Received: 25 May 2021 | Revised: 4 November 2021 | Accepted: 5 November 2021 DOI: 10.1096/fj.202100844RR RESEARCH ARTICLE Identification of atrial-­enriched lncRNA Walras linked to cardiomyocyte cytoarchitecture and atrial fibrillation Carlos García-­Padilla1 | Jorge N. Domínguez1 | Valeria Lodde2,3 | Rachel Munk2 | Kotb Abdelmohsen2 | Myriam Gorospe2 | Veronica Jiménez-­Sábado4 | Antonino Ginel5,6 | Leif Hove-­Madsen4,6,7 | Amelia E. Aránega1 | Diego Franco1 1 Cardiovascular Development Group, Department of Experimental Biology, University of Jaen, Jaen, Spain 2 Laboratory of Genetics and Genomics, National Institute on Aging IRP, National Institutes of Health, Baltimore, Maryland, USA 3 Department of Biomedical Sciences, University of Sassari, Sassari, Italy 4 CIBERCV, Barcelona, Spain 5 Department Cardiac Surgery, Hospital de Sant Pau, Barcelona, Spain 6 Biomedical Research Institute IIB Sant Pau, Barcelona, Spain 7 Biomedical Research Institute Barcelona (IIBB-­CSIC), Barcelona, Spain Correspondence Diego Franco, Cardiovascular Abstract Development Research Group, Atrial fibrillation (AF) is the most prevalent cardiac arrhythmia in humans. Department of Experimental Biology Genetic and genomic analyses have recently demonstrated that the homeobox B3-­362, University of Jaen, 23071 Jaén, Spain. transcription factor Pitx2 plays a fundamental role regulating expression of dis- Email: dfranco@ujaen.es tinct growth factors, microRNAs and ion channels leading to morphological and Funding information molecular alterations that promote the onset of AF. Here we address the plausible This work was supported by a grant-­ contribution of long non-­coding (lnc)RNAs within the Pitx2>Wnt>miRNA sign- in-­aid from the Junta de Andalucía aling pathway. In silico analyses of annotated lncRNAs in the vicinity of the Pitx2, Regional Council to DF and AA [CTS-­ 446] and by a grant from the Ministry Wnt8 and Wnt11 chromosomal loci identified five novel lncRNAs with differen- of Science, Innovation and Universities tial expression during cardiac development. Importantly, three of them, Walaa, for the Spanish Government to AA and Walras, and Wallrd, are evolutionarily conserved in humans and displayed pref- DF (BFU2015-­67131P). VL, RM, KA, and MG were supported by the NIA erential atrial expression during embryogenesis. In addition, Walrad displayed IRP, NIH moderate expression during embryogenesis but was more abundant in the right atrium. Walaa, Walras and Wallrd were distinctly regulated by Pitx2, Wnt8, and Wnt11, and Wallrd was severely elevated in conditional atrium-­specific Pitx2-­ deficient mice. Furthermore, pro-­arrhythmogenic and pro-­hypertrophic substrate administration to primary cardiomyocyte cell cultures consistently modulate expression of these lncRNAs, supporting distinct modulatory roles of the AF cardiovascular risk factors in the regulation of these lncRNAs. Walras affinity Abbreviations: AF, atrial fibrillation; AngII, angiotensin II; ECG, electrocardiogram; GWAS, genome-­wide association study; HTD, hyperthyroidism; HTN, hypertension; LC/MS/MS, liquid chromatography/mass spectrometry/mass spectrometry; lncRNA, long non coding RNA; MS, mass spectrometry; NE, norepinephrine. This is an open access article under the terms of the Creat​ive Commo​ns Attri​bution-NonCo​mmercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes. © 2021 The Authors. The FASEB Journal published by Wiley Periodicals LLC on behalf of Federation of American Societies for Experimental Biology. FASEB J. 2022;36:e22051.  wileyonlinelibrary.com/journal/fsb2 | 1 of 24 https://doi.org/10.1096/fj.202100844RR | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 2 of 24    GARCÍA-­PADILLA et al. pulldown assays revealed its association with distinct cytoplasmic and nuclear proteins previously involved in cardiac pathophysiology, while loss-­of-­function assays further support a pivotal role of this lncRNA in cytoskeletal organiza- tion. We propose that lncRNAs Walaa, Walras and Wallrd, distinctly regulated by Pitx2>Wnt>miRNA signaling and pro-­arrhythmogenic and pro-­hypertrophic factors, are implicated in atrial arrhythmogenesis, and Walras additionally in car- diomyocyte cytoarchitecture. KEYWORDS atrial fibrillation, lncRNA, post-­transcriptional regulation 1 | I N T RO DU CT ION self-­perpetuating reduction of Pitx2 during AF progres- sion.10 Moreover, cardiovascular risk factors contribut- Atrial fibrillation (AF) is the most common cardiac ar- ing to increased frequency of AF onset in the human rhythmia, with an incidence of 2%–­3% in the general population, such as hypertension, hyperthyroidism and population that rises up to 8%–­10% in the elderly. Genetic antioxidant redox imbalance, consistently altered the linkage analyses have identified point mutations in sev- Pitx2>Wnt>microRNA pathway, underscoring a molec- eral ion channels with key roles in the configuration of ular link between these AF risk factors and specific cel- the cardiac action potential, suggesting that they are im- lular processes.11 plicated in AF. However, these genetic defects only ex- The past two decades have revealed that gene regula- plain a minority (<10%) of all AF cases. Seminal work by tory networks are profoundly influenced by novel types of Gudbjartsson et al.1 using genome-­wide association stud- non-­coding RNAs with regulatory potential. There is now ies (GWAS) revealed that risk variants in the 4q25 locus extensive evidence that microRNAs are essential regula- were highly associated to lone AF, postulating that reg- tors of cardiovascular development and diseases, includ- ulatory elements within this locus might influence ex- ing seminal studies on the role of microRNAs regulating pression of a neighboring gene encoding the homeobox cardiac ion channels and AF itself. The discovery of long transcription factor PITX2, in turn leading to impaired non coding RNAs (lncRNAs) has increased the complexity cardiac function and AF. Subsequent GWAS studies and of the non-­coding RNA regulatory roles. LncRNAs gener- meta-­GWAS analyses have increased exponentially our ally have no protein-­coding potential, yet many of them understanding of the plausible genetic substrates of AF, are structurally similar to mRNAs, including the presence with the identification of more than 90 risk variants asso- of 5′ terminal cap and 3′ terminal poly(A) tails and their ciated to AF.2 Importantly, in all cases the most significant transcription by RNA polymerase II.12 Similarly, most risk variants were those in the 4q25 locus. Experimental lncRNA genes comprise exons and introns and are often studies in mice have provided evidence that 4q25 physi- spliced. LncRNAs display lower expression levels and are cally interacts with the Pitx2 promoter,3,4 supporting key more tissue-­specific than protein-­coding mRNAs,13 sup- regulatory roles as suggested by Gudbjartsson et al.1 In porting the notion that they may have tightly defined roles addition, systemic Pitx2 loss-­of-­function experiments re- in different cellular events.14,15 LncRNAs can be localized vealed increased susceptibility to atrial arrhythmias,5,6 in both cytoplasm and nucleus; cytoplasmic lncRNAs while conditional atrial-­ specific deletion of Pitx2, re- are preferentially involved in post-­transcriptional regula- sulting in Pitx2 insufficiency, led to spontaneous atrial tion while nuclear lncRNAs are predominantly involved arrhythmias.7 in transcriptional regulation. Interestingly, lncRNAs can Subsequent studies demonstrated that Pitx2 in- translocate from the nucleus to the cytoplasm and act sufficiency led to remodeling of several meta-­GWAS-­ therein.16 associated genes, such as that encoding Wnt8, which in Distinct studies have investigated the functional role turn modulate Wnt11 expression, leading to microRNA of cardiac-­enriched lncRNAs during heart development, deregulation and hence impaired ion channels expres- i.e., Carmen, Braveheart, and Fendrr. Carmen, miR-­143 sion and function.7–­9 These data demonstrate a pivotal and miR-­145 are located within the same genomic locus, role of the Pitx2>Wnt>microRNA pathway modulat- but they are independently expressed.17,18 Expression of ing AF. In addition, experimentally induced AF leads Carmen in fetal and adult hearts is highly conserved in to Pitx2 downregulation, supporting the notion of a different mammalian species. Functionally, Carmen plays | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License GARCÍA-­PADILLA et al.    3 of 24 a pivotal role at the earliest lineage commitment steps, embryonic day (E) E12.5 to E18.5. Neonatal (1 day old) and modulating cardiac differentiation from initial mesoderm adult (>6 months) hearts were also collected. Pregnant by regulating Mesp1 expression.17 Similarly, Braveheart is females, adult and neonatal mice were euthanized by a key regulator in cardiac lineage commitment and its ab- cervical dislocation. Neonates were previously placed on lation leads to defective activation of key cardiac factors, ice. Subsequently, embryonic and postnatal hearts were heart development, and cardiomyocyte differentiation.19 dissected into right atrium, left atrium and ventricular Fendrr is transiently expressed at the posterior end of the chambers, pooled and stored in liquid nitrogen until used. forming lateral plate mesoderm, and is required for the Additionally, distinct tissues such as spleen, liver, lungs, proper development of the heart and body walls.20,21 We small and large intestine, kidney and brain were also dis- have recently demonstrated that these lncRNAs display a sected from adult mice, pooled and stored in liquid nitro- dynamic chamber-­specific expression, are distinctly reg- gen until used. ulated by cardiac enriched transcription factors such as The Pitx2floxed and NppaCre transgenic mouse lines Mef2c, Srf and Nkx2.5 and display distinct isoform usage and the generation of conditional atrial (NppaCre) mu- during cardiogenesis.22 tant mice were previously described.7,8,28,29 Two different In the context of AF, several reports have provided ev- conditions were used for the NppaCrePitx2 mice: wild-­ idence of altered expression of certain lncRNAs23–­26 but type Cre controls (NppaCre−Pitx2fl/fl) and atrial-­specific scarce information is available about their tissue distri- homozygous (NppaCre+Pitx2−/−). This investigation con- bution and regulatory mechanisms. Gore-­Panter et al.27 forms with the Guide for the Care and Use of Laboratory identified PANCR as an intergenic lncRNA expressed in Animals published by the US National Institutes of the adult left atrium from a region adjacent to PITX2, and Health. The study was approved by the University of