BRIEF RESEARCH REPORT published: 31 January 2022 doi: 10.3389/fonc.2022.828471 Results of ARI-0001 CART19 Cells in Patients With Chronic Lymphocytic Leukemia and Richter’s Transformation Valentı́n Ortiz-Maldonado 1,2, Gerard Frigola 3, Marta Español-Rego 4, Olga Balagué 2,3, Nuria Martı́nez-Cibrián 1, Laura Magnano 1,2, Eva Giné 1,2,5, Mariona Pascal 4, Juan G. Correa 1, Alexandra Martı́nez-Roca 1, Joan Cid 2,6, Miquel Lozano 2,6,7, Neus Villamor 2,5,8, Daniel Benı́tez-Ribas 2,4, Jordi Esteve 1,2,7,9, Armando López-Guillermo 1,2,5,7, Edited by: Elı́as Campo 2,3,5,7,8, Álvaro Urbano-Ispizua 1,2,7,9, Manel Juan 2,4,7 and Julio Delgado 1,2,5,7* Massimo Gentile, Cosenza Hospital, Italy 1 Department of Hematology, Hospital Clı´nic de Barcelona, Barcelona, Spain, 2 Oncology and Hematology, Institut Reviewed by: d’Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS), Barcelona, Spain, 3 Department of Pathology, Hospital Clı´nic de Paolo Ghia, Barcelona, Barcelona, Spain, 4 Department of Immunology, Hospital Clı´nic de Barcelona, Barcelona, Spain, 5 Centro de Vita-Salute San Raffaele Investigación Biomédica en Red de Cáncer (CIBERONC), Barcelona, Spain, 6 Apheresis & Cell Therapy Unit, Department of University, Italy Hemotherapy and Hemostasis, Hospital Clı´nic de Barcelona, Barcelona, Spain, 7 Department of Medicine, University of Yi Luo, Barcelona, Barcelona, Spain, 8 Hematopathology Unit, Hospital Clı´nic de Barcelona, Barcelona, Spain, 9 Stem Cell Transplant Zhejiang University, China and Cell Immunotherapy Group, Institute of Research Josep Carreras, Barcelona, Spain *Correspondence: Julio Delgado CART19 cells are emerging as an alternative therapy for patients with chronic lymphocytic jdelgado@clinic.cat leukemia (CLL). Here we report the outcome of nine consecutive patients with CLL treated Specialty section: with ARI-0001 CART19 cells, six of them with Richter’s transformation (RT). One patient This article was submitted to with RT never received therapy. The cytokine release syndrome rate was 87.5% (12.5% Hematologic Malignancies, grade ≥3). Neurotoxicity was not observed in any patient. All patients experienced a section of the journal Frontiers in Oncology absolute B-cell aplasia, and seven (87.5%) responded to therapy. With a median Received: 03 December 2021 follow-up of 5.6 months, two patients with RT experienced a CD19-negative relapse. In Accepted: 12 January 2022 conclusion, ARI-0001 cell therapy was feasible, safe, and effective in patients with high- Published: 31 January 2022 risk CLL or RT. Citation: Ortiz-Maldonado V, Frigola G, Keywords: CLL, CART, CD19, DLBCL, Richter disease Español-Rego M, Balagué O, Martı´nez-Cibrián N, Magnano L, Giné E, Pascal M, Correa JG, Martı´nez-Roca A, Cid J, Lozano M, INTRODUCTION Villamor N, Benı´tez-Ribas D, Esteve J, López-Guillermo A, Campo E, Patients with chronic lymphocytic leukemia (CLL) who do not respond to targeted therapies have an Urbano-Ispizua Á, Juan M and unfavourable prognosis, particularly if tumor cells harbour high-risk genomic aberrations (e.g. TP53 Delgado J (2022) Results of ARI-0001 aberrations or complex karyotype) or the disease has transformed into diffuse large B-cell lymphoma CART19 Cells in Patients With Chronic Lymphocytic Leukemia (DLBCL), also known as Richter’s transformation (RT) (1). Current guidelines recommend allogeneic and Richter’s Transformation. hematopoietic cell transplantation (alloHCT) for patients with high-risk CLL or RT (1–3). Chimeric Front. Oncol. 