Ovothiol ensures the correct developmental programme of the sea royalsocietypublishing.org/journal/rsob urchin Paracentrotus lividus embryo Alfonsina Milito1,2, Maria Cocurullo1, Alfredo Columbro1, Simona Nonnis3,4, Gabriella Tedeschi3,4, Immacolata Castellano1,5, Maria Ina Arnone1 and Research Anna Palumbo1 1 Department of Biology and Evolution of Marine Organisms, Stazione Zoologica Anton Dohrn, Naples, Italy Cite this article: Milito A, Cocurullo M, 2 Department of Molecular Genetics, Centre for Research in Agricultural Genomics, Barcelona, Spain Columbro A, Nonnis S, Tedeschi G, Castellano I, 3 Department of Veterinary Medicine (DIMEVET), and 4CRC ‘Innovation for Well-Being and Environment’ (I-WE), Arnone MI, Palumbo A. 2022 Ovothiol ensures Università degli Studi di Milano, Milan, Italy 5 Department of Molecular Medicine and Medical Biotechnology, University of Naples Federico II, Naples, Italy the correct developmental programme of the Downloaded from https://royalsocietypublishing.org/ on 04 May 2023 sea urchin Paracentrotus lividus embryo. Open AM, 0000-0002-5541-6113; MC, 0000-0002-7729-3281; AC, 0000-0002-0303-1115; SN, 0000-0002-3453-7282; IC, 0000-0002-4274-6738; MIA, 0000-0002-9012-7624; Biol. 12: 210262. AP, 0000-0002-5972-5589 https://doi.org/10.1098/rsob.210262 Ovothiols are π-methyl-5-thiohistidines produced in great amounts in sea urchin eggs, where they can act as protective agents against the oxidative burst at fertilization and environmental stressors during development. Received: 6 September 2021 Here we examined the biological relevance of ovothiol during the embryo- Accepted: 30 November 2021 genesis of the sea urchin Paracentrotus lividus by assessing the localization of the key biosynthetic enzyme OvoA, both at transcript and protein level, and perturbing its protein translation by morpholino antisense oligonucleotide-mediated knockdown experiments. In addition, we explored the possible involvement of ovothiol in the inflammatory response by asses- Subject Area: sing ovoA gene expression and protein localization following exposure to biochemistry/cellular biology/developmental bacterial lipopolysaccharide. The results of the present study suggest that biology ovothiol may be a key regulator of cell proliferation in early developing embryos. Moreover, the localization of OvoA in key larval cells and tissues, Keywords: in control and inflammatory conditions, suggests that ovothiol may ensure ovothiol, oxidative stress, cell proliferation, larval skeleton formation and mediate inflammatory processes triggered by bacterial infection. This work significantly contributes to the understand- sea urchin, embryonic development, marine ing of the biological function of ovothiols in marine organisms, and may organisms provide new inspiration for the identification of the biological activities of ovothiols in humans, considering the pharmacological potential of these molecules. Author for correspondence: Anna Palumbo e-mail: anna.palumbo@szn.it 1. Introduction Embryonic development represents an extremely sensitive and delicate stage of life for all living organisms, especially for those with external fertilization, such as sea urchins. Indeed, in the marine ecosystem, sea urchin adults and embryos are constantly exposed to a variety of environmental pressures, includ- ing both intrinsic and extrinsic/anthropogenic factors causing oxidative and nitrosative stress [1–7]. Nevertheless, they have acquired the ability, to some extent, to maintain homeostasis in an adverse environment, through the evol- ution of a ‘chemical defensome’, an integrated network of gene families and pathways, involved in the protection and repair from damage [8]. Moreover, since embryos lack specific tissues and organs for defence, all cells possess pro- tective and antioxidant systems, and the dysregulation of such mechanisms can Electronic supplementary material is available alter development, causing teratogenesis and lethality. Among the key biologi- online at https://doi.org/10.6084/m9.figshare. cal processes underpinning embryonic development is programmed cell death c.5752461. © 2022 The Authors. Published by the Royal Society under the terms of the Creative Commons Attribution License http://creativecommons.org/licenses/by/4.0/, which permits unrestricted use, provided the original author and source are credited. (PCD). Apoptosis in particular represents a crucial mechan- injection of specifically designed morpholino antisense oligo- 2 ism of PCD, essential for the development and re- nucleotides (MASO). The embryo phenotype caused by royalsocietypublishing.org/journal/rsob modelling of cell and organ structures in all living organ- MASO-induced downregulation of ovoA translation was isms, including sea urchins [9]. To support early analysed by biochemical assays and confocal imaging. development, eggs accumulate, during oogenesis, some Finally, to investigate a possible role in the defence mechan- antioxidant natural molecules, like tocopherols, ascorbic isms of the larva, we exposed sea urchin plutei to a acid, carotenoids, glutathione and ovothiol [10–15]. microbial lipopolysaccharide (LPS) mimicking bacterial infec- Ovothiols in particular are π-methyl-5-thiohistidines, tion and analysed effects on ovoA gene expression and OvoA which are present in great amounts, compared to other intra- enzyme immunolocalization. This is the first functional study cellular thiols such as glutathione, in the eggs of sea urchins assessing the localization of OvoA during the embryogenesis and other marine invertebrates [14,15]. They are also pro- of an ovothiol-producing organism and the phenotype duced by some protists and proteobacteria, and their induced by OvoA downregulation. chemical structure confers them unique redox properties [16,17]. Since their discovery in the early 1980s, studies Open Biol. 12: 210262 addressing the biological role of these molecules have been still limited. Recently, ovothiols have been reported to protect 2. Material and methods marine organisms, such as sea urchins, anemones, fish and 2.1. Sea urchin sampling mussels, from environmental stressors [18–21]. Moreover, Downloaded from https://royalsocietypublishing.org/ on 04 May 2023 they have been proposed to protect pathogenic parasites Paracentrotus lividus (Lamarck, 1816) sea urchins were col- from macrophage-triggered oxidative stress during host lected during the breeding season by scuba divers in the infection [22], and microalgae from light-induced stress Gulf of Naples from a location not privately owned nor pro- [23,24]. However, the role of these molecules does not seem tected in any way. to be restricted to a protective function. For example, they can act as mating pheromones in marine polychaetes, indu- cing egg release during sexual reproduction [25,26], and 2.2. Embryo culturing and treatments they are employed as a hunting strategy by cone snails, Sea urchins were transported in an insulated box to the lab- whose venom contains an ovothiol-derived structure (cona- oratory within 1 h after collection, kept in tanks with zolium), used to mimic the natural pheromones of their circulating seawater at a density of one animal per 5 litres preys (i.e. polychaetes) [27]. and fed every 3 days with fresh macroalgae (Ulva sp.). The In sea urchins, ovothiols have been reported to control the animals were acclimated for a minimum of 10 days before H2O2 toxicity in the oocytes during the oxidative burst at the experiments, during which very rare spontaneous spawn- fertilization [28] and to protect developing embryos from ing or mortalities were observed. Gamete spawning was environmental cues, such as heavy metals and marine induced by the injection of a 0.5 M KCl solution through toxins [18]. Indeed, being broadcast spawners, sea urchins the peribuccal membrane of the animals. Concentrated release gametes in the seawater column, where, upon egg– sperm was collected dry from at least three different males, sperm interaction and fertilization, the developing embryos mixed and kept undiluted at 4°C until use. Eggs from indi- enter the plankton community and may cope with several vidual females were washed three times with 0.22 µm stressful agents. These can induce the formation of reactive filtered seawater (FSW) and fertilized at a density of 150 eggs oxygen species (ROS), finally triggering the expression of ml−1 with a few drops of diluted sperm (1 : 1000). Fertiliza- the gene encoding the key enzyme involved in ovothiol bio- tion success was approximately 90%. For in situ synthesis, the 5-histidylcysteine sulfoxide