Jaén is expressed in coordination with PITX2C mRNA during Bioethics Committee. cardiomyocyte differentiation. Importantly, PANCR is ex- pressed in human tissues but no orthologues have been found in other species.27 2.2 | Mouse genotyping and phenotyping In this study, we have investigated the expression of lncRNAs via processes regulated by Pitx2>Wnt>miRNA. DNA for PCR screening was extracted from adult ear In silico analyses of annotated lncRNAs expressed from and/or tail samples. Screening of Cre and Pitx2 floxed al- the vicinity of Pitx2, Wnt8 and Wnt11 chromosomal loci leles was routinely done using used specific primers as identified five novel lncRNAs showing differential ex- previously described.7 Cycling conditions for Cre DNA pression levels during cardiac development in mice and were as follows: 5 min at 95°C, 35 cycles of 30 s at 95°C, some of them are also evolutionarily conserved in hu- 30 s at 60°C and 90 s at 72°C: and for Pitx2 DNA as fol- mans. Three of them displayed preferential atrial-­specific lows: 5 min at 95°C, 40 cycles of 30 s at 95°C, 30 s at expression during embryogenesis and were distinctly reg- 60°C and 90 s at 72°C, followed by a final extension step ulated by Pitx2, Wnt8 and Wnt11 as well as by microR- of 10 min at 72°C. In addition, the expression levels of NAs such as miR-­1, miR-­133 and miR-­29. Furthermore, Pitx2 mRNA in left atrial samples of wild-­type Cre con- pro-­arrhythmogenic and pro-­ hypertrophic substrates trols (NppaCre2Pitx2fl/fl) and atrial-­specific homozygous such as angiotensin II, norepinephrine and thyroid hor- (NppaCre+Pitx2−/−) were assessed by RT-­qPCR analysis, mone administration distinctly regulate their expression. displaying in all cases 60%–­70% reduction in PITX2c ex- Walras pulldown and loss-­ of-­ function assays further pression in NppaCre+Pitx2−/− samples. demonstrate a key role of this lncRNA in cardiomyocyte cytoskeletal organization. In summary, we have identified novel lncRNAs with enhanced atrial expression that are 2.3 | Mouse tissue samples distinctly regulated by signaling pathways leading to atrial arrhythmogenesis. Genetically modified transgenic Pitx2 mice and their corresponding controls were sacrificed by cervical dislo- cation. Adult hearts were carefully dissected and briefly 2 | M AT E R IALS AN D M ET H OD S rinsed in Ringer's solution. Left atrium tissue samples were collected for each experimental condition, immedi- 2.1 | Mouse breeding and tissue ately snap-­frozen in liquid nitrogen, and stored at −80°C sampling until used. Pooled samples of at least three independent mice were processed for each condition, respectively. CD1 mice were bred and embryos were collected at dif- Three independent pooled samples were further pro- ferent embryonic developmental stages, ranging from cessed for RNA isolation and RT-­qPCR analysis. | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 4 of 24    GARCÍA-­PADILLA et al. 2.4 | Human atrial biopsies are provided in Table S2. No amplifications were ob- served in PCR control reactions containing only water as Atrial myocardial tissue samples were obtained from pa- the template. Each PCR reaction was performed at least tients undergoing cardiac surgery at Hospital de la Santa three times to obtain representative averages. The Livak Creu i Sant Pau (Barcelona). Specimens were obtained method was used to analyze the relative quantification from the right atria just prior to atrial cannulation for car- RT-­PCR data30 and normalized in all cases taking as 100% diopulmonary bypass. After excision, samples were rap- the wild-­type (control) value, as previously described.7 idly frozen in liquid nitrogen and stored at −80°C until analyzed. The atrial samples were classified as patients with (AF; n = 4) and without (No AF; n = 3) a recorded 2.7 | qPCR analyses (microRNA) history of AF. Clinical data are presented in Table S1. Although the atrial tissue samples consisted of tissue that microRNA RT-­qPCR was performed using Exiqon LNA would normally be discarded during surgery, permission microRNA reverse transcription (RT) followed by real-­ to be used in this study was obtained from each patient. time quantitative (q) PCR primers and detection kit ac- The study was approved by the Ethical Committee of the cording to the manufacturer's guidelines. All reactions Hospital de la Santa Creu i Sant Pau (Barcelona) and the were always run in triplicate using 5S as normalizing con- investigation conforms with the principles outlined in the trol, as recommended by the manufacturer. SyBR Green Declaration of Helsinki. was used as quantification system on a Stratagene Q-­Max 2005P RT-­ qPCR thermocycler. Relative measurements were calculated as described by Livak and Schmittgen30 2.5 | RNA isolation and cDNA synthesis and control measurements were normalized to represent 100% as previously described.7 Total RNA was isolated using Trizol (Roche) according to manufacture's guidelines and DNase treated using RNase-­ Free DNase (Roche) for 1 h at 30°C. In all cases, at least 2.8 | Plasmid, siRNA, microRNA mimics three distinct pooled samples were used to perform the cell transfections corresponding RT-­qPCR experiments. First strand cDNA was synthesized at 50°C for 1 h HL1 cells (6 × 105 cells per well) were transfected with plas- using 1 μg of RNA, oligo-­dT primers and Superscript III mids containing expression constructs for Pitx2c, Wnt8a Reverse Transcriptase (Invitrogen) according to manu- (Addgene), Wnt11a (Addgene, Cambridge, MA, USA) facture's guidelines. Negative controls to assess genomic and with pre-­miR-­1, pre-­miR-­133, pre-­miR-­29 (Exiqon) contamination were performed for each sample, without or siRNA-­Pitx2c, siRNA-­Wnt8a, siRNA-­Wnt11a, siRNA-­ reverse transcriptase, which resulted in all cases in no de- Gm44934/Walras (Sigma, Aldrich, Munich, Germany), tectable amplification product. respectively, as previously described.6,7 siRNA sequences are provided in Table S3. 2.6 | qPCR analyses (mRNA and lncRNA) 2.9 | Immunofluorescence analyses RT-­PCR was performed in Mx3005Tm QPCR System with Control and experimentally siRNA treated cells were col- an MxPro QPCR Software 3.00 (Stratagene) and SyBR lected after the corresponding treatment, rinsed in PBS for Green detection system. Reactions were performed in 96-­ 10 min at room temperature, and fixed with 1% PFA for well plates with optical sealing tape (Cultek) in 20 μl total 2 h at 4°C. After fixation, the samples were rinsed three volume containing SYBR Green Mix (Finnzymes) and the times (10 min each) in PBS at room temperature and then corresponding cDNA. Two internal controls, mouse Gusb permeabilized with 1% Triton X-­100 in PBS for 30 min at and Gapdh mRNAs, were used in parallel for each run room temperature. To block nonspecific binding sites, and represented as previously described.8,9 Amplification PBS containing 5% goat serum and 1% bovine serum albu- conditions were as follows: denaturalization step of 95°C min (Sigma) was applied to the cell cultures overnight at for 10 min, followed by 40 cycles of 95°C for 30 s, 60°C 4°C. Phalloidin-­Atto 488 (Sigma) was used, diluted (5 mg/ for 30 s, 72°C for 30 s; with final elongation step of 72°C ml) in PBS, and applied to each culture overnight at 4°C. for 10 min. All primers were designed to span exon-­exon Subsequently, the samples were rinsed three times (for 1 h boundaries using online Primer3 software Primer3input each) in PBS to remove excess Phalloidin-­Atto 488. Finally, (http://bioin​fo.ut.ee/prime​r3-­0.4.0/). Primer sequences they were incubated with DAPI (1:1000; Sigma) for 7 min | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License GARCÍA-­PADILLA et al.    5 of 24 at room temperature and rinsed three times in PBS for For MS analysis, peptide mixtures from each sample 5 min each. Alternatively to Phalloidin-­Atto 488 staining, were loaded onto a peptide trap cartridge and eluted onto a control and experimentally siRNA treated cells were im- reversed-­phase PicoFrit column (New Objective, Woburn, munofluorescently labelled to detect ACTN1, ACTN4 and MA, USA). Eluted peptides were ionized and sprayed into MHY9 expression, respectively. Primary antibodies against the mass spectrometer, using a Nanospray Flex Ion Source ACTN1 (ab68194), ACTN4 (ab108198), MYH9 (ab75590) ES071 (Thermo Scientific). The LC/MS/MS analysis of were used, diluted (1:200) in PBS, and applied to each cul- samples were carried out using a Thermo Scientific Q-­ ture overnight at 4°C, respectively. Subsequently, the sam- Exactive hybrid Quadrupole-­Orbitrap Mass Spectrometer ples were rinsed three times (for 1 h each) in PBS to remove and a Thermo Dionex UltiMate 3000 RSLCnano System. excess primary antibody and incubated 2 hours at room Proteins were identified using the Thermo Proteome temperature with Alexa-­Fluor 546, 488 and 633 anti-­rabbit Discoverer 1.4.1 platform. Database search against pub- (1:100; Invitrogen) as secondary antibody. Cell cultures lic mouse protein database from NCBI was performed were stored in PBS in darkness at 4°C until analysed using through the Proteome Discoverer 1.4.1 platform. a Leica TCS SP5 II confocal scanning laser microscope. 2.13 | miRNA pull down assays 2.10 | Cell culture and angiotensin II, norepinephrine and thyroid Biotinylated miR-­29 was synthesized by IDT technologies. hormone treatment Whole-­cell lysates (500 μg) from HL1 cells were incubated with 1 μg of biotinylated RNA for 2 h at room tempera- Primary cultures of mouse fetal (E17.5) cardiomyocytes ture. Complexes were isolated with Streptavidin-­coupled were isolated using standard procedures,31 cultured ac- Dynabeads (Invitrogen) following the protocol published cordingly and treated with 1 μM angiotensin II (AngII), by Panda et al.34 RNA associated to biotinylated miR-­29 100 μM norepinephrine (NE) and 10 nM thyroid T3/T4 was isolated using Direct-­zol™ RNA Miniprep Plus (Zymo hormone, respectively, as previously reported.9,32,33 research) following the manufacturer´s instructions and RT-­qPCR was subsequently performed as detailed above. Biotinylated miR-­23 was used as a negative control. 