including read For determination of MAPK signaling, iMLL-ENL LICs were isolated count, base quality across reads, and guanine and cytosine (GC) and transduced with WT, C295 mutant MSN, or L61 HRAS. Two content per sequence. Reads were evaluated at the c.833 position for days after transduction, transduced cells were sorted and grown base calls supporting the c.833C>T mutation. in vitro for 5 more days. A total of 107 cells were lysed, cleared, and further processed as above. The following antibodies were used: Protein structure prediction and simulation rabbit -actin (1:1000; Cell Signaling Technology, 4970; RRID: of molecular dynamics AB_2223172), rabbit p44/42 MAPK (Erk1/2) (1:1000; Cell Signaling The three-dimensional structures of the WT and mutant moesin Technology, 9102; RRID: AB_330744), rabbit phospho-p44/42 were determined using the comparative modeling approach MAPK (Erk1/2) (Thr202/Tyr204) (1:1000; Cell Signaling Technology, Modeller 9.214 (67). For target-template alignment, we used three 9101), rabbit MEK1/2 (1:1000; Cell Signaling Technology, 9122; known template structures (Protein Data Bank IDs: 1e5wA, 5j0kA, RRID: AB_823567), and rabbit phospho-MEK1/2(Ser217/221) (1:1000; and 2i1jA). The modeled structures were evaluated on the basis of Cell Signaling Technology, 9121). For determination of MSN pro- the template structures using RAMPAGE (68). MDS was performed tein level upon Msn shRNA knockdown, iMLL-ENL LICs were isolated using the GROMACS 4.6.3 package. GROMOS96 43a1 force field was and transduced with scramble or Msn shRNA. Two days after trans- used for all MDS (69). Before performing MDS, water molecules duction, transduced cells were collected, lysed, and processed as above. were removed and the structures were solvated in cubic of simple Rabbit moesin (1:1000; Abcam, ab52490; RRID: AB_881245) was used. point charge water molecules and periodic boundary conditions. The topology files were generated by GROMOS force field; then, the steepest Immunoprecipitation and MS descent method was applied for energy minimization. Before starting Sample preparation for protein mass spectroscopy dynamics, five chlorine molecules were added to neutralize the sys- WT-MSN-3xFLAG, C295-MSN-3xFLAG, or empty MigR1 vector tem. Equilibration of the system was kept at a constant temperature of retrovirus–transduced iMLL-ENL LICs (five biological replicates/individual Yuan et al., Sci. Adv. 8, eabm9987 (2022) 20 April 2022 12 of 15 SCIENCE ADVANCES | RESEARCH ARTICLE mice were included per group) were lysed in 1 ml of ice-cold immuno- were used for downstream proteome analyses. The protein abundance precipitation buffer [50 mM tris-HCl (pH 7.4), 150 mM NaCl, 1% table were filtered for protein q value (cutoff, 0.01), contaminant NP-40, and protease inhibitor]. Lysates were cleared by centrif- (excluded), reverse sequences (excluded), unique peptides (at least 1). ugation at 15,000 rpm for 15 min at 4°C, and supernatants were re- Data analysis moved and assayed for protein concentration using the Quick Start LFQ intensities were log2-transformed and filtered to select high-­ Bradford Protein Assay Kit (Bio-Rad). Equal amounts of proteins confidence interactors by using Welch corrected t test (P value cutoff, from WT, C295 mutant MSN, or empty vector–transduced LICs 0.05) and quantitative enrichment measure (log2 ratio to negative con- were incubated with 40 l of Anti-FLAG M2 Magnetic Beads trol; >0). WT and mutant samples were filtered separately against the (Sigma-Aldrich, M8823; RRID: AB_2637089) for 6 hours in the cold empty MigR1 vector control. Missing data were then applied (four of and then washed six times in immunoprecipitation wash buffer five observations needed). The filtered dataset was subsequently cen- [50 mM tris-HCl (pH 7.4), 150 mM NaCl, 0.3% NP-40, and protease tered and scaled. Statistical differences between WT and mutant models inhibitor]. Beads bound with FLAG-tagged proteins were then washed were assessed by Welch t test (Benjamini-Hochberg adjusted P value with 200 mM Hepes, and bound proteins were digested on beads cutoff, 0.05). Analyses were performed in GraphPad (v9.0) and R (v3.6). with trypsin (5 g/ml) in 200 mM Hepes/0.1% RapiGest for 7 hours Data accession at 37°C. Supernatant containing peptides was collected, and proteins MS files have been deposited to the ProteomeXchange Consortium remaining on beads were further digested with trypsin (5 g/ml) in via the PRIDE partner repository with the dataset identifier PXD028261. 