synthase OvoA, hybridization and IHC experiments on pre-hatching develop- and the consequent production of ovothiol molecules, mental stages, eggs were fertilized in the presence of para- which may contribute to the stress defence of the embryo aminobenzoic acid (1 mmol l−1) to prevent hardening of the [18]. Despite the increasing interest around these molecules, fertilization membrane, then removed by passing the ferti- including their pleiotropic activities in humans [29–35] and lized eggs through a 70 µm mesh filter. Embryos were the peculiar evolutionary history and widespread distri- allowed to develop at 18 ± 2°C in a controlled temperature bution of the biosynthetic enzymes [36,37], no functional chamber at a 12 : 12 light : dark photoperiod cycle. All the studies have been performed so far to address the biological experiments were performed at least in triplicate. For LPS role of ovothiol. treatments, sea urchin embryos were reared in 6-well plates Our hypothesis is that the extremely high abundance of (about 400 embryos per well), each well was filled with a ovothiols in the eggs and early embryos may underline a total of 4 ml of FSW. We performed two biological replicates. key function of these molecules to ensure fertilization and Gametes from two females (F) and two males (M) were ferti- correct development. Here we carried out a comprehensive lized as follows: F1 × M1, F2 × M2. After checking that both study addressing the biological relevance of ovothiol biosyn- cultures were properly dividing, they were mixed to obtain thesis during the embryonic development of the sea urchin a mixed batch in order to increase genotypic diversity of off- Paracentrotus lividus. To this end, we assessed the spatial spring. Pluteus larvae at 48 h post fertilization (hpf ) were expression of OvoA at different developmental stages, from treated with FSW (untreated controls), or 10 µg ml−1, unfertilized eggs to plutei larvae, at both transcript and 50 µg ml−1 or 100 µg ml−1 of LPS (O55:B5, Sigma). Stock LPS protein levels, by in situ hybridization and immunohisto- solutions were prepared in Milli-Q water at 5 mg ml−1 concen- chemistry (IHC) experiments. We also followed the tration. Larvae were developed as reported above and temporal expression of OvoA during development, through collected at three time points: 1, 2 and 4 h of treatment. western blot (WB) analyses. More importantly, we performed Larvae were then used for phenotypic observation (using a OvoA-targeted perturbation experiments through zygotic Zeiss Axio Imager M1 microscope), IHC and RNA extraction. 2.3. Probe synthesis and in situ hybridization 50 mM EDTA in TBS 0.1% tween-20 (TBS-T). Samples were 3 washed twice in TBS-T, rinsed in glycerol 30% in MOPS Total RNA was extracted from about 1500 embryos (5 hpf royalsocietypublishing.org/journal/rsob buffer and finally visualized on glass slides under the optical blastulae) using RNAqueous-Microkit (Ambion), and microscope (Zeiss Axio Imager M1). Negative controls were 600 ng were retrotranscribed with iScriptTM cDNA Synthesis performed on the same batch of animals and in the same con- kit (Biorad), following the manufacturer’s instructions. 1 µl of ditions using sense probe. For FISH and CISH experiments, total cDNA was used to amplify an ovoA fragment (ampli- about 50 embryos/larvae were visualized under the micro- cone size: 974 bp) by PCR using the following primers: scope for each developmental stage. forward 50 -CATCCGTCCTCATCCGTCAG-30 ; reverse 50 - CCTAACTGGCACGTCTTGGT-30 . The obtained PCR frag- ment was then cloned into the pGEM-T Easy Vector 2.4. OvoA-MASO and synthetic mRNA injection (Promega) and the plasmid fraction was purified by GenElute The ovoA-MASO, targeting the ovoA translation initiation HP Plasmid Miniprep Kit (Sigma) and linearized by PCR. site, was newly designed and acquired from Gene Tools The PCR product was purified by QIAquick PCR Purification (Corvallis) (50 -TTCGAGGCTCAGTTCCGTTGCCATG-30 ). Open Biol. 12: 210262 Kit (Qiagen) and used as a template for RNA labelling with For each experiment around 200 fertilized eggs were injected digoxigenin-UTP by in vitro transcription with SP6 and T7 with approximately 2–4 pl of 0.3 mM ovoA-MASO solution polymerases, to obtain antisense and sense probes respect- containing 0.12 M KCl. Each experiment was repeated at ively (electronic supplementary material, figure S1). Probes least thrice and included negative control embryos, injected Downloaded from https://royalsocietypublishing.org/ on 04 May 2023 were finally purified by gel filtration chromatography on with 0.3 mM of the standard control morpholino (Gene- Sephadex G-50 columns and quantified by assessing the Tools). The injection of the standard control morpholino absorbance at 260 nm (ND-1000 Spectrophotometer; did not cause any effect on the development of embryos. NanoDrop Technologies, Wilmington, DE, USA). In situ For rescue experiments, the complete ovoA CDS was in hybridization experiments were performed according to the vitro synthesized as follows. Total RNA was extracted from protocol described by Andrikou et al. [38]. Briefly, embryos about 1500 P. lividus unfertilized eggs using RNAqueous- were fixed in fixative solution (4% paraformaldehyde, 0.1 M Microkit (Ambion), and 1 µg was retrotranscribed with MOPS pH 7, 0.5 M NaCl, DEPC water) for 1 h at room temp- Super ScriptTM IV VILOTM Master Mix (Invitrogen), follow- erature (RT), washed thrice in MOPS buffer (0.1 M MOPS pH ing the manufacturer’s instructions. 1 µl of total cDNA was 7, 0.5 M NaCl, 0.1% tween-20, DEPC water) and stored at − used to amplify the ovoA CDS, starting from the second 20°C in 70% ethanol in DEPC water until use. After three methionine (amplicone size: 2235 bp) by PCR using the washes in MOPS buffer, the embryos were incubated in following primers: OvoA_BgIII 50 -GAAGATCTATGA hybridization buffer (MOPS buffer supplemented with 70% CACCCTGTGACCTCTC-30 ; OvoA_EcoRI 50 -CGGAATT formamide, 1 mg ml−1 BSA and 1 µl tRNA) for 3 h at 50°C CTTACTGGGCCTCAGCTCTGG-30 . The PCR reaction was and treated with antisense probe (0.1 ng µl−1) for one week loaded on 1% agarose gel (electronic supplementary material, at the same temperature. Then, samples were rinsed in figure S2A) and the PCR product was purified from the gel post-hybridization buffer (MOPS buffer supplemented with using the GeneElute Gel Extraction Kit (Sigma) according 70% formamide, and 1 mg ml−1 BSA) for 3 h at 50°C and to the kit’s instructions. The purified PCR fragment was washed five times in MOPS buffer. For fluorescent in situ then digested with BgIII and EcoRI and cloned into pBlue- hybridization (FISH), embryos were blocked with Perkin- Script pRN3 Plasmid [39]. The plasmid fraction was Elmer (PE) blocking reagent for 30 min at RT and then incu- purified by GenElute HP Plasmid Miniprep Kit (Sigma) bated with anti-digoxigenin antibodies conjugated to and linearized by Sfil digestion. Capped synthetic mRNA horseradish peroxidase (anti DIG-POD, Roche) 1 : 1000 in was obtained by in vitro transcription using mMESSAGE PE reagent overnight at 4°C. Following five washes in mMACHINE kit (Ambion), followed by DNAse treatment MOPS buffer, samples were incubated in amplification dilu- and LiCl precipitation, according to the kit’s instructions. ent (AD, 1.6 µl 30% H2O2 in 10 ml Tris-buffered saline, TBS The mRNA integrity was checked by gel electrophoresis 1×, 50 mM Tris–HCl, pH 7.6, 150 mM NaCl) for 30 min at (electronic supplementary material, figure S2B) and mRNA RT and then treated with Cyanin 5 (Cy5, FP1171, Perkin concentration was quantified by assessing the absorbance at Elmer) 1 : 400 in AD for 30 min at RT in dark. 40 ,6-diami- 260 nm (ND-1000 Spectrophotometer; NanoDrop Techno- dine-20 -phenylindole dihydrochloride (DAPI) was added to logies, Wilmington, DE, USA). For rescue experiments, the samples (1 : 5000; final concentration 0.2 µg ml−1) and fertilized P. lividus eggs were injected with a working solution embryos were visualized at the confocal microscope (Zeiss containing 0.3 mM ovoA-MASO, 0.75 µg µl−1 synthetic ovoA LSM 700). For chromogenic in situ hybridization (CISH), mRNA and 0.12 M KCl. The eventual toxicity of mRNA was samples were washed four times in alkaline phosphatase evaluated by injecting the eggs with a solution containing (AP) buffer (0.1 M Tris–HCl, pH 7.6, 2.5 mM MgCl2, 0.1 M 0.12 mM KCl and 0.75 µg µl−1 of ovoA mRNA, in absence of NaCl) and then twice in AP buffer supplemented with ovoA-MASO. 0.2% tween-20 and 1 mM levamisole. Incubation was carried out in dye solution composed of 10% dimethylformamide, 100 mM Tris–HCl pH 9.5, 50 mM MgCl2, 0.1 M NaCl, 2.5. 