2.11 | Nuclear/cytoplasmic distribution Cytoplasmic and nuclear RNA fractions from atrial and 2.14 | RIP assay ventricles samples were isolated with Cytoplasmic & Nuclear RNA Purification Kit (Norgen, Belmont, CA, For immunoprecipitation of endogenous ACTN1, ACTN4 USA) following the manufacturer's instructions. After and MHY9 cytoskeleton proteins, HL1 cells were lysed with RNA isolation, RT-­qPCR analysis for nuclear enriched PEB buffer for 10 min on ice and centrifuged at 10 000 g Rpb1 mRNA marker and cytoplasmic Gapdh mRNA for 15 min at 4°C. The supernatants were incubated with marker were performed to validate enrichment on each protein A Sepharose beads (Abcam) coated with antibod- subcellular fractions. RT-­qPCR analysis of distinct lncR- ies that recognized ACTN1, ACTN4, MYH9 or control IgG NAs was subsequently performed as detailed above. (Abcam) for 2 h at 4°C, respectively. The corresponding beads were washed with NT2 buffer (50 mM Tris–­HCl [pH 7.5], 150 mM NaCl, 1 mM MgCl2, 0.05% NP-­40). Protein 2.12 | lncRNA pull down assays complexes were incubated with 20 units of DNase I (15 min at 37°C). In this step, an aliquot from each reaction was iso- Biotinylated RNA of exon 1 and exon2 of Gm_44934 of lated for Western blot validation. Subsequently they were Exon 1 and Exon 2 were synthesized from PCR frag- further incubated with 0.1% SDS/0.5 mg/ml Proteinase ment using specific forward primers that contained K (30 min at 55°C) to remove DNA and proteins, respec- the T7 RNA polymerase promoter sequence [(T7), tively. The RNA isolated from the IP materials were further CCAAGCTTCTAATACGACTCACTATAGGGAGA]. assessed by RT-­qPCR analysis. After purifying the DNA template, biotinylated transcripts were synthesized using MaxiScript T7 kit (Ambion); whole-­cell lysates (500 μg) from HL1 cells were incubated 2.15 | Western blot with 1 μg of biotinylated RNA for 2 h at room tempera- ture. Complexes were isolated with Streptavidin-­coupled For western blot analysis, 10% of total IP lysate was Dynabeads (Invitrogen) and analyzed by MS. used. Primary antibodies recognizing ACTN1 (ab68194), | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 6 of 24    GARCÍA-­PADILLA et al. ACTN4 (ab108198), MYH9 (ab75590) from Abcam were E16.5 (Figure 1F). In all cases, expression in neonatal and used. After incubation with the rabbit secondary antibod- adult heart was markedly lower than in embryonic heart. ies, protein signals were developed using HRP. Importantly, Walrad displayed preferential expression in the right atrium in all stages analyzed (Figure 1C), includ- ing adulthood, but also presented a transient peak expres- 2.16 | Statistical analyses sion at neonatal stages in the ventricular chambers. By contrast, Walce was preferentially expressed in embryos For statistical analyses of datasets, unpaired Student's but was not restricted to the atrial chambers (Figure 1E), ­t-­tests were used. Significance levels or p values are stated showing a dynamic expression pattern in right atrium, in each corresponding figure legend. p < .05 was consid- left atrium and ventricular tissues at different develop- ered statistically significant. mental time points. Playrr displayed a prominent expres- sion in the early developmental stages declining during development (Figure 1G). Curiously, expression of these 3 | R E S U LTS lncRNAs is significantly different from the expression of Wnt8 and Wnt11 mRNAs expression during cardiogene- 3.1 | Identification of novel sis, as illustrated in Figure 1H–­I. Expression of these five lncRNAs putatively involved in the distinct lncRNAs is not restricted to the heart, since all but Pitx2>Wnt>microRNA pathway Walce are also expressed in distinct adult tissues such as spleen, liver, lungs, gut, kidney and brain as depicted in Previous studies have demonstrated that some long non Figure 2A–­F. Walce expression is restricted to the heart coding RNAs act locally regulating neighboring genes.35–­38 and spleen (Figure 2D). Importantly, Wnt8 mRNA is also We therefore examined the mouse genome to identify broadly expressed in distinct adult tissues (Figure 2H), lncRNAs in close vicinity to genes previously identi- while Wnt11 mRNA is primarily expressed in the heart fied to play a pivotal role in the onset of AF, particularly and brain, with low, but detectable levels in spleen and Pitx2>Wnt>microRNA pathway.7–­9 In particular, we lungs (Figure 2G). In summary, we identified novel ln- searched for lncRNAs expressed from regions close to cRNAs with wide distribution in adult tissues and impor- the Pitx2, Wnt8 and Wnt11 loci. We did not find novel tantly, three of them, Walaa, Walras and Wallrd, display lncRNAs near the Pitx2 locus, besides the previously re- preferential expression in the embryonic atrial chambers ported Playrr lncRNA,39 but we identified two lncRNAs and one of them, Walrad, with preferential expression in adjacent to Wnt8 and four near Wnt11 genes, respectively the adult right atrium during cardiogenesis. Furthermore, (Figure 1A; Table 1). Three of them, i.e., Walras, Wallrd their expression profile, both in different adult tissues as and Walce are evolutionarily conserved in humans (Figure well as during cardiogenesis, is markedly distinct from S1). In particular, Walras displayed significant homology, those of Wnt8 and Wnt11 mRNAs, supporting the notion ranging from 25% to 43%, with three distinct human lncR- that they might not directly regulate Wnt expression. NAs (AP0002340.1, AP000785.1 and LINC02761). Wallrd isoforms also displayed significant homology, ranging from 33% to 45%, with AC13382.1, AC13382.2 and AC104116.1, 3.2 | Differential spatio-­temporal nuclear respectively. Finally, Walce display significant homology vs cytoplasmic localization of these novel (35%) with Wnt11_03 human lncRNA (Figure S1). lncRNAs support both transcriptional and We then measured the levels of expression of these ln- post-­transcriptional regulatory function cRNAs in the right and left atria and in ventricular tissues of mouse embryos ranging from E12.5 to E18.5, neonate LncRNAs can reside in both the nucleus and the cytoplasm, and adult tissues. Among the six lncRNAs interrogated, exerting distinct regulatory functions in each compart- including Playrr, only five of them were detectable in ment. We thus measured the relative abundance of these cardiac tissues (Figure 1B–­ F). Three of them (Walaa, lncRNAs in the nucleus and cytoplasm by RT-­qPCR analy- Walras and Wallrd) displayed a preferential embryonic sis using Rpb1 mRNA for normalization22 (Figure S2). The expression confined to the atrial chambers with only low nuclear and cytoplasmic distribution was analyzed in three ventricular expression. Interestingly, Walaa displayed distinct cardiac compartments of E14.5 mouse embryos a similar atrial-­specific expression in both right and left and neonatal mice: right atrium, left atrium and ventricles. atrial chambers, peaking at E16.5 (Figure 1B), Walras dis- Walas displayed similar nuclear vs cytoplasmic distribu- played a left atrial-­restricted expression (Figure 1D), with tion in the left atrium in both embryonic and adult stages, peak levels at E16.5, while Wallrd also displayed atrial-­ while it was prominently nuclear in the embryonic and restricted expression, preferentially in the left atrium, at adult ventricles. Importantly, a rise in cytoplasmic levels of | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License GARCÍA-­PADILLA et al.    7 of 24 (A) (B) (C) (D) (E) (F) (G) (H) (I) F I G U R E 1 (A) Schematic representation of the mouse chromosomal localization of lncRNAs situated in the vicinity of Pitx2, Wnt11 and Wnt8 genes. (B–­G) RT-­qPCR analyses of Walaa, Walras, Wallrd, Walrad, Walce and Playrr expression levels. We note observe atrial expression of Walaa, Walras and Wallrd during cardiogenesis, while Walrad is mainly expressed in the left atrium in the adulthood. (H–­I) Rt-­qPCR analyses of Wnt11 and Wnt8a expression during cardiogenesis. Three embryonic hearts were pooled on each developmental time and three distinct neonatal and adult hearts were used for RNA isolation, respectively. Three independent biological assays were analyzed in each case | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 8 of 24    GARCÍA-­PADILLA et al. TABLE 1 Transcripts and gene localization data of novel identified lncRNAs LncRNA LncRNA name name (new) (previous) Transcript number Type Cromosome position Isoforms Bps Walras Gm 44934 ENSMUST00000208941.1 LincRNA Chromosome 7: 98,734,747-­ 1 238 98,735,081 reverse strand Walaa Gm 45188 ENSMUST00000207592.1 LncRNA Chromosome 7: 98,895,930-­ 1 1369 98,899,545 forward strand Walrad Gm 44653 ENSMUST00000208543.1 LncRNA Chromosome 7: 98,720,057-­ 1 4610 98,728,760 reverse strand Walce Wnt11_06 ENSMUST00000208062.1 LncRNA Chromosome 7: 98,835,112-­ 1 745 98,855,195 forward strand. Wallrd 2010110K18Rik ENSMUST00000181453.2 LncRNA Chromosome 18: 34,751,809-­ 3 2398 ENSMUST00000181641.1 34,758,685 forward strand 678 ENSMUST00000236940.1 490 Walas was observed from embryonic to neonatal stages in (Figure 4A). Wnt8a overexpression significantly decreased the right atrium (Figure 3A). Walrad was prominently nu- all lncRNAs analyzed except Wallrd. Wnt8a siRNA silenc- clear in both embryonic and neonatal stages in the left and ing significantly decreased Walaa and Walras, upregulated right atria, while similar nuclear/cytoplasmic distribution Walce while Walrad and Wallrd displayed no significant was observed in the embryonic and neonatal ventricles differences (Figure 4B). On the other hand, Wnt11 over- (Figure 3B). Walras displayed no significant differences in expression significantly upregulated all lncRNAs analyzed the left atrium at both stages analyzed, while in the right except Walaa, which was downregulated. Importantly, atrium and ventricle it was prominently nuclear in the silencing Wnt11 using small interfering (si)RNA also up- embryonic stages whereas there were no significant differ- regulated all lncRNAs analyzed except Walras (Figure 4C). ences in the neonatal stage (Figure 3C). Walce displayed a Control experiment of gain-­and loss-­of-­function are pro- prominent nuclear distribution in the left atrium at both vided in Figure 4A–­C (right). These data indicate that stages, but no significant differences in the right atrium Pitx2, Wnt8a and Wnt11 influenced the expression levels and ventricles (Figure 3D). Wallrd displayed similar nu- of these lncRNAs. Moreover, Pitx2 silencing upregulated clear and cytoplasmic expression levels in the embryonic Walrad and Walce, while Wnt8 and Wnt11 overexpres- and adult left atrium and ventricles. Importantly, however, sion displayed complementary patterns on the regulation Wallrd shifted from being primarily cytoplasmic in the em- of Walrad and Walce expression, in line with our previ- bryonic right atrium to being mostly nuclear in the adult ous findings in NppaCrePitx2−/− mice.7 In addition, it is ventricles (Figure 3E). Finally, Playrr displays similar nu- importantly to note that both Pitx2 overexpression and clear vs cytoplasmic distribution at all tissues and stages silencing similarly affected lncRNAs, demonstrating that analyzed except in the embryonic left atrium where it is