12:828471. antigen receptor T-cells targeting CD19 (CART19) are also emerging as alternative options for these doi: 10.3389/fonc.2022.828471 patients, even though there are currently no approved products for them. Frontiers in Oncology | www.frontiersin.org 1 January 2022 | Volume 12 | Article 828471 Ortiz-Maldonado et al. ARI-0001 Cells for CLL/RT At Hospital Clinic of Barcelona, we have developed our own Measurement of ARI-0001 Cells and CART19 product (A3B1:CD8:41BB : CD3z or ARI-0001), which CAR19 Transgene has been recently approved by the Spanish Medicines Agency ARI-0001 cells presence was evaluated by flow cytometry with an (AEMPS) for the treatment of patients with relapsed/refractory APC-conjugated AffiniPureF(ab’)2-fragment goat-anti-mouse IgG acute lymphoblastic leukemia (ALL) older than 25 years of age (4). monoclonal antibody (goat-anti-mouse IgG, Jackson The aim of this paper is to report the outcome of all ImmunoResearch Laboratories). Moreover, a quantitative PCR consecutive patients with CLL treated with ARI-0001 cells, assay was optimized and validated for monitoring ARI-0001 cell either within the CART19-BE-01 trial or a subsequent expansion and persistence. The number of transgene copies/cell was compassionate use program (CUP). determined by quantitative real-time PCR, using Light Cycler® 480 SYBRGreen® I Master (Roche, Cat. N. 04707516001). Pairs of primers were designed against the GATA2 gene (control) and METHODS WPRE sequence (part of the transgene). Primer sequences are as follows: GATA2_F: 5’tggcgcacaactacatggaa 3’; GATA2_R: Patient Eligibility and Clinical Trial Design 5’cgagtcgaggtgattgaagaaga 3’; WPRE_F: 5’gtcctttccatggctgctc 3’; ARI-0001 cells are autologous T-cells transduced with a CD137- WPRE_R: 5’ccgaagggacgtagcaga 3’. The absolute quantification based second generation CAR construct designed to target CD19 method was used to determine copy number. Standard curves were (5). Full details of the ARI-0001 cell development, including its prepared using 1:10 serial dilutions of plasmids containing GATA2 or structure and phenotypic characteristics can be found elsewhere transgene. The final number of molecules in the reaction ranged from (5, 6). Two patients presented here were recruited into the 102 to 108 molecules. For GATA2 quantification, GATA2 cDNA was CART19-BE-01 study (registered as NCT03144583) (7), and cloned in a pCRII-Topo vector (Invitrogen). pCCL-CAR19 vector the remaining patients were included in a CUP with the same was used in the same way to quantify transgene copy number. The inclusion criteria: (i) CD19-positive B-cell malignancy (including following PCR program was used: 1) Initial denaturalization: 95°C, DLBCL or CLL); (ii) age from 2 to 80 years; (iii) ECOG 5’; 2) 40 cycles of: 95°C, 10’’; 58°C, 10’’; 72°C, 5’’; 3) melting curve. performance status 0-2; (iv) estimated life expectancy from 3 months to 2 years; and (v) adequate venous access (7). Patients Endpoints and Statistical Analysis with CLL were eligible if they had received a minimum of 2 lines The primary endpoint of the CART19-BE-01 trial was safety as of therapy, including rituximab, and experienced disease determined by procedure-related mortality (PRM) and grade 3-4 progression within 2 years of last therapy. Key exclusion toxicity at day +100 and one year. Adverse events of special interest criteria included history of other malignancy unless it had been were cytokine release syndrome (CRS), neurotoxicity [currently in remission for more than 3 years; severe renal, hepatic, known as immune effector-cell associated neurotoxicity syndrome pulmonary or cardiac impairment; active immunosuppressive (ICANS)] and second primary malignancies. Adverse events were therapy; HIV infection; active HBV or HCV infection; and active graded according to common terminology criteria (CTC), version infection requiring systemic therapy. Of note, neither central 4.0. CRS was originally graded as per Lee et al. (8), but was later nervous system involvement nor prior alloHCT were exclusion retrospectively reassessed using ASTCT criteria (9). criteria for this trial. Secondary endpoints were objective response rate (ORR) and Whenever feasible, patients