200 mM Hepes/0.1% RapiGest/1 mM dithiothreitol for 1.5 hours at 37°C. Supernatant was collected, and both supernatants were com- qRT-PCR Downloaded from https://www.science.org at Universitat Autnoma de Barcelona on January 19, 2023 bined. Digested peptide mixtures were desalted and purified using Total RNA was isolated using a single-cell RNA purification kit Oasis HLB cartridges (Waters). Columns were primed and condi- (Norgen Biotek) and converted to cDNA using SuperScript III First-­ tioned in three steps using pure methanol, 80% acetonitrile (ACN), Strand Synthesis System (Invitrogen). qRT-PCR reactions were run and 0.1% formic acid (FA) in ultrapure water and 0.1% FA in water, with SYBR GreenER (Invitrogen) on a CFX96 Touch Real-Time PCR respectively. Samples were loaded on columns, and eluates were loaded Detection System (Bio-Rad). All signals were quantified using the again to maximize recovery. Columns were washed four times with Ct method and were normalized to -actin mRNA expression levels. 0.1% FA in water, and peptides were subsequently eluted in 45% ACN and 0.1% FA in water. Eluates were dried and stored at −80°C Statistical analysis before MS analysis. Data analysis was performed using Microsoft Excel and GraphPad MS analysis Prism (GraphPad Software). All FACS data were analyzed with Before MS analysis, purified peptide mixtures were reconstituted FlowJo (Tree Star). Significance values were calculated by Student’s with 3% ACN and 0.1% FA in ultrapure water, and peptide concen- two-tailed t test or the log rank test (Mantel-Cox test) for Kaplan-­ tration was measured on a DS-11-FX (DeNovix) at 215 nm. Global Meier curves. proteome MS analysis was performed on a Q-Exactive HF-X (Thermo Fisher Scientific) MS. The volume equivalent of 1 g of tryptic pep- SUPPLEMENTARY MATERIALS tides from each sample was trapped on an Acclaim PepMap 100 Supplementary material for this article is available at https://science.org/doi/10.1126/ sciadv.abm9987 precolumn (ID, 75 m by 2 cm; C18, 3 m; 100 Å resin; Thermo Fisher Scientific) and then separated on a reverse-phase EASY-Spray View/request a protocol for this paper from Bio-protocol. HPLC column (ID, 75 m by 50 cm; C18, 2 m; 100 Å resin; Thermo Fisher Scientific) coupled to a Proxeon nano–liquid chromatography REFERENCES AND NOTES 1. R. L. Bowman, L. Busque, R. L. Levine, Clonal hematopoiesis and evolution EASY 1200 system (Thermo Fisher Scientific). Peptides were eluted to hematopoietic malignancies. Cell Stem Cell 22, 157–170 (2018). in a 120-min gradient (flow, 350 nl/min; mobile phase A, 0.1% FA 2. J. C. Wang, J. E. Dick, Cancer stem cells: Lessons from leukemia. Trends Cell Biol. 15, in H2O; mobile phase B, 80% ACN and 0.1% FS). Gradient was as 494–501 (2005). follows: 10 to 30% B in 90 min, 30 to 45% B in 20 min, 45 to 95% B 3. K. Mitchell, U. Steidl, Targeting immunophenotypic markers on leukemic stem cells: How lessons from current approaches and advances in the leukemia stem cell (LSC) model can in 0.5 min, and 95% B for 9 min. Full MS scan parameters were as inform better strategies for treating acute myeloid leukemia (AML). Cold Spring Harb. follows: 60,000 resolution and AGC target was set to 3E6. Tandem Perspect. Med. 10, a036251 (2020). MS scan parameters were as follows: 15,000 resolution and AGC 4. A. V. Krivtsov, S. A. Armstrong, MLL translocations, histone modifications and leukaemia target was set to 1E5. Collision energy was set to 28, and n of ana- stem-cell