even subtle changes in Pitx2 expression greatly influenced prominently nuclear (Figure 3F). Overall, these data dem- lncRNA abundance, although the precise regulatory mo- onstrate distinct spatio-­temporal and subcellular distribu- lecular mechanisms remain to be elucidated. tion for these lncRNAs, suggesting chamber-­specific shifts To further support the notion that Pitx2 regulates the in their transcriptional vs post-­transcriptional regulatory expression of these lncRNAs, we measured lncRNA lev- roles during cardiac development. els of these lncRNAs in conditional Pitx2 mouse model NppaCrePitx2−/−. Left atrial samples were used to verify Pitx2 loss-­of-­function by measuring Pitx2c mRNA levels 3.3 | LncRNA regulatory roles exerted by using RT-­qPCR analysis (Figure 4D). As previously re- Pitx2, Wnt8 and Wnt11 ported, NppaCrePitx2−/− mice displayed 70%–­80% reduc- tion of Pitx2c mRNA expression levels in the left atrial To dissect the functional roles of Pitx2, Wnt8 and Wnt11 chamber (Figure 4D, right), leading to Pitx2 insufficiency. in the regulation of these newly identified lncRNAs, over- In this context, Walaa was severely upregulated, Wallrd expression and silencing experiments were carried out in moderately upregulated, while Walrad was downregulated, atrial HL1 cardiomyocytes. and Walras and Walce displayed no significant differences Pitx2c overexpression and silencing significantly up- in abundance (Figure 4D). These data support our earlier regulated Walaa, Walrad and Walce, downregulates observations in HL1 cardiomyocytes that Pitx2 regulates Wallrd while Walras display no significant differences Walaa but not Walras. The surprising finding that Walrad | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License GARCÍA-­PADILLA et al.    9 of 24 (A) (B) (C) (D) (E) (F) (G) (H) F I G U R E 2 (A–­H) RT-­qPCR analyses of Walaa, Walras, Wallrd, Walrad, Walce, Playrr, Wnt8a, and Wnt11 expression levels in different organs (heart, spleen, liver, lung, small intestine, large intestine, kidney, and brain) in the adult mouse. Note that Walaa, Walras, Wallrd, Walrad, Playrr, and Wnt8a are widely distributed in different organs, while Walce is essentially confined to the spleen and heart, and Wnt11 to the heart and brain with just detectable levels in the spleen and lungs. Three independent adult tissues were used for RNA isolation, respectively. Three independent biological assays were analyzed in each case | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 10 of 24    GARCÍA-­PADILLA et al. (A) (D) (B) (E) (C) (F) F I G U R E 3 (A–­F) Nuclear vs cytoplasmic distribution of Walas, Walrad, Walras, Walce, Wallrd and Playrr in the embryonic and neonatal right atrium, left atrium and ventricles, respectively. Differential nuclear vs cytoplasmic subcellular distribution was observed for Walas, Walras and Wallrd in the right atrium of both embryonic and neonatal hearts, while Walras only displayed it in the embryonic right atrium. Walas displayed enhanced nuclear localization in the embryonic and neonatal ventricles while Walras only did in the embryonic ventricle. Walrad and Walce displayed enhanced nuclear vs cytoplasmic localization in embryonic and neonatal left atrium. Five to ten embryonic right atrial, left atrial or ventricles were pooled on each developmental staged, respectively and used for RNA isolation. Three independent biological assays were performed on each case. Statistical analyses was performed using unpaired Student's t-­test. *p < .05, **p < .01, ***p < .005. eLA_N, embryonic left atrium, nuclear, eLA_C, embryonic left atrium, cytoplasmic, eRA_N, embryonic right atrium, nuclear, eRA_C, embryonic right atrium, cytoplasmic, eV_N, embryonic ventricle, nuclear, eV_C, embryonic ventricle, cytoplasmic, nLA_N, neonatal left atrium, nuclear, nLA_C, embryonic left atrium, cytoplasmic, nRA_N, neonatal right atrium, nuclear, nRA_C, neonatal right atrium, cytoplasmic, nV_N, neonatal ventricle, nuclear, nV_C, neonatal ventricle, cytoplasmic and Wallrd display opposite patterns in NppaCrePitx2−/− were subsequently scrutinized. Our data demonstrate mice and HL1 Pitx2 siRNA assays demonstrate that addi- that AP00785.1 displayed no significant differences while tional studies are required to clarify this point. AP002340.1 is significantly decreased while AC1040116.1 Since we identified plausible human lncRNAs ho- was significantly increased in AF as compared to no AF pa- mologues for Walras, Wallrd and Walce, we also investi- tients (Figure 4E). The other identified human homologues gated if these conserved lncRNAs are deregulated in AF displayed no detectable expression (data not shown). patients. Right atrial biopsies of AF and no AF patients Therefore these data further confirmed the upregulation | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License GARCÍA-­PADILLA et al.    11 of 24 (A) (A') (B) (B') (C) (C') (D) (D') (E) F I G U R E 4 (A–­C) Right, RT-­qPCR analyses of the levels of Walaa, Walrad, Walras, Walce and Wallrd after overexpression or silencing of Pitx2, Wnt8 and Wnt11, respectively. Left, levels of Pitx2, Wnt8 and Wnt11 mRNAs after overexpression and silencing. (D) Right, Expression levels of Walaa, Walras and Wallrd in NppaCrePITX2−/− adult left atrial chambers; Left, Pitx2c mRNA levels in NppaCrePITX2−/− adult left atrial chambers. (E) Expression levels of AP00785.1, AP0002340.1 (Walras human homologue) and AC1040116.1 (Wallrd human homologue) in human right atrial biopsies of patients with sinus rhythm (RsD) (i.e., no AF) and atrial fibrillation (AF), respectively. Three independent siRNA and overexpression assays were analyzed in each case. Similarly, at least three independent biopsies corresponding to each condition were analyzed in each case. Statistical analyses were performed using unpaired Student's t-­test. *p < .05, **p < .01, ***p < .005, ***p < .001 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License GARCÍA-­PADILLA et al. (D) (H) (E) (F)    (G) (A) (B) (C) (I) |12 of 24 | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License GARCÍA-­PADILLA et al.    13 of 24 F I G U R E 5 RT-­qPCR analysis of the abundance of lncRNAs after elevating miR-­1, miR-­29 and miR-­133 in HL1 atrial cardiomyocytes. (A–­F) RT-­qPCR analysis of Walaa, Walras, Wallrd, Walrad, Walce, and Playrr in cells overexpressing miR-­1, miR-­29 and miR-­133, respectively. miR-­1 increased Walaa and Wallrd but decreased Walrad and Playrr. miR-­29 overexpression elevated Walaa and reduced Walras and Playrr. miR-­ 133 significantly suppressed Walaa, Walras and Playrr. (G) Levels of miR-­1, miR-­29, and miR-­133 after ectopic overexpression. (H) represents miR29 pull-­down assays, which did not influence Walaa, Walras and Wallrd interactions. (I) represents MECOM and C-­Rel1 predicted binding sites on the upstream regulatory regions (−10 Kb) of Walaa, Walras and Playrr, respectively and their RT-­qPCR expression after miR-­133 and miR-­29 overexpression. Three independent microRNA overexpression assays were analyzed in each case (A–­E). Three independent pull-­down assays were analyzed (F). Statistical analyses were performed using unpaired Student's t-­test. **p < .01, ***p < .005, ***p < .001 of Walrrd in both experimental and human AF conditions, we demonstrate that miR-­133 and miR-­29 significantly while Walras display downregulation in human AF but not impaired the expression levels of MECOM and c-­Rel, in mice. respectively. MECOM and c-­Rel transcriptional binding sites are broadly identified within the proximal Walras, Walras and Playrr regulatory elements (10 Kb upstream 3.4 | AF related microRNAs modulate the transcriptional start site) (Figure 5I). In sum, these lncRNA expression data indicate that distinct microRNAs exert different reg- ulatory properties upon these lncRNAs and further sup- We have previously shown that signaling through port a plausible functional role of these lncRNAs in the Pitx2>Wnt regulates the expression of a large subset Pitx2>Wnt>microRNA pathways, previously reported to of microRNAs with pivotal roles regulating ion chan- play a fundamental role in the onset of AF. nel expression/function and thus has an important impact on the onset of atrial arrhythmogenesis.7–­9 We therefore tested if AF-­related microRNAs such as miR-­ 3.5 | Thyroid hormone administration 1, miR-­133 and miR-­29 are capable of modulating the distinctly regulated AF-­associated lncRNAs expression of these lncRNAs. It is important to high- light that microRNA-­ lncRNA interaction algorithms Impaired thyroid levels have been consistently reported such as DIANA software (http://carol​ ina.imis.athen​ as a cardiovascular risk factor associated with increased a-­i nnov​a tion.gr/diana_tools/ ​ w eb/index.php?r=lncba​ prevalence of atrial arrhythmias40,41 and hypertrophy.42–­44 sev2%2Find ​ e xpre ​ d icte ​ d &miRNA ​ s %5B%5D=&lncRN​ Therefore, we tested whether T3 and T4 administration in As%5B%5D=&thres​ hold=0.7&filte​ rs=0) failed to pre- primary cultures of fetal cardiomyocytes might modulate dict any putative binding of these microRNAs in these the levels of these lncRNAs. Our data show that Walaa lncRNAs. We overexpressed these microRNAs in HL1 abundance is reduced following administration of T4 but not atrial cardiomyocytes and measured lncRNA expression T3 (Figure 6A). On the other hand, administration of both levels by RT-­qPCR analysis (Figure 5G). We found that T3 and T4 significantly increased the expression of Walras ectopic expression of miR-­1 and miR-­29 increased the and Walce while it decreased the expression of Wallrd levels of Walaa, while miR-­133 treatment decreased it (Figure 6A). No significant differences were observed for (Figure 5A). Walrad was only downregulated by miR-­1 Walrad, while Playrr was only downregulated by T4 admin- while miR-­29 and miR-­133 resulted in no significant dif- istration (Figure 6A). Thus, thyroid administration modu- ferences (Figure 5B). miR-­133 and miR-­29 administra- lates AF-­associated lncRNAs, supporting the notion that tion reduced Walras levels in HL1 cardiomyocytes, while these lncRNAs are involved in AF pathophysiology. miR-­1 had no effect on Walras abundance (Figure 5C). Walce was not altered by overexpression of any of the tested microRNAs (Figure 5D). Finally, miR-­1 upregu- 3.6 | Angiotensin II (AngII) and lates Wallrd expression while miR-­133 and miR-­29 ad- norepinephrine (NE) treatment ministration leads to no significant changes (Figure 5E). significantly upregulated In addition, we also found that Playrr was significantly AF-­associated lncRNAs downregulated by miR-­ 1, miR-­ 133 and miR-­ 29 over- expression (Figure 5F). Pulldown analysis using