with CLL/RT were asked to take complete response rate (CRR) at day +28 and +100, duration of ibrutinib, at the approved dose or less in case of intolerance, for a response (DOR), duration of B-cell aplasia (DBCA), progression-free minimum of two weeks until leukocytapheresis. Before ARI-0001 survival (PFS) and overall survival (OS). ORR/CRR were assessed as cell infusion, patients received fludarabine at 30 mg/m2/day plus per iwCLL (10) and Lugano (11) criteria as appropriate. Measurable cyclophosphamide at 300 mg/m2/day on days −6, −5, and −4 residual disease (MRD) was determined in peripheral blood and bone followed by ARI-0001 cells. The first patient received a single marrow by flow cytometry, with a sensitivity of 10-4. intravenous infusion of ARI-0001 cells, at a dose of 1 ×106 cells/ Adverse events and response rates are presented with 95% kg, on day 0. The remaining patients received a fractionated exact Clopper-Pearson confidence intervals. OS, PFS, DOR and target dose of 1 ×106 cells/kg (patients with CLL only) or 5 ×106 DBCA, were plotted using the Kaplan-Meier method. Due to the cells/kg (patients with RT). The first fraction (10%) of ARI-0001 open-label non-randomized nature of the study, the statistical cells was administered on day 0, followed by the second (30%) analysis was descriptive and no formal comparisons between and third (60%) fraction 24-48 hours after the first and second cohorts are provided. Statistical analyses were performed using fraction, respectively, if the patient had no signs or symptoms of SAS version 9.4 (SAS Institute, Cary, NC) and R (R Foundation for cytokine release syndrome (CRS). The implementation of the Statistical Computing, Vienna, Austria). The trial (EUDRA n° fractionated administration of ARI-0001 cells was motivated by 2016-2972-29) was registered at clinicaltrials.gov (NCT03144583). 3 toxic deaths, all in patients with ALL (7). Intravenous immunoglobulin (Ig) replacement was recommended in case of IgG determinations lower than 4 g/L. RESULTS All patients provided written, informed consent. The AEMPS and our Institutional Review Board approved the trial, which was We report the outcome of nine consecutive patients with CLL conducted in accordance with the principles of the Declaration of treated with ARI-0001 cells, six of them with concomitant RT Helsinki (last updated version, Fortaleza, Brazil, 2013). (Table 1). In patients with RT, tumor histology was consistent Frontiers in Oncology | www.frontiersin.org 2 January 2022 | Volume 12 | Article 828471 Ortiz-Maldonado et al. ARI-0001 Cells for CLL/RT adriamycin, vincristine and prednisone; R-ESHAP, rituximab, etoposide, cytarabine, cisplatin and methyl-prednisolone; RIE, rituximab, etoposide and ifosfamide; Chl, chlorambucil; CHOP, cyclophosphamide, adriamycin, vincristine and *This patient was diagnosed with both chronic lymphocytic leukemia and B-cell prolymphocytic leukemia (B-PLL). Richter’s transformation (in the form of plasmablastic lymphoma) occurred in the B-PLL clone. Blood and marrow evaluation prednisone; R-HyperCVAD, rituximab, cyclophosphamide, adriamycin, vincristine and dexamethasone; alloHCT, allogeneic hematopoietic cell transplantation; IGHV, immunoglobulin heavy chain gene variable region; U, unmutated; M, mutated; NA, not available; CK, complex karyotype; IPI, international prognostic index (referred to the diffuse large B-cell lymphoma); L, low risk; HI, high-intermediate risk; H, high risk; CRS, cytokine release syndrome; ICANS, immune effector- Pt, patient; F, female; M, male; FCR, fludarabine, cyclophosphamide and rituximab; BR, bendamustine and rituximab; I, ibrutinib; V, venetoclax; O, obinutuzumab; IdR, idelalisib and rituximab; R-CHOP, rituximab, cyclophosphamide, with DLBCL in patients 2-5 and 8, and plasmablastic lymphoma Died while awaiting infusion (delayed