5-ethynyl-20 -deoxyuridine and TUNEL assay 1 mM levamisole and the two substrates for alkaline phos- For detection of actively replicating DNA, live embryos were phatase: 0.3 mg ml−1 nitro-blue tetrazolium chloride (NBT) pre-incubated with 10 µM EdU for 2 h. Fixation and 5-ethy- and 0.2 mg ml−1 5-bromo-4-chloro-3’-indoly phosphate nyl-2’-deoxyuridine (EdU) assay were performed according p-toluidine (BCIP). Coloration was carried out overnight at to the protocol described by Wood et al. [40]. For RT, checking under optical microscope until the desired the terminal deoxynucleotidyl transferase dUTP nick end lab- intensity was reached. The reaction was stopped with elling (TUNEL) assay, 18–20 hpf embryos, both control and ovoA-MASO injected were fixed with 4% paraformaldehyde was performed according to Perillo et al. [41]. OvoA antibody 4 in FSW for 1 h. After three washes in PBS 0.1% tween-20 was diluted 1 : 100 and the incubation was performed at 4°C royalsocietypublishing.org/journal/rsob (PBS-T), embryos were treated with ice-cold methanol for overnight, while Msp130 (6a9) [42] was diluted 1 : 50 and 2 min, then rinsed twice in PBS for and in PBS-T two more embryos were incubated at 37°C for 1 h and 30 min. Alexa- times. For positive control, an aliquot of the control unin- Fluor secondary antibodies (488 rabbit and 555 mouse) jected embryos was incubated with 1 U ml−1 DNase (Roche) were used at 1 : 1000 at RT for 1 h. Samples were imaged at 37°C for 30 min and then washed twice with milliQ using a Zeiss LSM700 confocal microscope equipped with a water. The assay was performed using Click-iT Plus 25× water immersion objective, and keeping gain and laser TUNEL Assay (Invitrogen) according to the kit’s instructions. power constant in each experiment. Images were analysed Briefly, embryos were first rinsed in 1× TdT reaction buffer for using ImageJ and ZEN 3.1 (blue edition). Brightness/contrast 10 min at 37°C, and then incubated for 1 h with TdT reaction was adjusted only on the double immunostainings with mix (1× TdT reaction buffer, 1× EdUTP nucleotide mixture, Msp130, on the zoomed details of the pictures. On the con- 0.6 U µl−1 TdT enzyme). After one wash in milliQ water, trary, no corrections have been applied to pictures of the embryos were rinsed twice in 1% BSA in PBS-T and then whole larva, in order to allow the comparison of the staining Open Biol. 12: 210262 washed twice with PBS. Embryos were then incubated for under different treatments. For WB, 200 ml of culture (30 000 30 min at 37°C with Click-iT reaction mix, containing 1× embryos in total) for each developmental stage (from unfer- Click-iT Plus TUNEL Reaction Buffer Additive and Supermix tilized eggs to larval stages) were centrifuged at 1500 rpm (1x Click-iT Plus TUNEL Reaction Buffer, Copper Protectant, for 10 min at 4°C in a swing-out rotor centrifuge. The col- Downloaded from https://royalsocietypublishing.org/ on 04 May 2023 Alexa Fluor 488 picolyl azide). Following two incubations lected pellets were combined, washed once in PBS, with 1% BSA in PBS, samples were washed thrice in PBS centrifuged again in the same conditions and the resulting and incubated with Hoechst 33342 to stain the nuclei (1 : pellets were weighed, rapidly freezed in liquid N2 and kept 2000 in PBS; final concentration 5 µg ml−1). Embryos were at −80°C until use. Pellets were dounce-homogenized on ice finally washed twice in PBS and visualized under the confo- in PBS 0.5% Triton X-100, pH 7.4 [43], supplemented with cal microscope (Zeiss LSM 700). proteases and phosphatases inhibitors (1 mM NaVO4, 1 mM NaF, 1 mM PMSF, cocktail of phosphatases and proteases inhibitors). A protein amount corresponding to 20 µg was 2.6. Antibody production, IHC and WB analyses separated by sodium dodecyl sulfate-polyacrylamide gel In order to obtain a specific antibody for P. lividus OvoA electrophoresis (SDS-PAGE) on 12% gels and transferred to protein (PlOvoA), we selected three antigenic peptides PVDF membranes. Membranes were incubated with 5% based on its amino acidic sequence (ID: AMM72581.1) and non-fat dried milk (nfdmilk) blocking solution for 1 h and structural model [18]. The selected peptides were: P1 (KTEDAIY- then with anti-OvoA IgGs (dilution 1 : 500, final concentration KAPDRLRLC; 52–67 aa) and P2 (PDQNQNSSQYR 1 µg ml−1s) or anti-α actin (SIGMA, 1 : 5000) overnight at 4°C. YRSC; 313–327 aa), both exposed on the surface of the protein, After multiple washes in PBS-T, membranes were incubated and P4 (KSAEELLSKKQKVFYC; 609–624 aa), in the C-terminal with horseradish peroxidase-conjugated goat anti-rabbit IgGs region. The mix of the three synthetic ovalbumin conjugated (Santa Cruz Biotechnology, 1 : 5000) in 5% nfdmilk for 1 h at peptides were used to immunize a rabbit, producing immune RT. Protein bands were visualized on Hyperfilm-ECL films sera, from which the specific IgGs were purified (Primm, using ECL western blotting detection reagents (GE Health- www.primm.it). The PlOvoA specific antibody was used care). Optical density (OD) of immune-positive bands was for all IHC and WB analyses. Pre-immune serum was pro- quantified through ImageJ software. Data were presented as vided by Primm, from which we purified unspecific IgGs OvoA/actin OD ratios mean ± standard deviation and ana- by affinity chromatography using protein A agarose lysed by Kruskal–Wallis with a Dunn’s post hoc test (n = 3 (Sigma) according to standard procedures. The pre-immune biological triplicate) using PAST software package, v. 4.03 IgGs were used for negative controls both in IHC and WB [44]. Data with p-value < 0.05 were considered significant. analyses. For IHC, different P. lividus developmental stages, from unfertilized eggs to gastrula stages, were fixed in 2% paraformaldehyde in FSW for 10 min at RT and then treated 2.7. RNA extraction, cDNA synthesis and real time qPCR with ice-cold methanol for 1 min. Plutei larvae were fixed in Around 400 larvae per treatment were collected for RNA 4% paraformaldehyde in FSW for 15 min at RT, without ice- extraction in a 1.5 ml tube and centrifuged at maximum cold methanol treatment. After multiple washes in PBS-T, speed for 5 min. The pellet was resuspended in Lysis Buffer embryos were blocked in 4% sheep serum in PBS-T for 1 h and vigorously vortexed to lyse the cells. The samples were at RT and incubated overnight at 4°C with the anti-OvoA fast frozen in liquid nitrogen and stored at −80°C until IgGs (dilution 1 : 100, final concentration 5 µg ml−1) in 4% usage. RNA extraction was performed using RNAqueous- sheep serum in PBS-T. Pre-immune IgGs were used at the Micro Kit from ThermoFisher following manufacturer’s same protein concentration as negative control. After mul- instruction. cDNA has been synthesized in a 20 µl reaction tiple washes in PBS-T, embryos/larvae were incubated with from 200 ng of total RNA using the SuperScript VILO CF555 Goat Anti-Rabbit IgGs (H + L) (cat. 20033, Biotium, cDNA synthesis kit (Invitrogen) and stored at −20°C until CA, USA) for 2 h in dark at RT (dilution 1 : 1000) in 4% use. For Real-Time qPCR, 10 µl of reaction was prepared as sheep serum, then rinsed in PBS-T, added with DAPI follows: 5 µl of SYBR Green reagent, 0.7 µl of forward (1 : 5000; final concentration 0.2 µg ml−1) to stain the nuclei. and reverse primer mix (final concentration 0.7 µM each) About 50 embryos/larvae for each developmental stage and 1 µl of cDNA (diluted 1 : 10). Reactions were perfor- were finally visualized under the confocal microscope med in four technical replicates using ViiA 7 Real Time (Zeiss LSM 700). For IHC experiments on LPS-treated PCR. The following primers were used for OvoA: forward embryos and relative untreated controls, immunostaining AGGTCAGCATGGACATAGCC, reverse CCTCAGCCGACT TCAAGAAC. All primer pairs were validated by QPCR although a stronger signal was detected in the gut and 5 against a negative (water) control. Obtained data were mesenchyme cells identifiable for their position as skeleto- royalsocietypublishing.org/journal/rsob analysed using REST. Untreated samples were used as genic cells (figure 1D2). CISH confirmed, to some extent, reference sample while 18S gene was used as endogenous the results obtained by FISH, despite enhancing some key control (18S forward CCTGCCAGTAGTCATATGCTT, differences, probably due to the higher sensitivity but lower reverse CTCGATCCAATGAACCAAACT). specificity of the diffusible chromogenic signal. Indeed, CISH results showed a diffuse ovoA expression in all blasto- meres at the 32-cell stage (figure 