development. Nat. Rev. Cancer 7, 823–833 (2007). lyzed peaks was set to 15. Dynamic exclusion window was set to 10 s. 5. V. Grossmann, S. Schnittger, F. Poetzinger, A. Kohlmann, A. Stiel, C. Eder, A. Fasan, W. Kern, T. Haferlach, C. Haferlach, High incidence of RAS signalling pathway mutations MS data processing in MLL-rearranged acute myeloid leukemia. Leukemia 27, 1933–1936 (2013). MS files were analyzed using MaxQuant (70) (v1.6.3.4), and MS 6. E. Papaemmanuil, M. Gerstung, L. Bullinger, V. I. Gaidzik, P. Paschka, N. D. Roberts, spectra searched using the Andromeda (71) search engine with the N. E. Potter, M. Heuser, F. Thol, N. Bolli, G. Gundem, P. van Loo, I. Martincorena, P. Ganly, UniProt–Swiss-Prot mouse proteome database (version download, L. Mudie, S. McLaren, S. O’Meara, K. Raine, D. R. Jones, J. W. Teague, A. P. Butler, M. F. Greaves, A. Ganser, K. Döhner, R. F. Schlenk, H. Döhner, P. J. Campbell, Genomic 2021.02.08; selected enzyme, trypsin). Carbamidomethylation of Cys classification and prognosis in acute myeloid leukemia. N. Engl. J. Med. 374, 2209–2221 residues was selected as fixed modification, while Met oxidation and (2016). acetylation of N-terminal residues were selected as variable ones. 7. A. K. Andersson, J. Ma, J. Wang, X. Chen, A. L. Gedman, J. Dang, J. Nakitandwe, Label-free quantification (LFQ) was activated for the proteome data L. Holmfeldt, M. Parker, J. Easton, R. Huether, R. Kriwacki, M. Rusch, G. Wu, Y. Li, H. Mulder, search. Identification of peptides resulting from missed cleavages S. Raimondi, S. Pounds, G. Kang, L. Shi, J. Becksfort, P. Gupta, D. Payne-Turner, B. Vadodaria, K. Boggs, D. Yergeau, J. Manne, G. Song, M. Edmonson, P. Nagahawatte, was allowed. Precursor ion tolerances were 20 and 4.5 parts per million L. Wei, C. Cheng, D. Pei, R. Sutton, N. C. Venn, A. Chetcuti, A. Rush, D. Catchpoole, for first and main searches, respectively. Match-between-run option J. Heldrup, T. Fioretos, C. Lu, L. Ding, C.-H. Pui, S. Shurtleff, C. G. Mullighan, E. R. Mardis, was enabled, and settings were left to default. Protein LFQ intensities R. K. Wilson, T. A. Gruber, J. Zhang, J. R. Downing; St. Jude Children's Research Yuan et al., Sci. Adv. 8, eabm9987 (2022) 20 April 2022 13 of 15 SCIENCE ADVANCES | RESEARCH ARTICLE Hospital–Washington University Pediatric Cancer Genome Project, The landscape 25. P. Prasad, A. Lennartsson, K. Ekwall, The roles of SNF2/SWI2 nucleosome remodeling of somatic mutations in infant MLL-rearranged acute lymphoblastic leukemias. enzymes in blood cell differentiation and leukemia. Biomed. Res. Int. 2015, 347571 (2015). Nat. Genet. 47, 330–337 (2015). 26. L. Shih, D.-C. Liang, C.-F. Huang, Y.-T. Chang, C.-L. Lai, T.-H. Lin, C.-P. Yang, I.-J. Hung, 8. T. A. Milne, Mouse models of MLL leukemia: Recapitulating the human disease. Blood H.-C. Liu, T.-H. Jaing, L.-Y. Wang, T.-C. Yeh, Cooperating mutations of receptor tyrosine 129, 2217–2223 (2017). kinases and Ras genes in childhood core-binding factor acute myeloid leukemia 9. A. Hyrenius-Wittsten, M. Pilheden, H. Sturesson, J. Hansson, M. P. Walsh, G. Song, and a comparative analysis on paired diagnosis and relapse samples. Leukemia 22, J. U. Kazi, J. Liu, R. Ramakrishan, C. Garcia-Ruiz, S. Nance, P. Gupta, J. Zhang, 303–307 (2008). L. Rönnstrand, A. Hultquist, J. R. Downing, K. Lindkvist-Petersson, K. Paulsson, M. Järås, 27. M. Ibáñez, J. Carbonell-Caballero, E. Such, L. García-Alonso, A. Liquori, M. López-Pavía, T. A. Gruber, J. Ma, A. K. Hagström-Andersson, De novo activating mutations drive clonal M. Llop, C. Alonso, E. Barragán, I. Gómez-Seguí, A. Neef, D. Hervás, P. Montesinos, G. Sanz, evolution and enhance clonal fitness in KMT2A-rearranged leukemia. Nat. Commun. 9, M. A. Sanz, J. Dopazo, J. Cervera, The modular network structure of the mutational 1770 (2018). landscape of acute myeloid leukemia. PLOS ONE 13, e0202926 (2018). 