bioti- We previously reported that AF-­associated cardiovascular nylated miR-­29 revealed that the impact of miR-­29 upon risk factors, such as hyperthyroidism and hypertension, dis- Walaa and Walras levels was indirect (Figure 5H). A tinctly modulate signaling through Pitx2>Wnt>microRNA. plausible indirect mechanism might be that microR- Accordingly, we tested if these newly identified lncRNAs NAs distinct regulate upstream regulatory transcription are regulated by AngII and/or NE administration. Primary factors involved in lncRNA regulation. In this context, cultures of fetal cardiomyocytes were treated with AngII | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 14 of 24    GARCÍA-­PADILLA et al. (A) (B) F I G U R E 6 (A) RT-­qPCR analyses of the levels of Walaa, Walrad, Walras, Walce, Wallrd, and Playrr after T3 or T4 thyroid hormone administration in HL1 atrial cardiomyocytes, respectively. T3 administration significantly suppressed Walaa and Wallrd levels and increased Walras and Walce levels while T4 administration increased Walras and Walce but downregulated Playrr while no changes are observed for Walaa, Walrad and Wallrd. (B) RT-­qPCR analyses of the levels of Walaa, Walras, and Wallrd after angiotensin II (AngII) or norepinephrine (NE) administration. Both, AngII and NE treatments enhances Walaa, Walras and Wallrd expression. Three independent assays were analyzed in each case. Statistical analyses were performed using unpaired Student's t-­test. *p < .05, ***p < .005, ***p < .001 and NE, respectively, as previously reported,8 and lncRNA proteins interacting with it. To this end, we prepared expression was assessed by RT-­qPCR analysis. Our data in- lysates from HL1 cells and biotinylated Walras. After in- dicate that AngII and NE administration, respectively, sig- cubation, lncRNA-­protein complexes were pulled down nificantly enhanced the levels of Walaa, Wallrd and Walras and the associated proteins were identified by LC-­MS/ (Figure 6B). In line with our previous findings after thyroid MS. A total of 40 proteins significantly interacting with hormone administration, these data therefore support a Walras were identified (Table 2). Among them, ~40% plausible role of these lncRNAs in AF pathophysiology. were cytoplasmic proteins, 12% were nuclear and 20% mi- tochondrial, supporting a function dual role for Walras in the nucleus and cytoplasm, in line with our nuclear/ 3.7 | Walras lncRNA pull down assays cytoplasmic distribution analyses (Figure 3C). Among the cytoplasmic proteins, Walras associated with three dis- To examine more deeply the function of the atrium-­ tinct myosin proteins, MYH6, MYH9 and MYH10; inter- specific Walras lncRNA, we sought to identify the estingly, MYH6 is a structural protein that forms part of TABLE 2 Identification of Walras interacting proteins as revealed by pull-­down assays followed by LC-­MS/MS analyses Accessiona UniprotKB-­ID Gene Short-­name Subcellular location Gene ontology (roles) 71152969 Q61879 MYH10 Myosin-­10 Cytoplasm, cell projection, lamellipodium Actin cytoskeleton organization 205371802 Q8VDD5 MYH9 Myosin-­9 Cytoplasm, cytoskeleton Actin cytoskeleton reorganization 3024204 Q02566 MYH6 Myosin-­6 Cytoplasm, myofibril. Note=Thick filaments of Actin filament-­based movement GARCÍA-­PADILLA et al. the myofibrils 146345422 P06745 G6PI Glucose-­6-­phosphate isomerase Cytoplasm. Secreted Angiogenesis 146345481 P09411 PGK1 Phosphoglycerate kinase 1 Cytoplasm Glycolytic process 13123946 P57780 ACTN4 Alpha-­actinin-­4 Cytoplasm Actin filament bundle assembly 341940814 Q9D379 HYEP Epoxide hydrolase 1 Microsome membrane; Single-­pass type II Aromatic compound catabolic membrane protein. ER membrane process 224471907 Q9WTP6 KAD2 Adenylate kinase 2, mitochondrial Mitochondrion intermembrane space ADP biosynthetic process 124028629 O88569 ROA2 Heterogeneous nuclear ribonucleoproteins A2/B1 Nucleus, nucleoplasm. Cytoplasm mRNA processing 46397834 P51150 RAB7A Ras-­related protein Rab-­7a Cytoplasm vesicle, phagosome membrane Bone resorption 48429104 P61979 HNRPK Heterogeneous nuclear ribonucleoprotein K Cytoplasm mRNA processing 115718 P18242 CATD Cathepsin D Lysosome. Melanosome Autophagosome assembly 353526354 P17751 TPIS Triosephosphate isomerase Mitochondrion matrix Gluconeogenesis 60390645 Q9DCN2 NB5R3 NADH-­cytochrome b5 reductase Isoform 1: ER membrane Cholesteriol biosynthetic process 46395721 Q7TPR4 ACTN1 Alpha-­actinin-­1 Cytoplasm, cytoskeleton Actin crosslink formation 20178035 Q9DBJ1 PGAM1 Phosphoglycerate mutase 1 Mitochondrion matrix Glycolytic process 338817898 P05201 AATC Aspartate aminotransferase, cytoplasmic Cytoplasm 2-­oxoglutarate metabolic process 267190 Q02053 UBA1 Ubiquitin-­like modifier-­activating enzyme 1 Cytoplasm Cellular response to DNA damage stimulus 94730421 Q99P72 RTN4 Reticulon-­4 ER membrane Axonal fascilutaion 5915871 O35887 CALU Calumenin ER lumen. Melanosome Peripheral nervous system axon regeneration 52000730 Q921G7 ETFD Electron transfer flavoprotein-­ubiquinone Mitochondrion inner membrane Electron transport chain oxidoreductase, mitochondrial 124964 P09055 ITB1 Integrin beta-­1 Cell membrane Axon extension 1350822 P49312 ROA1 Heterogeneous nuclear ribonucleoprotein B Nucleus. Cytoplasm. Shuttles continuously Alternative mRNA splicing, via between the nucleus and the cytoplasm spliceosome 549057 P80315 TCPD T-­complex protein 1 subunit delta Cytoplasm. Melanosome Binding of sperm to zona pellucida 266608 Q01768 NDKB Nucleoside diphosphate kinase B Cytoplasm. Cell membrane. Cell projection, Activation of mitophagy in response    lamellipodium to mitochondrial depolarization | 118542 P26443 DHE3 Glutamate dehydrogenase 1, mitochondrial Mitochondrion matrix Glutamate biosynthetic process 15 of 24 (Continues) 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License | 16 of 24    TABLE 2 (Continued) Accessiona UniprotKB-­ID Gene Short-­name Subcellular location Gene ontology (roles) 81896595 Q8BLF1 NCEH1 Neutral cholesterol ester hydrolase 1 Membrane Lipid catabolic process 29839593 Q91W90 TXND5 Thioredoxin domain-­containing protein 5 ER lumen Apoptotic cell clearance 118105 P17742 PPIA Peptidyl-­prolyl cis-­trans isomerase A Cytoplasm. Secreted Lipid particle organization 61217662 Q9Z1N5 DX39B Spliceosome RNA helicase Ddx39b Nucleus Cellular response to DNA damage stimulus 50400807 O35114 SCRB2 Lysosome membrane protein 2 Lysosome membrane Cell adhesion 6093768 Q60930 VDAC2 Voltage-­dependent anion-­selective channel Mitochondrion outer membrane Negative regulation of intrinsic protein 2 apoptotic signalling pathway 46577116 Q9D1G1 RAB1B Ras-­related protein Rab-­1B Cytoplasm Autophagy 71153826 Q7TPV4 MBB1A Myb-­binding protein 1A Nucleus Cellular response to glucose starvation 1709998 P53994 RAB2A Ras-­related protein Rab-­2A ER-­Golgi intermediate compartment membrane; Golgi organization Lipid-­anchor. Melanosome 342187049 P26039 TLN1 Talin-­1 Cell projection, ruffle membrane Cell-­substrate junction assembly 341940396 P52825 CPT2 Carnitine O-­palmitoyltransferase 2, Mitochondrion inner membrane Fatty acid metabolic process mitochondrial 66773808 Q9JHI5 IVD Isovaleryl-­CoA dehydrogenase, mitochondrial Mitochondrion matrix Fatty acid beta-­oxidation using acyl-­ CoA dehydrogenase 51702234 P62897 CYC Cytochrome c, somatic Mitochondrion intermembrane space. Loosely Apoptotic process associated with the inner 51701449 Q9CQA3 SDHB Succinate dehydrogenase [ubiquinone], iron-­ Mitochondrion inner membrane Respiratory electron transport chain sulfur subunit, mitochondrial Note: Observed that 40 interacting proteins were identified, most of them are located in the cytoplasm, with a small but significant fraction is also observed in other cellular organelles such as the nucleus, mitochondria and endoplasmic reticulum. GARCÍA-­PADILLA et al. 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License GARCÍA-­PADILLA et al.    17 of 24 (A) (B) (C) (D) (E) (F) F I G U R E 7 (A–­C) RIP assays for ACTN4 (A), ACTN1 (B) and MHY9 (C), respectively. (D) RT-­qPCR analyses of Walras nuclear and cytoplasmic distribution in HL1 atrial cardiomyoctes. (E) Walras levels 24 h after siRNA transfection. (F) RT-­qPCR analyses of genes encoding for Walras interacting proteins in cells transfected with Walras siRNA (grey bars) as compared to controls (white bars) the sarcomere and is frequently altered in cardiac patho- but not ACTN1 and MHY9, directly interact with Walras logical conditions such as cardiac hypertrophy45–­47 as well (Figure 7A–­C). Importantly, Walras is distributed in as more recently with AF.48 Several cytoskeletal proteins both, nuclear and cytoplasmic compartments in HL1 car- RAB1A, RAB2A, RAB7A, ACTN1, ACTN4, TLN1 and diomyocytes (Figure 7D), in line with our observations in ITB1 are also associated to Walras. Importantly several of embryonic and neonatal cardiac chambers (Figure 3C). these proteins are linked to WNT non-­canonical signaling Further support of Walras lncRNA-­protein interactions is pathway and at least one of them (ACTN4) has been re- provided as qPCR analyses of distinct Walras interacting cently linked to AF.49 Among the nuclear proteins, Walras proteins failed to display differential expression in siRNA was found to interact with ROA2, ROA1, DXC39B and Walras treated cells at mRNA level, except for integrin MBBIA, suggesting that it can also play a nuclear role, beta 1 (Itb1). possibly in transcription, although at present the func- To further support the plausible functional role of tions of these interacting proteins are poorly understood. Walras in cardiomyocytes, we designed siRNAs and per- Surprisingly, Walras also interacted with a large array formed loss-­of-­function assays in HL1 cardiomyocytes. of mitochondrial proteins, such as KAD2, ETFD, DHE3, RT-­qPCR analyses demonstrated significant knock-­ VDAC2, IVD, CYC and SDHB, as well as with proteins down of Walras in HL1 cardiomyocytes (Figure 7E). located in other subcellular organelles, particularly at the Immunohistochemical analyses in HL1 cardiomyocytes ER (RTN-­4, CALU, TXDN5); the functional consequences demonstrated that cells treated with Walras siRNAs display of these interactions remain to be explored. In sum, these significantly decreased cell-­cell interactions (Figure 8B,C) data revealed the complexity of Walras-­interacting pro- as compared to controls (Figure 8A,C) and cytoskeletal teins and pave the ways for dissecting the functional role rearrangements (Figure 8A–­C). Immunocytochemical as- of this lncRNA in a cardiovascular context. Validation of says of ACTN4 (Figure 8D–­F), ACTN1 (Figure 8G–­I) and the Walras pulldown assays were performed for a subset MHY9 (Figure 