1A4). On the other hand, in 2.8. Mass spectrometry analysis the gastrula and prism stages the expression was restricted to The identity of the immunopositive band at 75 kDa was ana- the archenteron region, especially in blastopore and oral ecto- lysed through nano ESI mass spectrometry (MS). A protein derm (figure 1B4, C4), although it cannot be excluded that a amount from late gastrula extract, corresponding to 20 µg, diffuse ovoA mRNA expression occurred in all other cells as was loaded in quadruplicate and separated by SDS/PAGE well, due to the presence of weak staining. In plutei larvae on 12% gel. The gel was then incubated in a fixative solution there was a strong signal in the gut (figure 1D4), although Open Biol. 12: 210262 (40% methanol, 7% acetic acid) for 1 h at RT and stained with a weak staining is also present in all the larva. Embryos Colloidal Coomassie solution (20% methanol, 16% Brilliant hybridized with the sense probe, used as negative controls, Blue G colloidal concentrate, Sigma) overnight at 4°C. The showed absence of signal both in FISH and CISH exper- gel was incubated in a de-staining solution (25% methanol, iments (electronic supplementary material, figure S3). Downloaded from https://royalsocietypublishing.org/ on 04 May 2023 10% acetic acid) until the desired de-staining was observed. The band of interest was cut, kept in 5% acetic acid and in situ digested with trypsin ( protein : protease ratio 20 : 1) 3.2. Temporal and spatial expression of ovoA protein upon Cys derivatization with iodoacetamide as described Different P. lividus developmental stages were analysed for by Tedeschi et al. [45] before MS analysis. Peptide separation OvoA temporal expression through WB analyses. The anti- was achieved on a Thermo Easy-nLC 1000, with a linear gra- body anti-OvoA recognized a band at the apparent dient from 95% solvent A (2% acetonitrile, 0.1% formic acid) molecular weight of 75 kDa (figure 2), very similar to the to 30% solvent B (80% acetonitrile, 0.1% formic acid) over theoretical value of the OvoA primary structure (87.9 kDa). 60 min, from 30% to 60% solvent B in 5 min and from 60% The identity of the band at 75 kDa was confirmed by mass to 100% solvent B in 2 min at a constant flow rate of spectrometry analysis which revealed the presence of four 0.25 µl min−1, with a single run time of 75 min. MS data peptides belonging to OvoA sequence (electronic supplemen- were acquired on a Thermo Q-Exactive–HF, with a data- tary material, figure S4). dependent top 15 method, the survey full scan MS/MS spec- The intensity of this band, normalized to actin, was mon- tra (300–1650 m/z) were acquired in the Orbitrap with 60 000 itored from unfertilized eggs to plutei larvae. The results resolution, AGC target 3e6, IT 20 ms. For HCD spectra resol- showed high variability among batches. However, a general ution was set to 15 000, AGC target 1e5, IT 80 ms; normalized trend was observed with low OvoA expression in the eggs collision energy 28 and isolation width of 1.2 m/z. Raw label- and early embryos followed by a significant increase at the free MS/MS files from Thermo Xcalibur software (v. 4.1) mesenchyme blastula and late gastrula stages (figure 2; electronic were analysed using Proteome Discoverer software (v. 2.2, supplementary material, tables S1 and S2). This increase was also Thermo Fisher Scientific). The minimum required peptide detected at swimming blastula and prism stages, although length was set to six amino acids with carbamidomethylation slightly approaching the significance threshold (0.06 < p-value < as fixed modification, Met oxidation and Arg/Gln deamida- 0.08; electronic supplementary material, table S2). tion as variable modifications. Paracentrotus lividus developmental stages were analysed for OvoA protein spatial expression through IHC exper- iments. Immunolocalization experiments of the OvoA 3. Results enzyme performed in unfertilized eggs revealed a faint signal, weakly localized near the plasma membrane 3.1. OvoA mRNA localization during Paracentrotus (figure 3A1). The signal became stronger in fertilized eggs where several intense spots inside the cell and near the lividus development nuclear membrane were detected (figure 3B1). During The ovoA mRNA spatial expression in the embryos was the first mitotic divisions of the embryo (2- and 4-cell stage) investigated by in situ hybridization (ISH) experiments per- the OvoA immunopositivity was very faint, although a formed on P. lividus developmental stages. This is the first slightly stronger signal was observed near the plasma mem- time the localization of ovoA mRNA and OvoA enzyme brane (figure 3C1 and D1). At the 32-cell stage, a differential has been studied during embryogenesis of an animal model immunopositivity was detected in relation to the cell cycle system. Both fluorescent (FISH) and chromogenic (CISH) phases. Indeed, a stronger signal was detected in S-phase detection were performed following the incubation of fixed (interphase) blastomeres compared to those in M-phase embryos with antisense and sense (negative controls) ovoA (mitosis) (figure 3E1–E2). The IHC experiments at gastrula probes. FISH experiments in early stages showed a diffuse stage showed the presence of OvoA in the cytoplasm of all signal in all blastomeres, without a restricted pattern, until cells without a cell-specific localization (figure 4aA1). As the 32-cell stage (figure 1A2). The experiments performed development proceeded, the signal became gradually in gastrula and prism stages showed an ovoA diffuse restricted to specific cells and tissues. Indeed, in early echino- expression in all cells, although the signal appeared stronger plutei there was a strong immunopositivity in the in the archenteron region (figure 1B2, C2). Similarly, in the skeletogenic primary mesenchyme cells (PMCs) and possibly plutei larvae ovoA mRNA was expressed in all the larva, other mesenchyme cells (figure 4aB1). Interestingly, in FISH CISH 6 royalsocietypublishing.org/journal/rsob DAPI/ovoA merge ovoA mRNA bright field ovoA mRNA A1 A2 A3 A4 20 mm 20 mm B1 B2 B3 B4 Open Biol. 12: 210262 Downloaded from https://royalsocietypublishing.org/ on 04 May 2023 20 mm 20 mm C1 C2 C3 C4 20 mm 20 mm D1 D2 D3 D4 20 mm 20 mm Figure 1. OvoA mRNA localization in P. lividus embryos. For FISH detection, ovoA antisense/DAPI merge (on left), ovoA antisense probe signal (middle) and images in bright field (BF, on right) are shown for some representative P. lividus developmental stages. (A1–A3) 32-cell stage; (B1–B3) gastrula; (C1–C3) prism stage; (D1–D3) pluteus larva. For CISH detection, bright field images are shown for the same developmental stages (A4–D4). White arrows indicate the cells with stronger signal (for details refer to the text). FISH pictures were taken at confocal microscope (Zeiss LSM 700) at 20× magnification and maximum intensity Z-projections were obtained through ImageJ software. CISH pictures were taken at optical microscope (Zeiss Axio Imager M1) at 20× magnification. pluteus larvae, OvoA was clearly localized, as well as in cells in the dorsal side of larvae showed a roundish shape, PMCs, stomach and intestine cells (figure 4aC1,b). Develop- typical of cells that are responding to an infection [48,49] mental stages probed with pre-immune IgGs, as negative and appeared like migrating from the ectoderm towards the controls, showed an absence of staining (electronic inside of the larva (figure 5aC1–E2). By contrast, pigment supplementary material, figure S5). cells of control larvae were located in the ectodermal epi- The strong signal of OvoA in the gut, whose associated thelium and exhibited a stellated shape, typical of resting microbiome plays a pivotal role for the larval immune cells not responding to any infection (figure 5aA1–B2). Treat- system [46,47], prompted us to investigate the possible invol- ment with 100 µg ml−1 LPS for 1 h induced a slight vement of ovothiol in the larval response against bacterial upregulation of ovoA gene expression (electronic supplemen- infection. To this aim, larvae were treated with different con- tary material, figure S6), and an increase of the OvoA centrations of LPS, the major component of the outer immunopositive signal in mesenchyme cells (figure 5bI–L0 ) membrane of gram-negative bacteria. At different time compared to untreated controls (figure 5bA–D0 ), while points (1 and 4 h), larvae were examined by phenotypic 10 µg ml−1 LPS seemed to not induce a strong signal increase observation, ovoA gene expression and protein localization. (figure 5bE–H0 ). Double immunostaining of larvae with anti- After treatment with LPS at 10 and 100 µg ml−1, pigment bodies against OvoA and Msp130, a skeletogenic cell marker, kDa strand DNA breaks and actively replicating DNA, respect- 7 OvoA 75 ively. Results showed the presence of TUNEL positive actin 42 royalsocietypublishing.org/journal/rsob nuclei in ovoA-MASO embryos, compared to ctrl-MASO, § which did not display any apoptotic nucleus (figure 6). # Ctrl-MASO embryos treated with DNase were used as posi- 1.50 * tive control of the assay (electronic supplementary material, 1.25 § figure S8). In addition, a decrease in cell proliferation was OvoA/actin OD ratio ## * observed in ovoA-MASO compared to ctrl-MASO embryos, 1.00 which was rescued by co-injection in zygotes of ovoA syn- 0.75 thetic mRNA, obtaining a very low percentage of malformation (2–3%), and the recovery of the wild-type cell 0.50 proliferation (figure 7). 