10. S. Kotani, A. Yoda, A. Kon, K. Kataoka, Y. Ochi, Y. Shiozawa, C. Hirsch, J. Takeda, H. Ueno, 28. F. Xu, L. Y. Wu, C. K. Chang, Q. He, Z. Zhang, L. Liu, W. H. Shi, J. Guo, Y. Zhu, Y. S. Zhao, T. Yoshizato, K. Yoshida, M. M. Nakagawa, Y. Nannya, N. Kakiuchi, T. Yamauchi, K. Aoki, S. C. Gu, C. M. Fei, D. Wu, L. Y. Zhou, J. Y. Su, L. X. Song, C. Xiao, X. Li, Whole-exome Y. Shiraishi, S. Miyano, T. Maeda, J. P. Maciejewski, A. Takaori-Kondo, S. Ogawa, and targeted sequencing identify ROBO1 and ROBO2 mutations as progression-related H. Makishima, Molecular pathogenesis of disease progression in MLL-rearranged AML. drivers in myelodysplastic syndromes. Nat. Commun. 6, 8806 (2015). Leukemia 33, 612–624 (2019). 29. V. Grossmann, E. Tiacci, A. B. Holmes, A. Kohlmann, M. P. Martelli, W. Kern, A. Spanhol-Rosseto, 11. L. Chen, W. Chen, M. Mysliwski, J. Serio, J. Ropa, F. A. Abulwerdi, R. J. Chan, J. P. Patel, H. U. Klein, M. Dugas, S. Schindela, V. Trifonov, S. Schnittger, C. Haferlach, R. Bassan, M. S. Tallman, E. Paietta, A. Melnick, R. L. Levine, O. Abdel-Wahab, Z. Nikolovska-Coleska, V. A. Wells, O. Spinelli, J. Chan, R. Rossi, S. Baldoni, L. de Carolis, K. Goetze, H. Serve, A. G. Muntean, Mutated Ptpn11 alters leukemic stem cell frequency and reduces R. Peceny, K. A. Kreuzer, D. Oruzio, G. Specchia, F. di Raimondo, F. Fabbiano, M. Sborgia, the sensitivity of acute myeloid leukemia cells to Mcl1 inhibition. Leukemia 29, A. Liso, L. Farinelli, A. Rambaldi, L. Pasqualucci, R. Rabadan, T. Haferlach, B. Falini, 1290–1300 (2015). Whole-exome sequencing identifies somatic mutations of BCOR in acute myeloid 12. D. H. Christiansen, M. K. Andersen, F. Desta, J. Pedersen-Bjergaard, Mutations of genes leukemia with normal karyotype. Blood 118, 6153–6163 (2011). Downloaded from https://www.science.org at Universitat Autnoma de Barcelona on January 19, 2023 in the receptor tyrosine kinase (RTK)/RAS-BRAF signal transduction pathway in therapy- 30. A. Pellagatti, M. Fernandez-Mercado, C. di Genua, M. J. Larrayoz, S. Killick, H. Dolatshad, related myelodysplasia and acute myeloid leukemia. Leukemia 19, 2232–2240 (2005). A. Burns, M. J. Calasanz, A. Schuh, J. Boultwood, Whole-exome sequencing in del (5q) 13. A. Ugale, G. L. Norddahl, M. Wahlestedt, P. Säwén, P. Jaako, C. J. Pronk, S. Soneji, myelodysplastic syndromes in transformation to acute myeloid leukemia. Leukemia 28, J. Cammenga, D. Bryder, Hematopoietic stem cells are intrinsically protected against 1148–1151 (2014). MLL-ENL-mediated transformation. Cell Rep. 9, 1246–1255 (2014). 31. J. W. Tyner, C. E. Tognon, D. Bottomly, B. Wilmot, S. E. Kurtz, S. L. Savage, N. Long, 14. A. Ugale, P. Säwén, M. Dudenhöffer-Pfeifer, M. Wahlestedt, G. L. Norddahl, D. Bryder, A. R. Schultz, E. Traer, M. Abel, A. Agarwal, A. Blucher, U. Borate, J. Bryant, R. Burke, MLL-ENL-mediated leukemia initiation at the interface of lymphoid commitment. A. Carlos, R. Carpenter, J. Carroll, B. H. Chang, C. Coblentz, A. d’Almeida, R. Cook, Oncogene 36, 3207–3212 (2017). A. Danilov, K. H. T. Dao, M. Degnin, D. Devine, J. Dibb, D. K. Edwards V, C. A. Eide, 15. C. J. Pronk, D. J. Rossi, R. Månsson, J. L. Attema, G. L. Norddahl, C. K. F. Chan, I. English, J. Glover, R. Henson, H. Ho, A. Jemal, K. Johnson, R. Johnson, B. Junio, M. Sigvardsson, I. L. Weissman, D. Bryder, Elucidation of the phenotypic, functional, A. Kaempf, J. Leonard, C. Lin, S. Q. Liu, P. Lo, M. M. Loriaux, S. Luty, T. Macey, and molecular topography of a myeloerythroid progenitor cell hierarchy. Cell Stem Cell 1, J. MacManiman, J. Martinez, M. Mori, D. Nelson, C. Nichols, J. Peters, J. Ramsdill, A. Rofelty, 428–442 (2007). R. Schuff, R. Searles, E. Segerdell, R. L. Smith, S. E. Spurgeon, T. Sweeney, A. Thapa, 16. S. C. Kogan, J. M. Ward, M. R. Anver, J. J. Berman, C. Brayton, R. D. Cardiff, J. S. Carter, C. Visser, J. Wagner, K. Watanabe-Smith, K. Werth, J. Wolf, L. White, A. Yates, H. Zhang, S. de Coronado, J. R. Downing, T. N. Fredrickson, D. C. Haines, A. W. Harris, N. L. Harris, C. R. Cogle, R. H. Collins, D. C. Connolly, M. W. Deininger, L. Drusbosky, C. S. Hourigan, H. Hiai, E. S. Jaffe, I. MacLennan, P. P. Pandolfi, P. K. Pattengale, A. S. Perkins, C. T. Jordan, P. Kropf, T. L. Lin, M. E. Martinez, B. C. Medeiros, R. R. Pallapati, D. A. Pollyea, R. M. Simpson, M. S. Tuttle, J. F. Wong, H. C. Morse III; Hematopathology subcommittee of R. T. Swords, J. M. Watts, S. J. Weir, D. L. Wiest, R. M. Winters, S. K. McWeeney, the Mouse Models of Human Cancers Consortium, Bethesda proposals for classification B. J. Druker, Functional genomic landscape of acute myeloid leukaemia. Nature 562, of nonlymphoid hematopoietic neoplasms in mice. Blood 100, 238–245 (2002). 