due to COVID-19 in patient 6. The median age was 58 (range: 47-74) years, with a male/female ratio of 56/44%. All patients had high-risk progressive disease (2, 3), with a median number of prior therapies of 4 (range: 3-6) and significant lymphadenopathy in all patients except one (89%). Prior therapy included ibrutinib TABLE 1 | Patients’ baseline characteristics, toxicity and outcome of patients with CLL, with or without RT, who were included in the ARI-0001 program (CART19-BE-01 trial or compassionate use). Alive and disease-free (12.5+ months) and venetoclax in 8/9 (89%) and 5/9 (56%) patients, Outcome Alive and disease-free (45.4+ mo) Alive and disease-free (26.7+ mo) Alive and disease-free (4.2+ mo) Alive and disease-free (1.4+ mo) Alive and disease-free (1.2+ mo) Died of CD19- relapse (7.0 mo) respectively (Table 1). Died of CD19- relapse (3.7 mo) Besides patient 3, who was due cell infusion in April 2020 and never received it owing to the temporary suspension of our program caused by COVID-19, the remaining eight patients received ARI-0001 cells after lymphodepletion (7). The median vein-to-vein time was 27 (range: 22-81) days. The target dose was pandemic) 1 x106 and 5 x106 ARI-0001 cells/kg for patients with CLL and CLL/RT, respectively (7), but two patients with CLL/RT only received 10-40% (0.4-0.5 x106 cells/kg), as per protocol, due to cytokine release syndrome (CRS) requiring treatment with Response (iwCLL) tocilizumab (7). CR CR CR CR SD PR PR PR – There was no procedure-related mortality in this cohort. The CRS rate was 87.5% (95% confidence interval [CI]: 47-99%), with a grade ≥3 CRS rate of 12.5% (95% CI: 0.3-53%). Three patients required tocilizumab, and none required corticosteroids. The ICANS grade only patient who developed grade 3 CRS was one of the patients 0 0 0 0 0 0 0 0 – who did not receive the full dose, as per protocol. ICANS was not observed, whilst grade 4 neutropenia was documented in 7/8 (87.5%) patients for a median of 11 (range: 6-40) days. Grade 4 grade CRS 1 1 2 0 1 3 1 1 – thrombocytopenia was observed in 3/8 (37.5%) patients. Four patients suffered from grade ≥3 infections: two episodes of gastroenteritis by Campylobacter coli and Campylobacter jejuni Dose infused (x106/kg) and two occurrences of urinary tract infection by Escherichia coli 0.5 0.5 0.4 1 5 5 1 1 – and Klebsiella pneumoniae. All infused patients experienced absolute B-cell aplasia (BCA), whose median duration had not been reached (75% IPI HI HI HI [95% CI: 50-100%] at 1 year, Figure 1A). Four (50%) patients H H L – – – had IgG determinations below 3 g/L (two of them already at 13q-, 17p- and TP53 mutation screening), and five (56%) have required frequent Ig t(8;22), MYC rearrangement Genomic aberrations 13q-, 11q-, CK and TP53 17p-, NOTCH1 and TP53 cell associated neurotoxicity syndrome; CR, complete response; PR, partial response. replacement. All patients had CD4+ T-cell counts below 200/ 13q-, 11q-, 17p-, CK µL, which recovered (>200/µL) at a median of 1.98 months after the ARI-0001 cell infusion (Figure 1B). ARI-0001 cell expansion, 13q-, 17p-, CK TP53 mutation 17p-, t(11;21) as measured by quantitative PCR, is displayed in Figure 2. mutations Seven (87.5%; 95% CI: 47-99%) patients responded according mutation to iwCLL/Lugano criteria (CR, n = 4; PR, n = 3) (10), while one 13q- patient with RT remained with stable disease. Measurable- documented a MRD-negative CR for both CLL and B-PLL. IGHV residual disease (MRD) was undetectable in the peripheral NA NA NA NA M U U U U Patients with concomitant RT are highlighted in grey. blood and bone marrow of all patients. With a median follow- up of 5.6 (range, 1.2-45.3) months, two patients with RT R-HyperCVAD, R-CHOP, I, R-CHOP, R-ESHAP, RIE experienced a CD19-negative relapse in the lymph nodes 2.1 BR, R-CHOP, I, IdR, V Prior therapy