0.25 4. Discussion Open Biol. 12: 210262 0 UE Zi 64bI EB SB MB LG Pr PI Previous studies suggested that ovothiol plays a key role in Figure 2. OvoA protein expression during P. lividus development. Top: repre- sea urchins acting as a redox regulator to protect eggs from sentative western blot (WB) experiment showing the immunopositive bands Downloaded from https://royalsocietypublishing.org/ on 04 May 2023 the high oxidative burst at fertilization and developing OvoA (75 kDa) and actin (42 kDa) for all the examined developmental stages, embryos from environmental stressors [18,28]. from left to right: unfertilized eggs (UE), zygote (Zi), 64-blastomere stage Embryonic development is a finely regulated and extre- (64bl), early blastula (EB), swimming blastula (SB), mesenchyme blastula mely delicate period in the lifetime of all living organisms, (MB), late gastrula (LG), prism (Pr), pluteus larva (Pl). Bottom: bar-chart especially for those with external fertilization, such as sea showing the OvoA/actin optical densitometry (OD) ratio resulting from WB urchins. Sea urchin developing embryos are indeed exposed analyses performed on embryos derived from three different females. Data are to a variety of environmentally damaging factors and effi- presented as means ± s.d. (n = 3 biological replicates). *p < 0.05 represents sig- cient protection is needed to ensure the progression of the nificance compared to UE; #p < 0.05 and ##p < 0.01 represent significance correct developmental programme and ultimately the fitness compared to Zi; §p < 0.05 represents significance compared to 64bl. of the progeny. In this work we investigated the functional role of ovothiol biosynthesis in embryos of the sea urchin P. lividus, by assessing the localization of OvoA and perturb- revealed the presence of OvoA also in some non-skeletogenic ing its protein translation, demonstrating a key role for mesenchyme cells (figure 5bC0 ,C00 ,D0 ,G0 ,H0 ,K0 ,L0 , white this molecule during development, presumably acting on arrows), in addition to the skeletogenic ones (figure 5bC00 , different biological processes. D0 ,G0 ,H0 ,K0 ,L0 , yellow arrows). Interestingly, some of the OvoA positive cells that did not look to be skeletogenic showed extended filopodia and were very close to the gut 4.1. Role of ovothiol during early Paracentrotus lividus (figure 5b). development The temporal OvoA protein expression pattern from unferti- lized eggs to plutei larvae, with a maximum at the blastula/ 3.3. OvoA knockdown induces an apoptotic phenotype gastrula stages, exhibited a specular trend compared to ovoA In order to understand the functional relevance of ovothiol gene expression data, reported in previous studies, which during the embryonic development of sea urchin, its for- showed high levels in unfertilized eggs, a strong decrease at mation was perturbed through zygotic microinjection of early and swimming blastula stages, and then an increase anti-ovoA MASO (ovoA-MASO), thus blocking the OvoA at the pluteus stage [18]. This shift in the transcript and protein translation. Embryos developed from perturbed protein expression pattern can be ascribed to the time zygotes were analysed for phenotype observation and needed to synthesize the OvoA protein. Indeed, in sea urch- OvoA protein immunopositivity by IHC experiments. The ins, following fertilization, there is an enhanced activation of phenotype of perturbed embryos (ovoA-MASO) was com- cell metabolism, including protein synthesis, being dispensa- pared with phenotype of embryos injected with a control ble for the S-phase but necessary for the onset of M-phase morpholino, which was expected to not cause any malfor- and subsequent embryonic cell cycles [50–52]. Thus, it is mation (ctrl-MASO). OvoA-MASO embryos showed no likely that the previously described decrease in ovoA malformation until blastula stage, although revealing a mRNA in fertilized eggs is followed by a triggered protein slight delay in development compared to ctrl-MASO (elec- translation in the embryo. tronic supplementary material, figure S7A). At the gastrula In addition, our pioneering protein localization exper- stage (18–20 hpf ), a high percentage of malformation (80%) iments indicate the presence of OvoA near the plasma was observed in ovoA-MASO embryos, showing an extreme membrane in unfertilized eggs and its increase in fertilized phenotype characterized by the lack of PMCs ingression and eggs, thus providing support to Shapiro’s theory about a archenteron invagination, and resulting in a ‘ball of cells’ role of ovothiol against the oxidative stress produced by the with big and fragmented apoptotic-like nuclei (electronic entry of the spermatozoon into the oocyte [28]. Moreover, supplementary material, figure S7B). To confirm the occur- the higher expression of OvoA in S-phase (interphase) blasto- rence of apoptotic processes, and eventually highlight any meres compared to those in M-phase (mitosis) at the 32-cell effect on cell proliferation, ovoA-MASO embryos were ana- stage may suggest a correlation of ovothiol biosynthesis lysed through TUNEL and EdU assays, to detect double- with the cell cycle progression. Indeed, fertilization in sea OvoA protein DAPI bright field 8 A1 A2 A3 royalsocietypublishing.org/journal/rsob epn 10 mm B1 B2 B3 epn Open Biol. 12: 210262 spn 10 mm Downloaded from https://royalsocietypublishing.org/ on 04 May 2023 C3 C1 C2 10 mm D1 D2 D3 10 mm E1 E2 E3 S-n M-n 20 mm Figure 3. OvoA spatial expression in P. lividus early developmental stages. For immunohistochemistry experiments (IHC), OvoA immunofluorescence (in red, left side), nuclei (labelled in blue with DAPI, middle) and images in bright field are shown for: (A1–A3) unfertilized eggs; (B1–B3) fertilized eggs; (C1–C3) 2-cell stage; (D1–D3) 4-cell stage; (E1–E3) 32-cell stage. In OvoA protein panel, white arrows indicate OvoA signal (for details refer to the text). epn = egg pronucleus, spn = sperm pronucleus, S-n = S-phase (interphase) nucleus, M-n = M-phase (mitosis) nucleus. Pictures were taken at confocal microscope (Zeiss LSM 700) at 20× magnification. urchins triggers the entry of the eggs, blocked in G1 phase, experiments at the larval stage, revealing a very specific into the S-phase [52], and ROS are known to play a key expression pattern of the protein in the digestive tract. role in cell cycle progression, especially for entry into the Indeed, the accumulation of high mRNA concentrations in S-phase [53]. Thus, ovothiol could help to maintain a blastopore, archenteron and oral ectoderm at gastrula stage redox balance, preventing the damaging effects of toxic could sustain the increased OvoA protein translation in the ROS concentrations produced during the cell cycle, a key larval tissues originating from them (e.g. anus, gut and oral step for a normal early development in which the cycle cavity, respectively). It is worth noting that the restriction of time is extremely short, alternating S and M phases without the protein expression to few specific larval cells and tissues ‘gap’ [54]. The association of ovothiol formation with key may be responsible for the overall decrease of the protein regulators of cell cycle represents an interesting point of levels at the pluteus stage, revealed by WB analyses. By con- further investigation. trast, at earlier stages (i.e. blastula and gastrula), the amount Although at the gastrula and prism stages the OvoA of protein showed by WB is higher, probably for its diffuse protein is expressed in all cells, ISH experiments, especially localization in all cells. using chromogenic detection, revealed a stronger signal in Interestingly, when OvoA protein translation is blocked in the blastopore, archenteron