526–531 (2018). 17. T. Velasco-Hernandez, A. Hyrenius-Wittsten, M. Rehn, D. Bryder, J. Cammenga, HIF-1 can 32. T. Okeyo-Owuor, Y. Li, R. M. Patel, W. Yang, E. B. Casey, A. S. Cluster, S. N. Porter, D. Bryder, act as a tumor suppressor gene in murine acute myeloid leukemia. Blood 124, 3597–3607 J. A. Magee, The efficiency of murine MLL-ENL-driven leukemia initiation changes (2014). with age and peaks during neonatal development. Blood Adv. 3, 2388–2399 (2019). 18. M. Almosailleakh, J. Schwaller, Murine models of acute myeloid leukaemia. Int. J. Mol. Sci. 33. V. P. Lavallée, I. Baccelli, J. Krosl, B. Wilhelm, F. Barabé, P. Gendron, G. Boucher, S. Lemieux, 20, 453 (2019). A. Marinier, S. Meloche, J. Hébert, G. Sauvageau, The transcriptomic landscape 19. H. Koike-Yusa, Y. Li, E. P. Tan, C. Velasco-Herrera Mdel, K. Yusa, Genome-wide recessive genetic and directed chemical interrogation of MLL-rearranged acute myeloid leukemias. screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat. Biotechnol. 32, Nat. Genet. 47, 1030–1037 (2015). 267–273 (2014). 34. L. Huang, T. Y. Wong, R. C. Lin, H. Furthmayr, Replacement of threonine 558, a critical site 20. H. G. V. Einsiedel, T. Taube, B. Beyermann, S. Dragon, A. Möricke, C. Kebelmann-betzig, of phosphorylation of moesin in vivo, with aspartate activates F-actin binding of moesin. J. Köchling, G. Ü. N. Henze, K. Seeger, Absence of mutations in the CDKN2 binding site Regulation by conformational change. J. Biol. Chem. 274, 12803–12810 (1999). of CDK4 in childhood acute lymphoblastic leukemia. Leuk. Lymphoma 40, 413–417 (2001). 35. Y. Mei, Y. Wang, P. Kumari, A. C. Shetty, D. Clark, T. Gable, A. D. MacKerell, M. Z. Ma, 21. M. Yilmaz, F. Wang, S. Loghavi, C. Bueso-Ramos, C. Gumbs, L. Little, X. Song, J. Zhang, D. J. Weber, A. J. Yang, M. J. Edelman, L. Mao, A piRNA-like small RNA interacts T. Kadia, G. Borthakur, E. Jabbour, N. Pemmaraju, N. Short, G. Garcia-Manero, Z. Estrov, with and modulates p-ERM proteins in human somatic cells. Nat. Commun. 6, 7316 (2015). H. Kantarjian, A. Futreal, K. Takahashi, F. Ravandi, Late relapse in acute myeloid leukemia 36. R. Vaser, S. Adusumalli, S. N. Leng, M. Sikic, P. C. Ng, SIFT missense predictions (AML): Clonal evolution or therapy-related leukemia? Blood Cancer J. 9, 1–6 (2019). for genomes. Nat. Protoc. 11, 1–9 (2016). 22. M. Ojeda-Uribe, E. Jeandidier, P. Cornillet-Lefebvre, A. Le Bechec, L. Mauvieux, Molecular 37. I. A. Adzhubei, S. Schmidt, L. Peshkin, V. E. Ramensky, A. Gerasimova, P. Bork, profiling by whole-exome-sequencing of two patients with t-AML post combined A. S. Kondrashov, S. R. Sunyaev, A method and server for predicting damaging missense therapy of acute promyelocytic leukemia. Exp. Hematol. 53, S74 (2017). mutations. Nat. Methods 7, 248–249 (2010). 23. M. Garg, Y. Nagata, D. Kanojia, A. Mayakonda, K. Yoshida, S. Haridas Keloth, Z. J. Zang, 38. H. A. Shihab, J. Gough, M. Mort, D. N. Cooper, I. N. M. Day, T. R. Gaunt, Ranking Y. Okuno, Y. Shiraishi, K. Chiba, H. Tanaka, S. Miyano, L. W. Ding, T. Alpermann, Q. Y. Sun, non-synonymous single nucleotide polymorphisms based on disease concepts. D. C. Lin, W. Chien, V. Madan, L. Z. Liu, K. T. Tan, A. Sampath, S. Venkatesan, K. Inokuchi, Hum. Genomics 8, 11 (2014). S. Wakita, H. Yamaguchi, W. J. Chng, S. K. Y. Kham, A. E. J. Yeoh, M. Sanada, J. Schiller, 39. K. Kitano, F. Yusa, T. Hakoshima, Structure of dimerized radixin FERM domain suggests K. A. Kreuzer, S. M. Kornblau, H. M. Kantarjian, T. Haferlach, M. Lill, M. C. Kuo, L. Y. Shih, a novel masking motif in C-terminal residues 295-304. Acta Crystallogr. Sect. F Struct. Biol. I. W. Blau, O. Blau, H. Yang, S. Ogawa, H. P. Koeffler, Profiling of somatic mutations in acute Cryst. Commun. 