8J–­L) distribution evidenced a significant of these interacting proteins (Figure 7A–­C). We demon- downregulation of these cytoskeletal proteins in Walras strated by RIP assays in HL1 cardiomyocytes that ACTN4, siRNA treated HL1 cardiomyocytes. | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 18 of 24    GARCÍA-­PADILLA et al. (A) (B) (C) (D) (E) (F) (G) (H) (I) (J) (K) (L) F I G U R E 8 Immunohistochemical analyses of control (A,D,G,J) and Walras silenced (B,D,H,K) cardiomyocytes stained with phalloidin (A,B), anti-­ACTN4 (D,E), anti-­ACTN1 (G–­H) and MHY9 (J–­K). Note that cell-­cell interactions are disrupted in all Walras siRNA conditions, and that phalloidin (C), ACTN4 (F), ACTN1 (I) and MHY9 (L) stainings are significantly decreased. DAPI staining (blue) identify cell nuclei | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License GARCÍA-­PADILLA et al.    19 of 24 4 | DI S C USSION gastrointestinal tract. Curiously they display discord- ant expression profiles as compared to Wnt8 and Wnt11, AF is the most common cardiac arrhythmia in hu- during development and adulthood, suggesting a lack of mans, with an estimated incidence of 2%–­4% in the gen- regulatory influence. Importantly, three of them (Walras, eral population, but rising up to 8%–­10% in the elderly. Wallrd and Walce) are conserved in humans. Walras Mechanistically, AF is initiated by impaired electrical ac- display variable degree of homology with three distinct tivity that is most frequently originated in the left atrium, lncRNAs adjacent to the human WNT11 locus, being the particularly in the vicinity of the entrance of pulmonary most likely homologous one AP002340.1 lncRNAs since it veins. The onset of AF leads to structural and electrical displays 43% similarity and is roughly similar in size (238 remodeling of both the left and right atrial chambers lead- nt vs 285 nt), while AP000785.1 and LINC02761 display ing to self-­perpetuation.50 lower similarity (25% and 31%, respectively) and are lager Over the past few decades, our understanding of the in size (613 nt and 388 nt, respectively). Mouse Walrrd genetic basis of AF has increased greatly. A large num- presents three distinct isoform, each of them displaying ber of studies provided evidence on the causal relation- homologue similarity to AC13382.1 (33%), AC13382.2 ship between distinct point mutations in multiple genes (45%) and AC1041116.1 (44%), while Walce displayed 35% encoding ion channels and the occurrence of AF. More similarity to Wnt11_03 lncRNAs. Such findings are in line recently, a seminal paper by Gudbjartsson et al.1 identified with previous results of the modest similarity of lncRNAs risk variants at 4q25 highly associated to lone AF and sub- between distinct species. sequently corroborated in distinct AF cohort studies.51–­55 LncRNAs are found in the nucleus and cytoplasm, These variants are located 150 kb downstream of the primarily functioning as transcriptional or post-­ homeobox transcription factor PITX2. Importantly, loss-­ transcriptional modulators,61–­64 respectively. Our analy- of-­function assays in mice showed that impaired Pitx2 ses demonstrate that most lncRNAs studied display dual function leads to increased atrial arrhythmia susceptibili- nuclear and cytoplasmic localization i.e., Walras, Walce, ty.5–­7 Wang et al.5 demonstrated aberrant embryonic Shox2 Wallrd and Playrr. Importantly, both temporal and spa- and Tbx3 expression in Pitx2 loss-­of-­function and related tial differences in the nuclear vs cytoplasmic localization such impaired expression to AF susceptibility. Kirchhof was observed for several of these lncRNAs, with Walrad et al.6 reported similar findings and demonstrated that being primarily nuclear in the embryonic and neonatal the expression of multiple ion channels was impaired. right and left atrial chambers but not in the ventricles, and Importantly, in both cases, no AF episodes occurred under Walas displaying a prominent nuclear localization in the basal conditions. Using an atrial-­specific Pitx2 conditional embryonic right atrium but similarly distributed in both transgenic mouse line, Chinchilla et al.7 demonstrated atrial chambers at the neonatal stage. These data under- abnormal ECGs at rest as well as impaired SCN5A (INa), score the highly dynamic temporal and spatial distribu- KCNJ2 (IK1) and KCNJ12 (IK1) expression and function. tion of these lncRNAs during cardiogenesis and support These observations were subsequently corroborated by the notion that they can exert distinct transcriptional and Tao et al.56 using a model of conditional Pitx2 expression post-­transcriptional functions. in adult mice. Additional evidence was found for a role for Pitx2 in calcium homeostasis.8,57–­60 These data there- fore suggest that an embryonic impairment of Pitx2 might 4.2 | Modulation of lncRNAs predispose to atrial arrhythmias while an adult deficiency will be already causative of AF. Subsequently experiments revealed that Pitx2 enhanced the expression of Walaa and Walce, while it signifi- cantly decreased the expression of Wallrd, supporting a 4.1 | Expression and distribution of role for these lncRNAs in a Pitx2-­regulated processes. lncRNAs Analyses in an atrium-­specific Pitx2 conditional trans- genic mice further supported a regulatory role of Pitx2 In this study, we have identified four distinct Wnt-­ in raising the levels of Walaa and Wallrd. Importantly, associated lncRNAs with preferential expression in the such upregulation is also observed for human WALLRD atrial chambers (Walaa, Walras, Wallrd and Walrad), (AC1040116.1) in AF patients. Moreover, WALRAS three of them confined to the embryonic stages (Walaa, (AP002340.1) is downregulated in AF patients, fur- Walras and Wallrd), and a fourth lncRNA that is also pref- ther supporting a plausible role for these lncRNAs in erentially expressed in the adult right atrium (Walrad). Pitx2-­ induced AF. Surprisingly, divergent results are Expression of these lncRNAs is widely distributed along observed for Wallrd in atrium-­specific Pitx2 conditional several other tissues such as the liver, brain, lungs and transgenic mice. It is possible that additional regulatory | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 20 of 24    GARCÍA-­PADILLA et al. mechanisms are driven by Pitx2 in non-­cardiomyocyte miR-­133 significantly decreased Walaa and Walras. These cells. Additional experiments will be required to recon- data reveal that the expression of Walaa and Wallrd is cile these findings. modulated by Pitx2 and Wnt signalling, as well as by key More recently, GWAS have identified additional genes pro-­arrhythmogenic microRNAs. Importantly, such modu- linked to AF pathophysiology, such as KCNN3, ZFHX3, latory actions seems to be indirect, as several transcription IL6R, CAV1, HCN4, SYNE2, SYNPOL2, PRRX1, and factors potentially involved in Walaa, Walras and Playrr WTN8A, among others.1,65–­68 To date more than 90 genes regulation are distinctly impaired by miR-­133 and miR-­29 have been associated to AF by GWAS analyses.2 Strategies overexpression. Together, these data support a plausible to increase and reduce Pitx2, Lozano-­ Velasco et al.8 role for these novel lncRNAs in atrial arrhythmias. demonstrated that Pitx2 can drive expression of Wnt8a, There is wide demonstration that hypertension (HTN), but not Zfhx3. Interestingly, impaired Wnt8a expression hyperthyroidism (HTD), diabetes and obesity promote is only reported in Pitx2 loss-­of-­function models with ab- AF onset, respectively.69–­71 In addition, AF occurrence normal electrophysiological parameters at rest, support- can be also increased in presence of hypertrophic cardio- ing the notion that Wnt signaling is essential for the AF myopathy and valvular heart diseases.70,72,73 Importantly, susceptibility vs triggering capacity. In this context it is Pitx2 is upregulated in cardiac hypertophy74 as well as in important to highlight that risk variants associated with heart failure.10 We have recently provided evidence on the increased PR interval, a condition frequently associated to modulatory role of upstream pathways modulating Pitx2 AF, have been identified at the WNT11 locus, neighbor- in the setting of AF. HTD but not HTN leads to impaired ing WALRAS conserved human homologues (AP002340.1, Pitx2>Wnt>microRNA signaling causing thus abnormal AP000785.1 and LINC02761 lncRNAs). ion channel expression. We herein tested whether AngII In this study we therefore analyzed if Wnt8 and Wnt11 and NE treatment modulate lncRNA expression. Our could modulate lncRNA expression as they exert syner- data demonstrate that all lncRNAs analyzed are upreg- gistic and complementary regulatory mechanisms in the ulated upon AngII and NE administration, supporting a Pitx2>Wnt>microRNA signaling pathway as previously plausible role of these lncRNAs in atrial arrhythmias as reported by Lozano-­Velasco et al.8,9 Our data demonstrate well as in cardiac hypertrophy. that Wnt8 vs Wnt11 overexpression modulate Walrad, In addition, we also analyzed if thyroid hormone in- Walras and Walce expression in a complementary man- fluenced their expression. Surprisingly, thyroid hormone ner. Therefore, expression of Walrad and Walce is regu- distinctly modulated lncRNA expression as compared lated by both Pitx2 and Wnt whereas Walras is exclusively to AngII/NE administration. Thus, Walaa was signifi- regulated by Wnt signaling. Thus, these data reinforce the cantly downregulated after T3 administration as well as notion of a plausible role for these lncRNAs in Pitx2>Wnt Wallrd after both T3 and T4 administration, respectively. signaling and thus in atrial arrhythmias. On the other hand, Walras was significantly upregulated Different studies have reported that Pitx2-­regulated mi- after both T3 and T4 administration, respectively. These croRNAs are involved in AF pathophysiology. Chinchilla data further strengthen a role for these lncRNAs in atrial et al.7 demonstrated abnormal regulation of Kcnj2 and arrhythmias as they display differential modulation by Kcnj12 by miR-­1, leading to impaired resting membrane AngII/NE vs T3/T4 administration. potential configuration in Pitx2 loss-­ of-­ function mice. 8 Lozano-­Velasco et al. identified several microRNAs reg- ulated by Pitx2 that were previously linked to AF in hu- 4.3 | Functional roles of lncRNAs mans. In this context, miR-­1, miR-­133, miR-­21, miR-­26, miR-­ 29 and miR-­ 106b have previously been associated In order to start understanding the functional roles of these with the regulation of calcium (CACNA1C, RYR2), so- lncRNAs in cardiac development, pulldown assays for the dium (SCN5A), potassium (KCNJ2, KCNE1, KCNB2), lncRNA Walras were