and oral ectoderm. Such accumu- the eggs by microinjection of MASO specifically designed lation of ovoA mRNA in these tissues is in line with the IHC against ovoA (ovoA-MASO), the embryos do not develop (a) 9 OvoA protein DAPI bright field royalsocietypublishing.org/journal/rsob A1 A2 A3 20 mm B3 Open Biol. 12: 210262 B1 B2 PMCs Downloaded from https://royalsocietypublishing.org/ on 04 May 2023 30 mm C1 C2 C3 (i) (ii) 100 mm (b) (i) (ii) stomach intestine PMCs Figure 4. OvoA immunolocalization in P. lividus late developmental stages. (a) For immunohistochemistry experiments (IHC), OvoA immunofluorescence (in red, left side), nuclei (labelled in blue with DAPI, middle) and images in bright field are shown for: (A1–A3) gastrula stage; (B1–B3) early echinopluteus; (C1–C3) plutei larvae. (b) For pluteus stage two zoom insights are reported, showing (i) OvoA signal in intestine, and (ii) stomach and primary mesenchyme cells (PMCs). White arrows indicate OvoA signal (for details refer to the text). Pictures were taken at confocal microscope (Zeiss LSM 700) at 20× magnification. over the gastrulation process, thus showing a decrease in cell suggesting a possible involvement of ovothiol in the protec- proliferation and the occurrence of an apoptotic-like pheno- tion of DNA from damaging agents. This hypothesis is in type. This result might be explained by the presumable link line with the higher OvoA expression in S-phase of the cell of ovothiol biosynthesis with cell cycle progression in early cycle, when DNA is actively replicating and eventual stres- embryos, because when its biosynthetic pathway is per- sors could potentially lead to errors in genetic information, turbed, embryos are not able to reach the larval stage while which can also be transmitted to the daughter cells. For undergoing cell cycle arrest with consequent cell death. instance, a strictly localized ovothiol production close to the Another interesting observation arising from IHC exper- nuclear membrane could be necessary to protect the embryos iments is the restricted OvoA protein expression pattern to from ultraviolet radiation, which can penetrate up to 7–12 m the subcellular space surrounding the nuclear membrane, depth into the seawater column, and can eventually affect sea (a) bright field (b) OvoA msp130 DAPI staining 10 A1 A2 A B C D royalsocietypublishing.org/journal/rsob 1h (d¢) (a¢) (b¢) (c¢¢) untreated untreated B1 B2 A¢ * B¢ g C¢ D¢ g * 4h C¢¢ * * g C1 C2 E F F¢ G H Open Biol. 12: 210262 LPS 10 mg ml–1 1 h G¢ H¢ LPS 10 mg ml–1 E¢ Downloaded from https://royalsocietypublishing.org/ on 04 May 2023 1h C3 C4 E¢ F¢ G¢ g H¢ * m * D1 D2 D3 I J J¢ K K¢ L 1h g LPS 100 mg ml–1 1 h LPS 100 mg ml–1 (i¢) (l¢) E1 E2 I¢ g J¢ m K¢ L¢ 4h * * m g Figure 5. Phenotypic and molecular characterization of P. lividus pluteus larvae exposed to LPS treatments. (a) Phenotype observation of larvae exposed to various combinations of LPS concentrations and time points, and untreated larvae: (A1–B2) untreated larvae; (C1–C4) larvae after 1 h of exposure to 10 µg ml−1 of LPS; (D1–E2) larvae treated with 100 µg ml−1 of LPS for 1 h or 4 h (arrows indicate pigment cells inside the larva). (b) OvoA (in green) and Msp130 (in purple) immunostaining of untreated larvae (A–D0 ), and after treatment with 10 (E–H0 ) and 100 µg ml−1 (I–L0 ) of LPS for 1 h. g = gut; m = mouth; white asterisks = cells possibly skeletogenic; yellow arrow = skeletogenic OvoA-positive cells; white arrows = non-skeletogenic OvoA-positive cells. Brightness/contrast was adjusted only on the double immunostainings with Msp130, on the zoomed images. urchin fertilization success, timing of cleavage and develop- migrated from the ectoderm towards the inside of the larva, ment, mainly damaging the DNA by their direct action or such as happens when an immune response is activated [48]. through the consequent ROS production [1]. Moreover, non-skeletogenic OvoA positive cells were high- lighted, having extended filopodia and being located close to the gut. A coordinated cellular immune response, involving 4.2. Possible involvement of ovothiol in the larval distinct cell types, from pigment to filopodial and ameboid cells, occurs when sea urchin larvae are infected by marine inflammatory response and skeleton formation bacteria [49]. The presence of OvoA, and eventually ovothiol The strong OvoA immunolocalization in the sea urchin gut is formation, in these filopodial non-skeletogenic cells could be intriguing because it represents a key barrier against biotic related to the ability of ovothiol to counteract ROS overproduc- and abiotic threats the embryos can encounter in the seawater tion in response to microbial infection [56]. column, like heavy metals, toxins, bacteria/viruses. Since the A possible function of ovothiol in the context of an sea urchin larval gut is an important site of immune defence inflammatory response is also supported by the increased [49,55], we investigated ovoA gene expression and protein expression of the ovoA gene after LPS treatment, as revealed localization following infection. We exposed the larvae to a by quantitative PCR data, as well as by the increase in the bacterial LPS to induce an immune response, which was protein expression in mesenchyme cells. indeed detected by the phenotype change of pigment cells: Finally, the clear OvoA positivity in skeletogenic from the resting stellate state, they became rounded and mesenchyme cells suggests that this molecule could be (a) 11 TUNEL Hoechst bright field royalsocietypublishing.org/journal/rsob A1 A2 A3 20 mm B1 B2 B3 Open Biol. 12: 210262 Downloaded from https://royalsocietypublishing.org/ on 04 May 2023 20 mm (b) 5 mm 5 mm Figure 6. Apoptotic nuclei detection in OvoA knockdown sea urchin embryos. (a) TUNEL signal, nuclei staining (Hoechst) and bright field images are shown for both ctrl-MASO (A1–A3) and ovoA-MASO embryos (B1–B3). (b) TUNEL/Hoechst merged signal from two additional representative ovoA-MASO embryos. White arrows indicate the TUNEL-positive nuclei. somehow involved in the skeletogenic process. Larval skele- in spicules [64]. Nevertheless, larvae are able to maintain calci- togenesis is a key morphogenetic event, although transient fication rates also under acidified conditions due to energy in sea urchin development [57]. The larval skeleton, mainly allocation mechanisms and the capability of PMCs to counter- constituted by a soluble form of CaCO3, magnesium calcite act an internal acidified environment, protecting the spicules [58,59], is essential to protect the digestive organs, and by dissolution [64,65]. Due to the essential role of skeletogen- it contributes to the orientation of the arms, necessary for esis for the fitness of the sea urchin offspring and, considering effective swimming and feeding behaviour through the the redox/acid–base properties of ovothiol [66], its biosyn- action of the cilia [60–63]. thesis in the skeletogenenic cells could help the efficient Since skeletogenic cells, or PMCs, and spicules, face to the formation of larval skeleton, by contributing to maintain a primary body cavity, whose pH conforms to the external redox/acid–base homeostasis inside these cells. This is further seawater pH, they are directly exposed to any eventual suggested by our finding that embryos injected with ovoA- environmental change. Decreases in pH, for example, caused MASO show an extreme phenotype characterized by the lack by ocean acidification events, can cause a dysregulation of of PMCs ingression. However, further investigation is necess- ion pumps and transporters, challenging the calcifying activity ary in order to clarify these aspects. (a) 12 EdU Hoechst bright field royalsocietypublishing.org/journal/rsob A1 A2 A3 20 mm B1 B2 B3 Open Biol. 12: 210262 Downloaded from https://royalsocietypublishing.org/ on 04 May 2023 20 mm C1 C2 C3 20 mm (b) 20 mm 20 mm Figure 7. Proliferating nuclei staining in OvoA knockdown sea urchin embryos. (a) EdU signal, nuclei staining (Hoechst) and bright field images are shown for embryos injected with ctrl-MASO (A1–A3), ovoA-MASO alone (B1–B3) and co-injected with ovoA synthetic mRNA (C1–C3). (b) EdU/Hoechst merged signal from two additional representative ovoA-MASO embryos. White arrows indicate the EdU-positive nuclei. Pictures were taken with a confocal microscope (Zeiss LSM 700) at 20× magnification. programme in sea urchins, presumably helping fundamen- 5. Conclusion tal processes to occur, from cell proliferation to skeleton The overall outcomes of this study significantly contribute formation and immune response. This paper reports