62, 340–345 (2006). myeloid leukemia with FLT3-ITD at diagnosis and relapse. Blood 126, 2491–2501 (2015). 40. R. Viswanatha, J. Wayt, P. Y. Ohouo, M. B. Smolka, A. Bretscher, Interactome analysis 24. J. Takeda, K. Yoshida, M. M. Nakagawa, Y. Nannya, A. Yoda, D. Morishita, R. Saiki, K. Chiba, reveals ezrin can adopt multiple conformational states. J. Biol. Chem. 288, 35437–35451 H. Tanaka, Y. Shiraishi, M. C. Kuo, C. M. Kerr, Y. Nagata, N. Hiramoto, A. Hangaishi, (2013). H. Nakazawa, K. Ishiyama, S. Miyano, S. Chiba, Y. Miyazaki, T. Kitano, K. Usuki, N. Sezaki, 41. L. Steelman, R. A. Franklin, S. L. Abrams, W. Chappell, C. R. Kempf, J. Bäsecke, F. Stivala, H. Tsurumi, S. Miyawaki, J. P. Maciejewski, T. Ishikawa, K. Ohyashiki, A. Ganser, M. Heuser, M. Donia, P. Fagone, F. Nicoletti, M. Libra, P. Ruvolo, V. Ruvolo, C. Evangelisti, F. Thol, L. Y. Shih, A. Takaori-Kondo, H. Makishima, S. Ogawa, EPOR/JAK/STAT signaling A. M. Martelli, J. A. McCubrey, Roles of the Ras/Raf/MEK/ERK pathway in leukemia therapy. pathway as therapeutic target of acute erythroid leukemia. Blood 138, 610 (2021). Leukemia 25, 1080–1094 (2011). Yuan et al., Sci. Adv. 8, eabm9987 (2022) 20 April 2022 14 of 15 SCIENCE ADVANCES | RESEARCH ARTICLE 42. K. H. Metzeler, N. Sandhöfer, T. Hinrichsen, E. Zellmeier, B. Ksienzyk, A. Dufour, 59. T. Sperka, K. J. Geißler, U. Merkel, I. Scholl, I. Rubio, P. Herrlich, H. L. Morrison, Activation S. Schneider, P. M. Kakadia, P. A. Greif, M. S. Subklewe, Analysis of cooperating genetic of Ras requires the ERM-dependent link of actin to the plasma membrane. PLOS ONE 6, events in MLLT3-MLL rearranged acute myeloid leukemia (AML) by targeted e27511 (2011). next-generation sequencing of 16 leukemia-related genes reveals frequent mutations 60. W. S. Pear, J. P. Miller, L. Xu, J. C. Pui, B. Soffer, R. C. Quackenbush, A. M. Pendergast, affecting growth factor signalling pathways and provides evidence for clonal R. Bronson, J. C. Aster, M. L. Scott, D. Baltimore, Efficient and rapid induction of a chronic heterogeneity. Blood 120, 1379 (2012). myelogenous leukemia-like myeloproliferative disease in mice receiving P210 bcr/ 43. Cancer Genome Atlas Research Network, Genomic and epigenomic landscapes of adult abl-transduced bone marrow. Blood 92, 3780–3792 (1998). de novo acute myeloid leukemia. N. Engl. J. Med. 368, 2059–2074 (2013). 61. C. Fellmann, T. Hoffmann, V. Sridhar, B. Hopfgartner, M. Muhar, M. Roth, D. Y. Lai, 44. R. Ono, H. Kumagai, H. Nakajima, A. Hishiya, T. Taki, K. Horikawa, K. Takatsu, T. Satoh, I. A. Barbosa, J. S. Kwon, Y. Guan, An optimized microRNA backbone for effective Y. Hayashi, T. Kitamura, T. Nosaka, Mixed-lineage-leukemia (MLL) fusion protein single-copy RNAi. Cell reports 5, 1704–1713 (2013). collaborates with Ras to induce acute leukemia through aberrant Hox expression and Raf 62. G. A. Van der Auwera, M. O. Carneiro, C. Hartl, R. Poplin, G. D. Angel, A. Levy-Moonshine, activation. Leukemia 23, 2197–2209 (2009). T. Jordan, K. Shakir, D. Roazen, J. Thibault, E. Banks, K. V. Garimella, D. Altshuler, 45. S. Dutta, A. Krause, S. Vosberg, T. Herold, B. Ksienzyk, L. Quintanilla-Martinez, B. Tizazu, S. Gabriel, M. A. De Pristo, From FastQ data to high-confidence variant calls: M. Chopra, A. Graf, S. Krebs, H. Blum, P. A. Greif, A. Vetter, K. Metzeler, M. Rothenberg-Thurley, The genome analysis toolkit best practices pipeline. Curr. Protoc. Bioinformatics 43, M. R. Schneider, M. Dahlhoff, K. Spiekermann, U. Zimber-Strobl, E. Wolf, S. K. Bohlander, The 11.10.11–11.10.33 (2013). target cell of transformation is distinct from the leukemia stem cell in murine CALM/AF10 63. H. Li, Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. leukemia models. Leukemia 30, 1166–1176 (2016). arXiv:1303.3997 [q-bio.GN] (2013). 