FCR, BR, I, V, IdR, O and 3.0 months after cell infusion (Figure 3). The 2-year OS was FCR, I, V, alloHCT Chl, BR, I, CHOP 62.5% (95% CI: 32-100%) from ARI-0001 cell infusion and 51.4% (95% CI: 24-100%) from inclusion in the program (this FCR (x2), I last figure includes all nine patients) (Figures 1C, D). FCR, I, V I, IdR, V Pt Sex Age 53 57 51 72 74 64 65 47 58 DISCUSSION M M M M M F F F F Our results were comparable to other clinical trials and small series of patients with CLL/RT treated with similar CART19 6* 1 2 3 4 5 7 8 9 Frontiers in Oncology | www.frontiersin.org 3 January 2022 | Volume 12 | Article 828471 Ortiz-Maldonado et al. ARI-0001 Cells for CLL/RT A B C D FIGURE 1 | Duration of B-cell aplasia (A) and CD4+ cell counts below 200/µL (B) in patients who received ARI-0001 cell therapy. Overall survival from cell infusion (C) or signature of the informed consent (D). Panels (A–C) only include patients who received therapy, while panel (D) include all patients included in the program (intention-to-treat). were included but their specific clinical outcome was not reported (20). Since ibrutinib improves preclinical CART19 efficacy (21, 22), a number of clinical trials are evaluating the concomitant use of ibrutinib and CART19 cells in patients with CLL (13, 23, 24). In our experience, ARI-0001 cells could be manufactured for all patients and infused in 89% of them. A very unfortunate patient died before cell infusion, not because of excessive manufacturing time but because of the COVID-19 pandemic. Robust in vivo ARI-0001 cell expansion and persistent absolute B-cell aplasia was observed in most patients (Figures 1, 2), this leading to undetectable MRD in the peripheral blood and bone marrow of all patients treated, even in those achieving a PR or stable disease in the lymph nodes. Unfortunately, two patients with RT have relapsed with CD19-negative disease despite no prior anti-CD19 therapy. This suggests that, perhaps, ARI-0001 cell therapy works better before RT occurs. However, we would still FIGURE 2 | ARI-0001 expansion over time, calculated by quantitative PCR, recommend ARI-0001 cell therapy for patients with RT since in patients with CLL/RT. Lines represent median values. 3/5 patients remain in CR 1.4, 12.5 and 26.7 months after therapy. products (12, 13), which have revealed ORRs around 38-82%, In terms of toxicity, the fractionated administration of ARI- with CRRs around 20-45% (14–17). Of note, patients with RT 0001 cells appeared safe, with no cases of procedure-related were excluded from two pivotal trials performed in patients mortality. The grade ≥3 CRS rate was 12.5% and there were no with DLBCL (18, 19) and, in a third trial, five patients with RT occurrences of ICANS. Despite the prolonged absolute B-cell Frontiers in Oncology | www.frontiersin.org 4 January 2022 | Volume 12 | Article 828471 Ortiz-Maldonado et al. ARI-0001 Cells for CLL/RT FIGURE 3 | Lymph node morphology and phenotype observed in patients 5 and 6 at both study inclusion and relapse after treatment with ibrutinib-primed ARI- 0001 cells. In both cases, CD19 expression was lost upon relapse. aplasia and frequent grade 4 neutropenia, the incidence of severe AUTHOR CONTRIBUTIONS infections was not greater compared to similar trials (13, 15–17), and the brief exposition to ibrutinib had a minor impact JD, MJ, Á U-I, and JE designed the clinical trial. ME-R, MP, DB-R, on toxicity. and MJ were responsible for ARI-0001 cell production and In conclusion, our results suggest that the administration of monitoring after infusion. VO-M, NM-C, LM, EG, JC, AM-R, ARI-0001 cells is feasible, safe, and effective in patients with AL-G, and JD looked after the patients during the study. GF, OB high-risk CLL or RT. The role of concomitant ibrutinib therapy and EC were responsible for pathological evaluation of lymph is still debated, but