the to our understanding of the biological function of OvoA first experiments on perturbation of ovoA gene function in in marine invertebrates. Due to the pleiotropic properties organismal biology and provides a significant contribution of ovothiols, including powerful ROS scavenging activities for the understanding of cell and developmental biological and acid–base regulation properties, the function of processes. Moreover, our findings may also provide inspi- OvoA may be essential to ensure correct developmental ration for the discovery of new biological activities of ovothiols in humans, in the light of the growing interest in review and editing; S.N.: investigation, writing—review and editing; 13 their beneficial properties. G.T.: validation, visualization, writing—review and editing; I.C.: con- ceptualization, formal analysis, supervision, validation, writing— royalsocietypublishing.org/journal/rsob Ethics. Paracentrotus lividus (Lamarck, 1816) sea urchins were collected review and editing; M.I.A.: conceptualization, formal analysis, investi- in the Gulf of Naples from a location not privately owned nor pro- gation, resources, supervision, validation, writing—review and tected in any way, according to the authorization of Marina editing; A.P.: conceptualization, formal analysis, funding acquisition, Mercantile (DPR 1639/68, 09/19/1980 confirmed on 10 January project administration, resources, supervision, validation, writing— 2000). Although no authorization is required for sea urchins, all review and editing. All authors gave final approval for publication animal procedures were in compliance with the guidelines of the Euro- and agreed to be held accountable for the work performed therein. pean Union directive 2010/63/EU and following D. Lgs. 4/03/2014 Competing interests. We declare we have no competing interests. no. 26 on the protection of animals used for scientific purposes by Funding. A.M. and M.C. were supported by a PhD fellowship funded reducing to a minimum the number of specimens used and any by the Stazione Zoologica Anton Dohrn (Open University-Stazione pain or stress of animals. Zoologica Anton Dohrn PhD Program). Data accessibility. The datasets supporting this article have been Acknowledgements. We would like to thank Prof. Charles A. Ettensohn uploaded as part of the electronic supplementary material [67]. from the Department of Biological Sciences of the Carnegie Mellon Authors’ contributions. A.M.: conceptualization, formal analysis, investi- University (Pittsburgh, USA) for Msp130 antibodies, and Davide Open Biol. 12: 210262 gation, validation, visualization, writing—original draft, writing— Caramiello from the Marine Animal Conservation and Public review and editing; M.C.: investigation, validation, visualization, writ- Engagement Department of the Stazione Zoologica Anton Dohrn ing—review and editing; A.C.: investigation, validation, writing— (Naples, Italy). Downloaded from https://royalsocietypublishing.org/ on 04 May 2023 References 1. Lesser MP, Kruse VA, Barry TM. 2003 Exposure to 9. Agnello M, Roccheri MC. 2010 Apoptosis: focus on 18. Castellano I, Migliaccio O, D’Aniello S, Merlino A, ultraviolet radiation causes apoptosis in developing sea urchin development. Apoptosis 15, 322–330. Napolitano A, Palumbo A. 2016 Shedding light on sea urchin embryos. J. Exp. Biol. 206, 4097–4103. (doi:10.1007/s10495-009-0420-0) ovothiol biosynthesis in marine metazoans. Sci. Rep. (doi:10.1242/jeb.00621) 10. Bäckström S. 1957 Content and distribution of 6, 21506. (doi:10.1038/srep21506) 2. Migliaccio O, Castellano I, Romano G, Palumbo A. ascorbic acid in sea urchin embryos of different 19. Tarrant AM, Payton SL, Reitzel AM, Porter DT, Jenny 2014 Stress response to cadmium and manganese developmental trends. Exp. Cell Res. 13, 333–340. MJ. 2018 Ultraviolet radiation significantly enhances in Paracentrotus lividus developing embryos is (doi:10.1016/0014-4827(57)90012-5) the molecular response to dispersant and sweet crude mediated by nitric oxide. Aquat. Toxicol. 156, 11. Sakai H, Dan K. 1959 Studies on sulfhydryl groups oil exposure in Nematostella vectensis. Mar. Env. Res. 125–134. (doi:10.1016/j.aquatox.2014.08.007) during cell division of sea urchin egg: I. Glutathione. 134, 96–108. (doi:10.1016/j.marenvres.2018.01.002) 3. Migliaccio O, Castellano I, Cirino P, Romano G, Exp. Cell Res. 16, 24–41. (doi:10.1016/0926- 20. Yanshole VV, Yanshole LV, Zelentsova EA, Palumbo A. 2015 Maternal exposure to Cadmium and 6585(65)90216-5) Tsentalovich YP. 2019 Ovothiol A is the main Manganese impairs reproduction and progeny fitness 12. Griffiths M. 1966 The carotenoids of the eggs and antioxidant in fish lens. Metabolites 9, 95. (doi:10. in the sea urchin Paracentrotus lividus. PLoS ONE 10, embryos of the sea urchin Strongylocentrotus 3390/metabo9050095) e0131815. (doi:10.1371/journal.pone.0131815) purpuratus. Dev. Biol. 13, 296–309. (doi:10.1016/ 21. Diaz de Cerio O, Reina L, Squatrito V, Etxebarria N, 4. Migliaccio O, Castellano I, Di Cioccio D, Tedeschi G, 0012-1606(66)90070-4) Gonzalez-Gaya B, Cancio I. 2020 Gametogenesis- Negri A, Cirino P, Romano G, Zingone A, Palumbo A. 13. Griffiths M, Perrott P. 1976 Seasonal changes in the related fluctuations in ovothiol levels in the mantle 2016 Subtle reproductive impairment through nitric carotenoids of sea urchin Strongylocentrotus of mussels from different estuaries: fighting oxide-mediated mechanisms in sea urchins from an droebachiensis. Comp. Biochem. Physiol. B 55, oxidative stress for spawning in polluted waters. area affected by harmful algal blooms. Sci. Rep. 6, 435–441. (doi:10.1016/0305-0491(76)90317-5) Biomolecules 10, 373. (doi:10.3390/biom10030373) 26086. (doi:10.1038/srep26086) 14. Palumbo A, D’Ischia M, Misuraca G, Prota G. 1982 22. Spies HS, Steenkamp DJ. 1994 Thiols of intracellular 5. Milito A, Murano C, Castellano I, Romano G, Isolation and structure of a new sulphur-containing pathogens. Identification of ovothiol A in Leishmania Palumbo A. 2020 Antioxidant and immune response aminoacid from sea urchin eggs. Tetrahedron Lett. 23, donovani and structural analysis of a novel thiol from of the sea urchin Paracentrotus lividus to different 3207–3208. (doi:10.1016/S0040-4039(00)88597-4) Mycobacterium bovis. Eur. J. Biochem. 224, 203–213. re-suspension patterns of highly polluted marine 15. Palumbo A, Misuraca G, D’Ischia M, Donaudy F, (doi:10.1111/j.1432-1033.1994.tb20013.x) sediments. Mar. Environ. Res. 160, 104978. (doi:10. Prota G. 1984 Isolation and distribution of 23. Milito A, Castellano I, Burn R, Seebeck FP, Brunet C, 1016/j.marenvres.2020.104978) 1-methyl-5-thiol-l-histidine disulphide and a related Palumbo A. 2020 First evidence of ovothiol biosynthesis 6. Murano C, Agnisola C, Caramiello D, Castellano I, metabolite in eggs from echinoderms. Comp. in marine diatoms. Free Radic. Biol. Med. 152, Casotti R, Corsi I, Palumbo A. 2020 How sea urchins Biochem. Physiol. B 78, 81–83. (doi:10.1016/0305- 680–688. (doi:10.1016/j.freeradbiomed.2020.01.010) face microplastics: uptake, tissue distribution and 0491(84)90149-4) 24. Milito A, Orefice I, Smerilli A, Castellano I, immune system response. Environ. Pollut. 264, 16. Castellano I, Seebeck FP. 2018 On ovothiol Napolitano A, Brunet C, Palumbo A. 2020 Insights 114685. (doi:10.1016/j.envpol.2020.114685) biosynthesis and biological roles: from life in the into the light response of Skeletonema marinoi: 7. Murano C, Donnarumma V, Corsi I, Casotti R, Palumbo ocean to therapeutic potential. Nat. Prod. Rep. 35, involvement of ovothiol. Mar. Drugs 18, 477. A. 2021 Impact of microbial colonization of polystyrene 1241–1250. (doi:10.1039/c8np00045j) (doi:10.3390/md18090477) microbeads on the toxicological responses in the sea 17. Palumbo A, Castellano I, Napolitano A. 2018 Ovothiol: 25. Rohl I, Schneider B, Schmidt B, Zeeck E. 1999 urchin Paracentrotus lividus. Environ. Sci. Technol. 