performed in HL1 atrial cardiomy- cation (HCN4) channel subunits, respectively (revised in ocytes. A total of 40 proteins were identified that signifi- Ref. [11]). Importantly, microRNA regulation by Pitx2 is cantly interacted with Walras. Most of these proteins are exerted by a balanced interplay between Wnt8 and Wnt11 cytoplasmic (>40%), suggesting a prominent extranuclear expression.8 Therefore, in the present study we tested role for Walras (Figure 8). Two major sets of cytoplasmic if overexpression of Pitx2-­ regulated microRNAs influ- proteins were found, myosin proteins (MHY6, MHY9 enced the expression of lncRNAs. Our data indicate that and MHY10) and cytoskeletal proteins (RAB1A, RAB2A, that microRNA overexpression can indeed modulate ln- RAB7A, ACTN1, ACTN4 and TLN1). Importantly, we cRNAs. In particular, miR-­1 overexpression upregulated validated a direct protein-­Walras interaction for ACTN4. Walaa and Wallrd, but not Walras. In addition, miR-­29 Point mutations in MHY6 have been associated to cardiac overexpression also significantly increased Walaa, while hypertrophy, dilated cardiomyopathy, AF and congenital | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License GARCÍA-­PADILLA et al.    21 of 24 F I G U R E 9 Schematic representation of the most prominent Walras-­interacting proteins as identified by pulldown assays and mass spectrometry identification. Observe that Walras interacts with distinct cytoskeletal and cytoplasmic proteins as well as nuclear proteins mitochondrial proteins heart diseases.75–­79 In addition, SNV in the proximity of Walras also showed affinity for nuclear proteins ROA2, MHY6 have been associated with AF and impaired heart ROA1, DXC39B and MBBIA, supporting a nuclear func- rate.45 Experiments in mice further support the functional tion for Walras. It is important to note that we found sim- role of MHY6 in cardiac pathophysiology.80 RAB7A has ilar subcellular distribution patterns for Walras in other been implicated in controlling β-­adrenergic receptor en- tissues analyzed, except in the embryonic right atrium dosome recycling81 and impaired β-­adrenergic stimula- and ventricles. At present, the functional roles of these tion is frequently associated to AF. Abnormal expression interacting proteins are poorly understood. Surprisingly, of ACTN1 and TLN1 leads to dilated cardiomyopathy.82–­84 Walras also interacts with a large array of mitochon- In particular, TLN1 knock-­out display decreased beta1-­ drial proteins (KAD2, PGAM1, DHE3, CPT2, IVD, CYC, integrin expression (another Walras interacting protein), and SDHB) and endoplasmic reticulum proteins (HYEP, costameric instability and cardiac hypertrophy.84 Thus, it NB5R3, RTN-­4, CALU, ETFD, and TXDN5). While the is plausible that the interaction of Walras with TLN1 might nature and functional consequences of such interactions contribute to stabilization of cytoskeletal proteins such as remain to be explored, it is important to highlight the fact ACTN1, ACTN4 and MHY9 and MHY10, via ITG1 phos- that impaired expression of SDHD, CPT2, RTN4, ETFD, phorylation,83,84 a process that might be impaired in car- and CATD has also been associated to hypertrophic and/ diac hypertrophy. In this context, we provided evidence or dilated cardiomyopathy,88–­91 reinforcing the notion that that impairing Walras expression leads to decreased ex- Walras might play a role in cardiac hypertrophy. pression of ACTN1, ACTN4 and MHY9 in HL1 atrial In summary, we have identified five novel lncRNAs that cardiomyocytes. Importantly, two additional cytoplasmic are differentially expressed in the developing and adult Walras-­interacting proteins are also impaired in cardiac heart. Three of them displayed atrial expression during em- hypertrophy, UBA1 and PPIA.85–­87 Collectively, these lines bryogenesis and a fourth one is expressed in the right atrium of evidence support the idea that impairment of Walras in adulthood. Signaling through Pitx2>Wnt>miRNAs might also lead to cardiac arrhythmias and/or hypertrophy modulates the expression of these lncRNAs. In addition, by deregulating several interacting proteins (Figure 9). pro-­hypertrophic and pro-­arrhythmogenic pathways such | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 22 of 24    GARCÍA-­PADILLA et al. expression leading to WNT-­microRNA-­ion channel remodel- as those induced by AngII/NE and thyroid hormone ad- ing. PLoS One. 2017;12(12):e0188473. ministration distinctly regulated the expression of these 10. Torrado M, Franco D, Hernández-­ Torres F, et al. PITX2c lncRNAs. Pulldown and loss-­of-­function assays revealed is reactivated in the failing myocardium and stimulates that Walras interacts primarily with cytoplasmic proteins myf5 expression in cultured cardiomyocytes. PLoS One. that, if impaired, are associated with cardiac arrhythmias 2014;9(3):e90561. and hypertrophy. Overall, these data suggest that role of 11. Lozano-­ Velasco E, Garcia-­ Padilla C, Aránega AE, Franco these lncRNAs might plays a role in cardiac arrhythmo- D Genetics of atrial fibrilation: in search of novel thera- peutic targets. Cardiovasc Hematol Disord Drug Targets. genesis and hypertrophy. 2019;19(3):183-­194. 12. Wapinski O, Chang HY. Long noncoding RNAs and human dis- DISCLOSURES ease. Trends Cell Biol. 2011;21(6):354-­361. The authors declare no conflicts of interest. 13. Engreitz JM, Ollikainen N, Guttman M. Long non-­ coding RNAs: spatial amplifiers that control nuclear structure and AUTHOR CONTRIBUTIONS gene expression. Nat Rev Mol Cell Biol. 2016;17(12):756-­770. Diego Franco, Amelia E. Aránega, Myriam Gorospe, Leif 14. Gloss BS, Dinger ME. The specificity of long noncoding RNA Hove-­Madsen designed research; Carlos García-­ Padilla, expression. Biochim Biophys Acta. 2016;1859(1):16-­22. 15. Bär C, Chatterjee S, Thum T. Long noncoding RNAs in car- Jorge N. Domínguez, Valeria Lodde, Rachel Munk, Kotb diovascular pathology, diagnosis, and therapy. Circulation. Abdelmohsen performed research; Carlos García-­ Padilla, 2016;134(19):1484-­1499. Jorge N. Domínguez, Valeria Lodde, Rachel Munk, Kotb 16. Chen L. Linking long noncoding RNA localization and func- Abdelmohsen analyzed data; Veronica Jiménez-­ Sábado, tion. Trends Biochem Sci. 2016;41(9):761-­772. Antonino Ginel contributed with clinical data; Diego Franco 17. Ounzain S, Micheletti R, Arnan C, et al. CARMEN, a human wrote the draft paper; Carlos García-­Padilla, Myriam Gorospe, super enhancer-­associated long noncoding RNA controlling Leif Hove-­Madsen and Diego Franco edited final manuscript. cardiac specification, differentiation and homeostasis. J Mol Cell Cardiol. 2015;89:98-­112. 18. Boucher JM, Peterson SM, Urs S, et al. The miR-­143/145 cluster is ORCID a novel transcriptional target of Jagged-­1/Notch signaling in vas- Diego Franco https://orcid.org/0000-0002-5669-7164 cular smooth muscle cells. J Biol Chem. 2011;286(32):28312-­28321. 19. Klattenhoff C, Scheuermann J, Surface L, et al. Braveheart, a REFERENCES long noncoding RNA required for cardiovascular lineage com- 1. Gudbjartsson DF, Arnar DO, Helgadottir A, et al. Variants con- mitment. Cell. 2013;152(3):570-­583. ferring risk of atrial fibrillation on chromosome 4q25. Nature. 20. Mahlapuu M, Ormestad M, Enerback S, et al. The forkhead 2007;448:353-­357. transcription factor Foxf1 is required for differentiation of 2. Roselli C, Chaffin MD, Weng LC, et al. Multi-­ethnic genome-­ extra-­embryonic and lateral plate mesoderm. Development. wide association study for atrial fibrillation. Nat Genet. 2001;128(2):155-­166. 2018;50(9):1225-­1233. 21. Grote P, Wittler L, Hendrix D, et al. The tissue-­specific lncRNA 3. Aguirre LA, Alonso ME, Badía-­Careaga C, et al. Long-­range Fendrr is an essential regulator of heart and body wall develop- regulatory interactions at the 4q25 atrial fibrillation risk locus ment in the mouse. Dev Cell. 2013;24(2):206-­214. involve PITX2c and ENPEP. BMC Biol. 2015;13:26. 22. Garcia-­ Padilla C, Dominguez JN, Aranega A, Franco D. 4. Zhang M, Hill MC, Kadow ZA, et al. Long-­ range Pitx2c Differential chamber-­ specific expression and regulation of enhancer-­promoter interactions prevent predisposition to atrial long non coding RNAs during cardiac development. Biochim fibrillation. Proc Natl Acad Sci U S A. 2019;116(45):22692-­22698. Biophys Acta Gene Regul Mech. 2019;1862(10):194435. 5. Wang J, Klysik E, Sood S, Johnson RL, Wehrens XH, Martin JF. 23. Ruan Z, Sun X, Sheng H, Zhu L. Long non-­coding RNA ex- Pitx2 prevents susceptibility to atrial arrhythmias by inhibiting pression profile in atrial fibrillation. Int J Clin Exp Pathol. left-­sided pacemaker specification. Proc Natl Acad Sci U S A. 2015;8(7):8402-­8410. 2010;107(21):9753-­9758. 24. Su Y, Li L, Zhao S, Yue Y, Yang S. The long noncoding RNA ex- 6. Kirchhof P, Kahr PC, Kaese S, et al. PITX2c is expressed in the pression profiles of paroxysmal atrial fibrillation identified by adult left atrium, and reducing PITX2c expression promotes microarray analysis. Gene. 2018;642:125-­134. atrial fibrillation inducibility and complex changes in gene ex- 25. Mei B, Liu H, Yang S, et al. Long non-­coding RNA expression pro- pression. Circ Cardiovasc Genet. 2011;4:123-­133. file in permanent atrial fibrillation patients with rheumatic heart 7. Chinchilla A, Daimi H, Lozano-­Velasco E, et al. Pitx2 in- disease. Eur Rev Med Pharmacol Sci. 2018;22(20):6940-­6947. sufficiency leads to atrial electrical and structural remod- 26. Qian C, Li H, Chang D, Wei B, Wang Y. Identification of func- eling linked to arrhythmogenesis. Circ Cardiovasc Genet. tional lncRNAs in atrial fibrillation by integrative analysis of 2011;4(3):269-­279. the lncRNA-­mRNA network based on competing endogenous 8. Lozano-­Velasco E, Hernández-­Torres F, Daimi H, et al. Pitx2 RNAs hypothesis. J Cell Physiol. 2019;234(7):11620-­11630. impairs calcium handling in a dose-­ dependent manner by 27. Gore-­Panter SR, Hsu J, Barnard J, et al. PANCR, the Pitx2 ad- modulating WNT signalling. Cardiovasc Res. 2016;109(1):55-­66. jacent noncoding RNA, is expressed in human left atria and 9. Lozano-­ Velasco E, Wangensteen R, Quesada A, regulates PITX2c expression. Circ Arrhythm Electrophysiol. et al. Hyperthyroidism, but not hypertension, impairs Pitx2 2016;9(1):e003197. | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License GARCÍA-­PADILLA et al.    23 of 24 28. Gage PJ, Suh H, Camper SA. Dosage requirement of 46. Wolf CM. Hypertrophic cardiomyopathy: genetics and clinical Pitx2 for development of multiple organs. Development. perspectives. Cardiovasc Diagn Ther. 2019;9(Suppl 2):S388-­S415. 1999;126:4643-­4651. 