46. W. T. Lankes, H. Furthmayr, Moesin: A member of the protein 4.1-talin-ezrin family 64. H. Li, B. Handsaker, A. Wysoker, T. Fennell, J. Ruan, N. Homer, G. Marth, G. Abecasis, of proteins. Proc. Natl. Acad. Sci. U.S.A. 88, 8297–8301 (1991). R. Durbin; 1000 Genome Project Data Processing Subgroup, The sequence alignment/ 47. A. Shcherbina, A. Bretscher, D. M. Kenney, E. Remold-O'Donnell, Moesin, the major ERM map format and SAMtools. Bioinformatics 25, 2078–2079 (2009). protein of lymphocytes and platelets, differs from ezrin in its insensitivity to calpain. FEBS 65. A. McKenna, M. Hanna, E. Banks, A. Sivachenko, K. Cibulskis, A. Kernytsky, K. Garimella, Lett. 443, 31–36 (1999). D. Altshuler, S. Gabriel, M. Daly, M. A. DePristo, The Genome Analysis Toolkit: Downloaded from https://www.science.org at Universitat Autnoma de Barcelona on January 19, 2023 48. J. Clucas, F. Valderrama, ERM proteins in cancer progression. J. Cell Sci. 127, 267–275 A MapReduce framework for analyzing next-generation DNA sequencing data. Genome (2014). Res. 20, 1297–1303 (2010). 49. H. Kobayashi, J. Sagara, H. Kurita, M. Morifuji, M. Ohishi, K. Kurashina, S. Taniguchi, Clinical 66. Y. Choi, A. P. Chan, PROVEAN web server: A tool to predict the functional effect of amino significance of cellular distribution of moesin in patients with oral squamous cell acid substitutions and indels. Bioinformatics 31, 2745–2747 (2015). carcinoma. Clin. Cancer Res. 10, 572–580 (2004). 67. B. Webb, A. Sali, Comparative protein structure modeling using MODELLER. Curr. Protoc. 50. A. Estecha, L. Sánchez-Martín, A. Puig-Kröger, R. A. Bartolomé, J.́. Teixidó, R. Samaniego, Protein Sci. 86, 2.9.1–2.9.37 (2016). P. Sánchez-Mateos, Moesin orchestrates cortical polarity of melanoma tumour cells 68. S. C. Lovell, I. W. Davis, W. B. Arendall III, P. I. W. de Bakker, J. M. Word, M. G. Prisant, to initiate 3D invasion. J. Cell Sci. 122, 3492–3501 (2009). J. S. Richardson, D. C. Richardson, Structure validation by C geometry: , and C 51. Y. Qin, W. Chen, G. Jiang, L. Zhou, X. Yang, H. Li, X. He, H.-L. Wang, Y.-B. Zhou, S. Huang, deviation. Proteins 50, 437–450 (2003). S. Liu, Interfering MSN-NONO complex–activated CREB signaling serves as a therapeutic 69. W. R. P. Scott, P. H. Hünenberger, I. G. Tironi, A. E. Mark, S. R. Billeter, J. Fennen, A. E. Torda, strategy for triple-negative breast cancer. Sci. Adv. 6, eaaw9960 (2020). T. Huber, P. Krüger, W. F. van Gunsteren, The GROMOS biomolecular simulation program 52. F. Tort, M. Pinyol, K. Pulford, G. Roncador, L. Hernandez, I. Nayach, H. C. Kluin-Nelemans, package. Chem. A Eur. J. 103, 3596–3607 (1999). P. Kluin, C. Touriol, G. Delsol, D. Mason, E. Campo, Molecular characterization of a new 70. J. Cox, M. Mann, MaxQuant enables high peptide identification rates, individualized ALK translocation involving moesin (MSN-ALK) in anaplastic large cell lymphoma. p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. Lab. Invest. 81, 419–426 (2001). 26, 1367–1372 (2008). 53. C. Lagresle-Peyrou, S. Luce, F. Ouchani, T. S. Soheili, H. Sadek, M. Chouteau, A. Durand, 71. J. Cox, N. Neuhauser, A. Michalski, R. A. Scheltema, J. V. Olsen, M. Mann, Andromeda: I. Pic, J. Majewski, C. Brouzes, N. Lambert, A. Bohineust, E. Verhoeyen, F.-L. Cosset, A peptide search engine integrated into the MaxQuant environment. J. Proteome Res. 10, A. Magerus-Chatinet, F. Rieux-Laucat, V. Gandemer, D. Monnier, C. Heijmans, M. van Gijn, 1794–1805 (2011). V. A. Dalm, N. Mahlaoui, J.-L. Stephan, C. Picard, A. Durandy, S. Kracker, C. Hivroz, N. Jabado, G. de Saint Basile, A. Fischer, M. Cavazzana, X-linked primary Acknowledgments: We thank G. Sten and E. Erlandson for expert technical support. M. Ciesla immunodeficiency associated with hemizygous mutations in the moesin (MSN) gene. and S. Muthukumar are acknowledged for valuable scientific discussions. S. Adolfsson and J. Allergy Clin. Immunol. 