55, a potent natural antioxidant from marine organisms. L-ovothiol A: the egg release pheromone of the 7990–8000. (doi:10.1021/acs.est.1c00618) In Blue biotechnology: production and use of marine marine polychaete Platynereis dumerilii: Anellida: 8. Goldstone JV et al. 2006 The chemical defensome: molecules, part 2: marine molecules for disease Polychaeta. Z. Naturforsch. C 54c, 1145–1147. environmental sensing and response genes in the treatment/prevention and for biological research (eds (doi:10.1515/znc-1999-1222) Strongylocentrotus purpuratus genome. Dev. Biol. S La Barre, SS Bates), pp. 583–610. Weinheim, DE: 26. Breithaupt T, Hardege JD. 2012 Pheromones 300, 366–384. (doi:10.1016/j.ydbio.2006.08.066) Wiley VCH. (doi:10.1002/9783527801718.ch18) mediating sex and dominance in aquatic animals. In Chemical ecology in aquatic systems 40. Wood NJ, Mattiello T, Rowe ML, Ward L, Perillo M, APC(Cdh1) by reactive oxygen species. Mol. Cell. 14 (eds C Bronmark, LA Hansson), pp. 39–56. Arnone MI, Elphick MR, Oliveri P. 2018 Biol. 26, 4701–4711. (doi:10.1128/MCB.00303-06) royalsocietypublishing.org/journal/rsob Oxford, UK: Oxford University Press. Neuropeptidergic systems in pluteus larvae of the 54. Siefert JC, Clowdus EA, Sansam CL. 2015 Cell cycle control 27. Torres JP et al. 2021 Small-molecule mimicry hunting sea urchin Strongylocentrotus purpuratus: in the early embryonic development of aquatic animal strategy in the imperial cone snail, Conus imperialis. neurochemical complexity in a ‘simple’ nervous species. Comp. Biochem. Physiol. C: Toxicol. Pharmacol. Sci. Adv. 7, eabf2704. (doi:10.1126/sciadv.abf2704) system. Front. Endocrinol. (Lausanne) 9, 628. 178, 8–15. (doi:10.1016/j.cbpc.2015.10.003) 28. Shapiro BM. 1991 The control of oxidant stress at (doi:10.3389/fendo.2018.00628) 55. Buckley KM, Rast JP. 2017 An organismal model for fertilization. Science 252, 533–536. (doi:10.1126/ 41. Perillo M, Paganos P, Spurrell M, Arnone MI, Wessel gene regulatory networks in the gut-associated science.1850548) GM. 2021 Methodology for whole mount and immune response. Front. Immunol. 8, 1297. (doi:10. 29. Russo GL, Russo M, Castellano I, Napolitano A, Palumbo fluorescent RNA in situ hybridization in 3389/fimmu.2017.01297) A. 2014 Ovothiol isolated from sea urchin oocytes echinoderms: single, double, and beyond. In 56. Hicks JM, Halkerston R, Silman N, Jackson SK, Aylott JW, induces autophagy in the Hep-G2 cell line. Mar. Drugs Developmental biology of the sea urchin and other Rawson FJ. 2019 Real-time bacterial detection with an 12, 4069–4085. (doi:10.3390/md12074069) marine invertebrates (eds DJ Carroll, SA Stricker), intracellular ROS sensing platform. Biosens. Bioelectron. 30. Brancaccio M, D’Argenio G, Lembo V, Palumbo A, pp. 195–216. New York, NY: Humana. 141, 111 430. (doi:10.1016/j.bios.2019.111430) Open Biol. 12: 210262 Castellano I. 2018 Antifibrotic effect of marine 42. Ettensohn CA, McClay DR. 1988 Cell lineage 57. Decker GL, Lennarz WJ. 1988 Skeletogenesis in the ovothiol in an in vivo model of liver fibrosis. conversion in the sea urchin embryo. Dev. Biol. 125, sea urchin embryo. Development 103, 231–247. Oxidative Med. Cell. Longev. 2018, 5045734. (doi:10. 396–409. (doi:10.1016/0012-1606(88)90220-5) (doi:10.1242/dev.103.2.231) 1155/2018/5045734) 43. Amaroli A, Ferrando S, Gagliani MC, Gallus L, Masini 58. Beniash E, Aizenberg J, Addadi L, Weiner S. 1997 Downloaded from https://royalsocietypublishing.org/ on 04 May 2023 31. Castellano I, Di Tomo P, Di Pietro N, Mandatori D, MA. 2013 Identification of aquaporins in eggs and Amorphous calcium carbonate transforms into Pipino C, Formoso G, Napolitano A, Palumbo A, early embryogenesis of the sea urchin Paracentrotus calcite during sea urchin larval spicule growth. Pandolfi A. 2018 Anti-inflammatory activity of lividus. Acta Histochem. 115, 257–263. (doi:10. Proc. R. Soc. Lond. B 264, 461–465. (doi:10.1098/ marine ovothiol A in an in vitro model of 1016/j.acthis.2012.07.006) rspb.1997.0066) endothelial dysfunction induced by hyperglycemia. 44. Hammer Ø, Harper DAT, Ryan PD. 2001 PAST: 59. Raz S, Hamilton PC, Wilt FH, Weiner S, Addadi L. Oxidative Med. Cell. Longev. 2018, 12. (doi:10.1155/ paleontological statistics software package for 2003 The transient phase of amorphous calcium 2018/2087373) education and data analysis. Palaeontol. Electron. 4, carbonate in sea urchin larval spicules: the 32. Brancaccio M, Russo M, Masullo M, Palumbo A, 1–9. involvement of proteins and magnesium ions in its Russo GL, Castellano I. 2019 Sulfur-containing 45. Tedeschi G, Pagliato L, Negroni M, Montorfano G, formation and stabilization. Adv. Funct. Mater. 13, histidine compounds inhibit γ-glutamyl Corsetto P, Nonnis S, Negri A, Rizzo AM. 2011 480–486. (doi:10.1002/adfm.200304285) transpeptidase activity in human cancer cells. Protein pattern of Xenopus laevis embryos grown in 60. Pennington JT, Strathmann RR. 1990 Consequences J. Biol. Chem. 294, 14 603–14 614. (doi:10.1074/ simulated microgravity. Cell Biol. Int. 35, 249–258. of the calcite skeletons of planktonic echinoderm jbc.RA119.009304) (doi:10.1042/CBI20100248) larvae for orientation, swimming, and shape. Biol. 33. Milito A, Brancaccio M, D’Argenio G, Castellano I. 46. Buckley KM, Rast JP. 2019 Immune activity at the Bull. 179, 121–133. (doi:10.2307/1541746) 2019 Natural sulfur-containing compounds: an gut epithelium in the larval sea urchin. Cell Tissue 61. Strathmann RR. 2000 Functional design in the alternative therapeutic strategy against liver fibrosis. Res. 377, 469–474. (doi:10.1007/s00441-019- evolution of embryos and larvae. Semin. Cell Dev. Cells 8, 1356. (doi:10.3390/cells8111356) 03095-7) Biol. 11, 395–402. (doi:10.1006/scdb.2000.0192) 34. Milito A, Brancaccio M, Lisurek M, Masullo M, 47. Buckley KM, Schuh NW, Heyland A, Rast JP. 2019 62. Strathmann RR. 2007 Time and extent of ciliary Palumbo A, Castellano I. 2019 Probing the Analysis of immune response in the sea urchin response to particles in a non-filtering feeding interactions of sulfur-containing histidine larva. Methods Cell Biol. 150, 333–355. (doi:10. mechanism. Biol. Bull. 212, 93–103. (doi:10.2307/ compounds with human gamma-glutamyl 1016/bs.mcb.2018.10.009) 25066587) transpeptidase. Mar. Drugs 17, 650. (doi:10.3390/ 48. Burguera D et al. 2017 Evolutionary recruitment of 63. Strathmann RR, Grünbaum D. 2006 Good eaters, md17120650) flexible Esrp-dependent splicing programs into poor swimmers: compromises in larval form. Integr. 35. Milito A, Castellano I, Damiani E. 2021 From sea to diverse embryonic morphogenetic processes. Nat. Comp. Biol. 46, 312–322. (doi:10.1093/icb/icj031) skin: is there a future for natural photoprotectants? Commun. 8, 1799. (doi:10.1038/s41467-017- 64. Stumpp M et al. 2012 Acidified seawater Mar. Drugs 19, 379. (doi:10.3390/md19070379) 01961-y) impacts sea urchin larvae pH regulatory systems 36. Gerdol M, Sollitto M, Pallavicini A, Castellano I. 49. Ho EC, Buckley KM, Schrankel CS, Schuh NW, Hibino relevant for calcification. Proc. Natl Acad. Sci. USA 2019 The complex evolutionary history of sulfoxide T, Solek CM, Bae K, Wang G, Rast JP. 2016 109, 18 192–18 197. (doi:10.1073/pnas. synthase in ovothiol biosynthesis. Proc. R. Soc. B Perturbation of gut bacteria induces a coordinated 1209174109) 286, 20191812. (doi:10.1098/rspb.2019.1812) cellular immune response in the purple sea urchin 65. Martin S et al. 2011 Early development and 37. Brancaccio M, Tangherlini M, Danovaro R, Castellano larva. Immunol. Cell Biol. 94, 861–874. (doi:10. molecular plasticity in the Mediterranean sea urchin I. 2021 Metabolic adaptations to marine 1038/icb.2016.51) Paracentrotus lividus exposed to CO2 driven environments: molecular diversity and evolution of 50. Wagenaar EB. 1983 The timing of synthesis of acidification. J. Exp. Biol. 214, 1357–1368. (doi:10. ovothiol biosynthesis in Bacteria. Genome Biol. Evol. proteins required for mitosis in the cell cycle of the 1242/jeb.051169) 13, evab169. (doi:10.1093/gbe/evab169) sea urchin embryo. Exp. Cell Res. 144, 393–403. 66. Marjanovic B, Simic MG, Jovanovic SV. 1995 38. Andrikou C, Iovene E, Rizzo F, Oliveri P, Arnone MI. (doi:10.1016/0014-4827(83)90419-6) Heterocyclic thiols as antioxidants: Why Ovothiol C 2013 Myogenesis in the sea urchin embryo: the 51. Dubé F. 1988 Effect of reduced protein synthesis on is a better antioxidant than ergothioneine. Free molecular fingerprint of the myoblast precursors. the cell cycle in sea urchin embryos. J. Cell. Physiol. Radic. Biol. Med. 18, 679–685. (doi:10.1016/0891- Evodevo 4, 33–33. (doi:10.1186/2041-9139-4-33) 137, 545–552. (doi:10.1002/jcp.1041370321) 5849(94)00186-n) 39. Lemaire P, Garrett N, Gurdon JB. 1995 Expression 52. Epel D. 1990 The initiation of development at 67. Milito A, Cocurullo M, Columbro A, Nonnis S, cloning of Siamois, a Xenopus homeobox gene fertilization. Cell Differ. 29, 1–12. (doi:10.1016/ Tedeschi G, Castellano I, Arnone MI, Palumbo A. expressed in dorsal-vegetal cells of blastulae and 0922-3371(90)90019-s) 2021 Ovothiol ensures the correct developmental able to induce a complete secondary axis. Cell 81, 53. Havens CG, Ho A, Yoshioka N, Dowdy SF. 2006 program of the sea urchin Paracentrotus lividus 85–94. (doi:10.1016/0092-8674(95)90373-9) Regulation of late G(1)/S phase transition and embryo. Figshare.