we hope that ongoing and future clinical trials node biopsies. JC and ML were responsible for leukocytoapheresis. will help us answer this question. NV was responsible for immunophenotypic evaluation of peripheral blood and bone marrow samples. JD was responsible for the statistical analysis. VO-M and JD wrote the manuscript, which was approved by all authors. All authors contributed to the DATA AVAILABILITY STATEMENT article and approved the submitted version. The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation. ACKNOWLEDGMENTS The authors would like to thank the patients who participated in ETHICS STATEMENT the study and their families, friends, caregivers and referring physicians. The authors are very grateful to Drs. Miguel Á ngel The studies involving human participants were reviewed and Perales (Memorial Sloan Kettering Cancer Center, New York), approved by the Hospital Clı́nic de Barcelona. The patients/ Shannon Maude (Children’s Hospital of Philadelphia), Juan José participants provided their written informed consent to Lasarte (Centro de Investigació n Mé dica Aplicada, Navarra) and participate in this study. Michael Schmitt (Universitäts Klinikum Heidelberg), members Frontiers in Oncology | www.frontiersin.org 5 January 2022 | Volume 12 | Article 828471 Ortiz-Maldonado et al. ARI-0001 Cells for CLL/RT of the CART19-BE-01 trial DSMB. The authors are also indebted Antoni Castells, Aurea Mira and Marc Roda as the main to the study staff and health care providers at Hospital Clı́nic, representatives from the institution. specifically to Anna Boronat, Raquel Martı́n-Ibá ñez, Unai This study was funded by CatSalut, Projecte ARI and grants co- Perpiñá , Josep M. Canals, Vanina Rodrı́guez, Guillermo Suñé , financed by the Instituto de Salud Carlos III–Subdirecció n Esteve Trias and Jordi Yagüe who participated in the General de Evaluació n y Fomento de la Investigació n development of the CART19 construct; Sara Varea, Judit Pich, Sanitaria–and Fondo Europeo de Desarrollo Regional (FEDER) Gabriela Recalde, Leticia Pereira and Joan Albert Arná iz, from PICI14/122, PI13/676, PIE13/33, PI18/775; and Fundació La the Clinical Trials Unit; Gonzalo Calvo, Andrea Scalise, Joaquı́n Caixa CP042702/LCF/PR/GN18/50310007. VO-M and JD were Sá ez-Peñataro, Ferran Torres and Sandra Castaño, from the recipients of research grants from FEHH and Generalitat de Department of Pharmacology; and Josep Maria Campistol, Catalunya (PERIS IPFE SLT006/17/301), respectively. CLL After Ibrutinib Failure. Blood (2020) 135(19):1650–60. doi: 10.1182/ REFERENCES blood.2019002936 1. Kipps TJ, Stevenson FK, Wu CJ, Croce CM, Packham G, Wierda WG, et al. 14. Porter DL, Hwang W-T, Frey NV, Lacey SF, Shaw PA, Loren AW, et al. Chronic Lymphocytic Leukaemia. Nat Rev Dis Primers (2017) 3:16096. doi: Chimeric Antigen Receptor T Cells Persist and Induce Sustained Remissions 10.1038/nrdp.2017.8 in Relapsed Refractory Chronic Lymphocytic Leukemia. Sci Transl Med 2. Dreger P, Ghia P, Schetelig J, van Gelder M, Kimby E, Michallet M, et al. (2015) 7(303):303ra139. doi: 10.1126/scitranslmed.aac5415 High-Risk Chronic Lymphocytic Leukemia in the Era of Pathway Inhibitors: 15. Frey NV, Gill S, Hexner EO, Schuster S, Nasta S, Loren A, et al. Long-Term Integrating Molecular and Cellular Therapies. Blood (2018) 132(9):892–902. Outcomes From a Randomized Dose Optimization Study of Chimeric doi: 10.1182/blood-2018-01-826008 Antigen Receptor Modified T Cells in Relapsed Chronic Lymphocytic 3. Kharfan-Dabaja MA, Kumar A, Hamadani M, Stilgenbauer S, Ghia P, Leukemia. J Clin Oncol (2020) 38(25):2862–71. doi: 10.1200/JCO.19.03237 Anasetti C, et al. Clinical Practice Recommendations for Use of Allogeneic 16. Geyer MB, Rivière I, Sé né chal B, Wang X, Wang Y, Purdon TJ, et al. Safety Hematopoietic Cell Transplantation in Chronic Lymphocytic