138, 1681–1689.e8 (2016). Genevia Technologies are acknowledged for analysis of sequencing data. Funding: This work 54. X. Liu, T. Yang, K. Suzuki, S. Tsukita, M. Ishii, S. Zhou, G. Wang, L. Cao, F. Qian, S. Taylor, was generously supported by project grants from the Swedish Cancer Society CAN2018/322 M. J. Oh, I. Levitan, R. D. Ye, G. K. Carnegie, Y. Zhao, A. B. Malik, J. Xu, Moesin and myosin (D.B.), the Swedish Medical Research Council 2018-02515 (D.B.), the Tobias Foundation 2016 phosphatase confine neutrophil orientation in a chemotactic gradient. J. Exp. Med. 212, (D.B.), and a European Research Council (ERC) consolidator grant, Leukemiabarrier, 615068 267–280 (2015). (D.B.). J.A.M. is a Leukemia and Lymphoma Society scholar. Author contributions: O.Y., A.U., 55. B. Mizukawa, E. O’Brien, D. C. Moreira, M. Wunderlich, C. L. Hochstetler, X. Duan, W. Liu, A.K.-C., H.W., M.E., C.D., T.V.-H., and I.H. performed experiments. O.Y., T.d.M., E.N., M.J., and J.H. E. Orr, H. L. Grimes, J. C. Mulloy, Y. Zheng, The cell polarity determinant CDC42 controls designed, performed, and interpreted MS experiments. V.A. and O.Y. designed, performed, division symmetry to block leukemia cell differentiation. Blood 130, 1336–1346 (2017). and interpreted the protein structure prediction analysis. J.A.M. provided Msn mutation data 56. P. Zhang, L. Azizi, S. Kukkurainen, T. Gao, M. Baikoghli, M. C. Jacquier, Y. Sun, from the non–transplantation-based MLL-ENL model, and J.C. provided retroviral MLL-AF9 J. A. E. Määttä, R. H. Cheng, B. Wehrle-Haller, V. P. Hytönen, J. Wu, Crystal structure data. D.B. designed and supervised the work and wrote the manuscript together with O.Y. of the FERM-folded talin head reveals the determinants for integrin binding. Proc. Natl. Competing interests: The authors declare that they have no competing interests. Data and Acad. Sci. U.S.A. 117, 32402–32412 (2020). materials availability: All data needed to evaluate the conclusions in the paper are present in 57. E. Weisberg, C. Meng, A. Case, M. Sattler, H. L. Tiv, P. C. Gokhale, S. Buhrlage, J. Wang, the paper and/or the Supplementary Materials. The whole-genome and exome sequencing N. Gray, R. Stone, S. Liu, S. V. Bhagwat, R. V. Tiu, S. Adamia, J. D. Griffin, Evaluation datasets are available at SRA under accession numbers PRJNA799845. All MS proteomic data of ERK as a therapeutic target in acute myelogenous leukemia. Leukemia 34, 625–629 were deposited to the ProteomeXchange Consortium with the dataset identifier PXD028261. (2020). 58. K. J. Geißler, M. J. Jung, L. B. Riecken, T. Sperka, Y. Cui, S. Schacke, U. Merkel, R. Markwart, Submitted 2 November 2021 I. Rubio, M. E. Than, C. Breithaupt, S. Peuker, R. Seifert, U. B. Kaupp, P. Herrlich, Accepted 1 March 2022 H. Morrison, Regulation of Son of sevenless by the membrane-actin linker protein ezrin. Published 20 April 2022 Proc. Natl. Acad. Sci. 110, 20587–20592 (2013). 10.1126/sciadv.abm9987 Yuan et al., Sci. Adv. 8, eabm9987 (2022) 20 April 2022 15 of 15 A somatic mutation in moesin drives progression into acute myeloid leukemia Ouyang Yuan, Amol Ugale, Tommaso de Marchi, Vimala Anthonydhason, Anna Konturek-Ciesla, Haixia Wan, Mohamed Eldeeb, Caroline Drabe, Maria Jassinskaja, Jenny Hansson, Isabel Hidalgo, Talia Velasco-Hernandez, Jrg Cammenga, Jeffrey A. Magee, Emma Nimus, and David Bryder Sci. Adv., 8 (16), eabm9987. DOI: 10.1126/sciadv.abm9987 Downloaded from https://www.science.org at Universitat Autnoma de Barcelona on January 19, 2023 View the article online https://www.science.org/doi/10.1126/sciadv.abm9987 Permissions https://www.science.org/help/reprints-and-permissions Use of this article is subject to the Terms of service Science Advances (ISSN ) is published by the American Association for the Advancement of Science. 1200 New York Avenue NW, Washington, DC 20005. The title Science Advances is a registered trademark of AAAS. Copyright © 2022 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works. Distributed under a Creative Commons Attribution License 4.0 (CC BY).