Leukemia on and Tolerability of Conditioning Chemotherapy Followed by CD19-Targeted Behalf of the Guidelines Committee of the American Society for Blood and CAR T Cells for Relapsed/Refractory CLL. JCI Insight (2019) 5(9):e122627. Marrow Transplantation. Biol Blood Marrow Transplant (2016) 22(12):2117– doi: 10.1172/jci.insight.122627 25. doi: 10.1016/j.bbmt.2016.09.013 17. Siddiqi T, Soumerai JD, Dorritie KA, Stephens DM, Riedell PA, Arnason JE, 4. Juan M, Delgado J, Calvo G, Trias E, Urbano-Ispizua A. Is Hospital et al. Phase 1 TRANSCEND CLL 004 Study of Lisocabtagene Maraleucel in Exemption an Alternative or a Bridge to European Medicines Agency for Patients With Relapsed/Refractory CLL or SLL. Blood (2021) Developing Academic Chimeric Antigen Receptor T-Cell in Europe? Our blood.2021011895. doi: 10.1182/blood.2021011895 Experience With ARI-0001. Hum Gene Ther (2021) 32(19–20):1004–7. doi: 18. Neelapu SS, Locke FL, Bartlett NL, Lekakis LJ, Miklos DB, Jacobson CA, et al. 10.1089/hum.2021.168 Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell 5. Castella M, Boronat A, Martı́n-Ibá ñez R, Rodríguez V, Suñé G, Caballero M, et al. Lymphoma. N Engl J Med (2017) 377(26):2531–44. doi: 10.1056/ Development of a Novel Anti-CD19 Chimeric Antigen Receptor: A Paradigm for NEJMoa1707447 an Affordable CAR T Cell Production at Academic Institutions. Mol Ther 19. Schuster SJ, Bishop MR, Tam CS, Waller EK, Borchmann P, McGuirk JP, Methods Clin Dev (2019) 12:134–44. doi: 10.1016/j.omtm.2018.11.010 et al. Tisagenlecleucel in Adult Relapsed or Refractory Diffuse Large B-Cell 6. Castella M, Caballero-Baños M, Ortiz-Maldonado V, Gonzá lez-Navarro EA, Lymphoma. N Engl J Med (2019) 380(1):45–56. doi: 10.1056/ Suñé G, Antoñana A, et al. Point-Of-Care CAR T-Cell Production (ARI- NEJMoa1804980 0001) Using a Closed Semi-Automatic Bioreactor: Experience From an 20. Abramson JS, Palomba ML, Gordon LI, Lunning MA, Wang M, Arnason J, Academic Phase I Clinical Trial. Front Immunol (2020) 11:482. doi: et al. Lisocabtagene Maraleucel for Patients With Relapsed or Refractory Large 10.3389/fimmu.2020.00482 B-Cell Lymphomas (TRANSCEND NHL 001): A Multicentre Seamless 7. Ortı́z-Maldonado V, Rives S, Castellà M, Alonso-Saladrigues A, Benı́tez-Ribas Design Study. Lancet (2020) 396(10254):839–52. doi: 10.1016/S0140-6736 D, Caballero-Baños M, et al. CART19-BE-01: A Multicenter Trial of ARI- (20)31366-0 0001 Cell Therapy in Patients With CD19+ Relapsed/Refractory 21. Fraietta JA, Beckwith KA, Patel PR, Ruella M, Zheng Z, Barrett DM, et al. Malignancies. Mol Ther (2021) 29(2):636–44. doi: 10.1016/j.ymthe.2020. Ibrutinib Enhances Chimeric Antigen Receptor T-Cell Engraftment and 09.027 Efficacy in Leukemia. Blood (2016) 127(9):1117–27. doi: 10.1182/blood- 8. Lee DW, Gardner R, Porter DL, Louis CU, Ahmed N, Jensen M, et al. Current 2015-11-679134 Concepts in the Diagnosis and Management of Cytokine Release Syndrome. 22. Fan F, Yoo HJ, Stock S, Wang L, Liu Y, Schubert ML, et al. Ibrutinib for Blood (2014) 124(2):188–95. doi: 10.1182/blood-2014-05-552729 Improved Chimeric Antigen Receptor T-Cell Production for Chronic 9. Lee DW, Santomasso BD, Locke FL, Ghobadi A, Turtle CJ, Brudno JN, et al. Lymphocytic Leukemia Patients. Int J Cancer (2021) 148(2):419–28. doi: ASTCT Consensus Grading for Cytokine Release Syndrome and Neurologic 10.1002/ijc.33212 Toxicity Associated With Immune Effector Cells. Biol Blood Marrow 23. Wierda WG, Dorritie KA, Munoz J, Stephens DM, Solomon SR, Gillenwater Transplant (2019) 25(4):625–38. doi: 10.1016/j.bbmt.2018.12.758 HH, et al. TRANSCEND CLL 004: Phase 1 Cohort of Lisocabtagene 10. Hallek M, Cheson BD, Catovsky D, Caligaris-Cappio F, Dighiero G, Döhner Maraleucel (Liso-Cel) in Combination With Ibrutinib for Patients With H, et al. iwCLL Guidelines for Diagnosis, Indications for Treatment, Response Relapsed/Refractory Chronic Lymphocytic Leukemia/Small Lymphocytic Assessment, and Supportive Management of CLL. Blood (2018) 131 Lymphoma. Blood (2020) 136(Supplement 1):39–40. doi: 10.1182/blood- (25):2745–60. doi: 10.1182/blood-2017-09-806398 2020-140622 11. Cheson BD, Fisher RI, Barrington SF, Cavalli F, Schwartz LH, Zucca E, et al. 24. Gill SI, Vides V, Frey NV, Metzger S, O'Brien M, Hexner E, et al. Prospective Recommendations for Initial Evaluation, Staging, and Response Assessment Clinical Trial of Anti-CD19 CAR T Cells in Combination With Ibrutinib for of Hodgkin and Non-Hodgkin Lymphoma: The Lugano Classification. J Clin the Treatment of Chronic Lymphocytic Leukemia Shows a High Response Oncol (2014) 32(27):3059–67. doi: 10.1200/JCO.2013.54.8800 Rate. Blood (2018) 132(Supplement 1):298. doi: 10.1182/blood-2018-99- 12. Kittai AS, Bond DA, William B, Saad A, Penza S, Efebera Y, et al. Clinical 115418 Activity of Axicabtagene Ciloleucel in Adult Patients With Richter Syndrome. Blood Adv (2020) 4(19):4648–52. doi: 10.1182/bloodadvances.2020002783 Conflict of Interest: VO-M: Consultant or advisory role (Kite Gilead, Celgene, 13. Gauthier J, Hirayama AV, Purushe J, Hay KA, Lymp J, Li DH, et al. Feasibility Novartis), travel grants (Kite Gilead, Celgene, Novartis, Roche, Takeda, Janssen), and Efficacy of CD19-Targeted CAR T Cells With Concurrent Ibrutinib for honoraria (Kite Gilead). EG: Consultant or advisory role (Kite Gilead, Janssen, Frontiers in Oncology | www.frontiersin.org 6 January 2022 | Volume 12 | Article 828471 Ortiz-Maldonado et al. ARI-0001 Cells for CLL/RT Genmab), research funding (Kite Gilead, Janssen, Roche). AM-R: Consultant or Publisher’s Note: All claims expressed in this article are solely those of the authors advisory role (Bristol Myers Squibb, Abbvie), travel grants (Kite Gilead, Roche, and do not necessarily represent those of their affiliated organizations, or those of Takeda, Janssen, Abbvie), honoraria (Abbvie). ML: Honoraria (Grifols, Fresenius the publisher, the editors and the reviewers. Any product that may be evaluated in Kabi), research funding (Terumo BCT, Maco-Pharma). JE: Consultant or advisory this article, or claim that may be made by its manufacturer, is not guaranteed or role (Abbvie, Novartis, Celgene, Astellas, Jazz, Daiichi Dankyo, Roche, Amgen, endorsed by the publisher. Pfizer), travel grants (Celgene, Roche, Astellas, Daiichi Dankyo), research funding (Novartis, Celgene). AL-G: Consultant or advisory role (Roche, Kite Gilead, Copyright © 2022 Ortiz-Maldonado, Frigola, Español-Rego, Balague,́ Martınez- ́ Celgene/Bristol-Myers, Incyte), honoraria (Roche, Novartis, Takeda, Bayer, Cibriań , Magnano, Gine,́ Pascal, Correa, Martınez-Roca, ́ Cid, Lozano, Villamor, Sandoz, Kern), research grants (Roche, Kite Gilead, Celgene/Bristol-Myers, ́ ́ Benıtez-Ribas, Esteve, Loṕ ez-Guillermo, Campo, Urbano-Ispizua, Juan and Delgado. Novartis, Incyte, Janssen, Pfizer, Takeda). AU-I: Consultant or advisory role This is an open-access article distributed under the terms of the Creative Commons (Kite Gilead, Celgene, Miltenyi), travel grants (Kite Gilead, Celgene). MJ: Attribution License (CC BY). The use, distribution or reproduction in other forums is Consultant or advisory role (Kite Gilead, Grifols), honoraria (Kite Gilead, Grifols). permitted, provided the original author(s) and the copyright owner(s) are credited and The remaining authors declare that the research was conducted in the absence of that the original publication in this journal is cited, in accordance with accepted any commercial or financial relationships that could be construed as a potential academic practice. No use, distribution or reproduction is permitted which does not conflict of interest. comply with these terms. Frontiers in Oncology | www.frontiersin.org 7 January 2022 | Volume 12 | Article 828471