47. Marian AJ, Braunwald E. Hypertrophic cardiomyopathy: genet- 29. de Lange FJ, Moorman AF, Christoffels VM. Atrial ics, pathogenesis, clinical manifestations, diagnosis, and ther- cardiomyocyte-­specific expression of Cre recombinase driven apy. Circ Res. 2017;121(7):749-­770. by an Nppa gene fragment. Genesis. 2003;37:1-­4. 48. McNally EM, Golbus JR, Puckelwartz MJ. Genetic mutations 30. Livak KJ, Schmittgen TD. Analysis of relative gene expression and mechanisms in dilated cardiomyopathy. J Clin Invest. data using real-­time quantitative PCR and the 2(-­Delta Delta 2013;123(1):19-­26. C(T)) Method. Methods. 2001;25:402-­408. 49. Veluchamy A, Ballerini L, Vitart V, et al. Novel genetic locus 31. Daimi H, Lozano-­Velasco E, Haj Khelil A, et al. Regulation of influencing retinal venular tortuosity is also associated with SCN5A by microRNAs: miR-­219 modulates SCN5A transcript risk of coronary artery disease. Arterioscler Thromb Vasc Biol. expression and the effects of flecainide intoxication in mice. 2019;39(12):2542-­2552. Heart Rhythm. 2015;12:1333-­1342. 50. Jalife J, Kaur K. Atrial remodeling, fibrosis, and atrial fibrilla- 32. Wang YG, Dedkova EN, Fiening JP, Ojamaa K, Blatter LA, tion. Trends Cardiovasc Med. 2015;25(6):475-­484. doi:10.1016/​ Lipsius SL. Acute exposure to thyroid hormone increases Na+ j.tcm.2014.12.015 current and intracellular Ca2+ in cat atrial myocytes. J Physiol. 51. Henningsen KM, Olesen MS, Haunsoe S, Svendsen JH. 2003;546(Pt 2):491-­499. Association of rs2200733 at 4q25 with early onset of lone 33. Lunde IG, Kvaløy H, Austbø B, Christensen G, Carlson atrial fibrillation in young patients. Scand Cardiovasc J. CR. Angiotensin II and norepinephrine activate specific 2011;45:324-­326. calcineurin-­dependent NFAT transcription factor isoforms in 52. Kiliszek M, Franaszczyk M, Kozluk E, et al. Association cardiomyocytes. J Appl Physiol. 2011;111(5):1278-­1289. between variants on chromosome 4q25, 16q22 and 1q21 34. Panda AC, Martindale JL, Gorospe M. Affinity pulldown of bi- and atrial fibrillation in the Polish population. PLoS One. otinylated RNA for detection of protein-­RNA complexes. Bio 2011;6(7):e21790. Protoc. 2016;6(24):e2062. 53. Olesen MS, Holst AG, Jabbari J, et al. Genetic loci on chro- 35. Villegas VE, Zaphiropoulos PG. Neighboring gene regu- mosomes 4q25, 7p31, and 12p12 are associated with onset of lation by antisense long non-­ coding RNAs. Int J Mol Sci. lone atrial fibrillation before the age of 40 years. Can J Cardiol. 2015;16(2):3251-­3266. 2012;28:191-­195. 36. Dempsey J, Zhang A, Cui JY. Coordinate regulation of long 54. Parvez B, Shoemaker MB, Muhammad R, et al. Common ge- non-­coding RNAs and protein-­coding genes in germ-­free mice. netic polymorphism at 4q25 locus predicts atrial fibrillation BMC Genom. 2018;19(1):834. recurrence after successful cardioversion. Heart Rhythm. 37. Hori Y, Tanimoto Y, Takahashi S, Furukawa T, Koshiba-­ 2013;10(6):849-­855. Takeuchi K, Takeuchi JK. Important cardiac transcription fac- 55. Mohanty S, Santangeli P, Bai R, et al. Variant rs2200733 on chro- tor genes are accompanied by bidirectional long non-­coding mosome 4q25 confers increased risk of atrial fibrillation: evidence RNAs. BMC Genom. 2018;19(1):967. from a meta-­analysis. J Cardiovasc Electrophysiol. 2013;24:155-­161. 38. Hitachi K, Nakatani M, Takasaki A, et al. Myogenin promoter-­ 56. Tao Y, Zhang M, Li L, et al. Pitx2, an atrial fibrillation predis- associated lncRNA Myoparr is essential for myogenic differen- position gene, directly regulates ion transport and intercalated tiation. EMBO Rep. 2019;20(3):e47468. disc genes. Circ Cardiovasc Genet. 2014;7:23-­32. 39. Welsh IC, Kwak H, Chen FL, et al. Chromatin architec- 57. Pérez-­Hernández M, Matamoros M, Barana A, et al. Pitx2c ture of the Pitx2 locus requires CTCF-­and Pitx2-­dependent increases in atrial myocytes from chronic atrial fibrillation asymmetry that mirrors embryonic gut laterality. Cell Rep. patients enhancing IKs and decreasing ICa,L. Cardiovasc Res. 2015;13(2):337-­349. 2016;109(3):431-­441. 40. Higa S, Maesato A, Ishigaki S, Suenari K, Chen YJ, Chen SA. 58. Bai J, Gladding PA, Stiles MK, Fedorov VV, Zhao J. Ionic and Diabetes and endocrine disorders (hyperthyroidism/hypothy- cellular mechanisms underlying TBX5/PITX2 insufficiency-­ roidism) as risk factors for atrial fibrillation. Card Electrophysiol induced atrial fibrillation: insights from mathematical models Clin. 2021;13(1):63-­75. of human atrial cells. Sci Rep. 2018;8(1):15642. 41. Tribulova N, Kurahara LH, Hlivak P, Hirano K, Szeiffova BB. 59. Bai J, Lo A, Gladding PA, Stiles MK, Fedorov VV, Zhao Pro-­arrhythmic signaling of thyroid hormones and its relevance J. In silico investigation of the mechanisms underlying in subclinical hyperthyroidism. Int J Mol Sci. 2020;21(8):2844. atrial fibrillation due to impaired Pitx2. PLoS Comput Biol. 42. Barreto-­Chaves ML, Senger N, Fevereiro M, Parletta AC, 2020;16(2):e1007678. Takano A. Impact of hyperthyroidism on cardiac hypertrophy. 60. Bai J, Zhu Y, Lo A, Lu Y, Zhao J. In silico assessment of ge- Endocr Connect. 2020;9(3):R59-­R69. netic variation in PITX2 reveals the molecular mechanisms of 43. Prisant LM, Gujral JS, Mulloy AL. Hyperthyroidism: a second- calcium-­mediated cellular triggered activity in atrial fibrillation. ary cause of isolated systolic hypertension. J Clin Hypertens Annu Int Conf IEEE Eng Med Biol Soc. 2020;2020:2353-­2356. (Greenwich). 2006;8(8):596-­599. 61. Terreri S, Mancinelli S, Ferro M, et al. Subcellular localization 44. Dörr M, Völzke H. Cardiovascular morbidity and mortal- of uc.8+ as a prognostic biomarker in bladder cancer tissue. ity in thyroid dysfunction. Minerva Endocrinol. 2005;30(4):​ Cancers (Basel). 2021;13(4):681. 199-­216. 62. Das S, Zhang E, Senapati P, et al. A novel angiotensin II-­induced 45. Holm H, Gudbjartsson DF, Sulem P, et al. A rare variant in long noncoding RNA giver regulates oxidative stress, inflam- MYH6 is associated with high risk of sick sinus syndrome. Nat mation, and proliferation in vascular smooth muscle cells. Circ Genet. 2011;43(4):316-­320. Res. 2018;123(12):1298-­1312. | 15306860, 2022, 1, Downloaded from https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.202100844RR by Readcube (Labtiva Inc.), Wiley Online Library on [12/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 24 of 24    GARCÍA-­PADILLA et al. 63. Cabili MN, Dunagin MC, McClanahan PD, et al. Localization 80. Jiang J, Wakimoto H, Seidman JG, Seidman CE. Allele-­specific and abundance analysis of human lncRNAs at single-­cell and silencing of mutant Myh6 transcripts in mice suppresses hyper- single-­molecule resolution. Genome Biol. 2015;16(1):20. trophic cardiomyopathy. Science. 2013;342(6154):111-­114. 64. Coassin SR, Orjalo AV Jr, Semaan SJ, Johansson HE. 81. Nooh MM, Bahouth SW. Two barcodes encoded by the type-­1 Simultaneous detection of nuclear and cytoplasmic RNA vari- PDZ and by phospho-­ Ser(312) regulate retromer/WASH-­ ants utilizing Stellaris® RNA fluorescence in situ hybridization mediated sorting of the ß(1)-­adrenergic receptor from endo- in adherent cells. Methods Mol Biol. 2014;1211:189-­199. somes to the plasma membrane. Cell Signal. 2017;29:192-­208. 65. Kääb S, Darbar D, van Noord C, et al. Large scale replication 82. Jia Y, Chang HC, Schipma MJ, et al. Cardiomyocyte-­specific ab- and meta-­analysis of variants on chromosome 4q25 associated lation of Med1 subunit of the mediator complex causes lethal di- with atrial fibrillation. Eur Heart J. 2009;30:813-­819. lated cardiomyopathy in mice. PLoS One. 2016;11(8):e0160755. 66. Schnabel RB, Kerr KF, Lubitz SA, et al.; Candidate 83. Manso AM, Li R, Monkley SJ, et al. Talin1 has unique expres- Gene Association Resource (CARe) Atrial Fibrillation/ sion versus talin 2 in the heart and modifies the hypertrophic re- Electrocardiography Working Group. Large-­ scale candi- sponse to pressure overload. J Biol Chem. 2013;288(6):4252-­4264. date gene analysis in whites and African Americans identi- 84. Manso AM, Okada H, Sakamoto FM, et al. Loss of mouse car- fies IL6R polymorphism in relation to atrial fibrillation: the diomyocyte talin-­1 and talin-­2 leads to β-­1 integrin reduction, National Heart, Lung, and Blood Institute's Candidate Gene costameric instability, and dilated cardiomyopathy. Proc Natl Association Resource (CARe) project. Circ Cardiovasc Genet. Acad Sci U S A. 2017;114(30):E6250-­E6259. 2011;4:557-­564. 85. Satoh K, Nigro P, Zeidan A, et al. Cyclophilin A promotes 67. Ellinor PT, Lunetta KL, Glazer NL, et al. Common variants in cardiac hypertrophy in apolipoprotein E-­ deficient mice. KCNN3 are associated with lone atrial fibrillation. Nat Genet. Arterioscler Thromb Vasc Biol. 2011;31(5):1116-­1123. 2010;42:240-­244. 86. Wang KC, Lim CH, McMillen IC, Duffield JA, Brooks DA, 68. Pfeufer A, van Noord C, Marciante KD, et al. Genome-­wide as- Morrison JL. Alteration of cardiac glucose metabolism in asso- sociation study of PR interval. Nat Genet. 2010;42(2):153-­159. ciation to low birth weight: experimental evidence in lambs with 69. Zhang Q, Liu T, Ng CY, Li G. Diabetes mellitus and atrial re- left ventricular hypertrophy. Metabolism. 2013;62(11):1662-­1672. modeling: mechanisms and potential upstream therapies. 87. Shu Q, Lai S, Wang XM, et al. Administration of ubiquitin-­ Cardiovasc Ther. 2014;32:233-­241. activating enzyme UBA1 inhibitor PYR-­41 attenuates angioten- 70. Anumonwo JM, Kalifa J. Risk factors and genetics of atrial sin II-­induced cardiac remodeling in mice. Biochem Biophys Res fibrillation. Cardiol Clin. 2014;32:485-­494. Commun. 2018;505(1):317-­324. 71. Goudis CA, Korantzopoulos P, Ntalas IV, Kallergis EM, 88. Zhou B, Rao L, Li Y, et al. The association between dilated car- Ketikoglou DG. Obesity and atrial fibrillation: a comprehen- diomyopathy and RTN4 3′UTR insertion/deletion polymor- sive review of the pathophysiological mechanisms and links. phisms. Clin Chim Acta. 2009;400(1-­2):21-­24. J Cardiol. 2015;66(5):361-­369. 89. Tang Y, Mi C, Liu J, Gao F, Long J. Compromised mitochon- 72. Yadava M, Hughey AB, Crawford TC. Postoperative atrial fibril- drial remodeling in compensatory hypertrophied myocar- lation: incidence, mechanisms, and clinical correlates. Cardiol dium of spontaneously hypertensive rat. Cardiovasc Pathol. Clin. 2014;32:627-­636. 2014;23(2):101-­106. 73. Kumar KR, Mandleywala SN, Link MS. Atrial and ventric- 90. Sasagawa S, Nishimura Y, Okabe S, et al. Downregulation of ular arrhythmias in hypertrophic cardiomyopathy. Card GSTK1 is a common mechanism underlying hypertrophic car- Electrophysiol Clin. 2015;7:173-­186. diomyopathy. Front Pharmacol. 2016;7:162. 74. Su D, Jing S, Guan L, et al. Role of Nodal-­PITX2C signal- 91. Pereyra AS, Hasek LY, Harris KL, et al. Loss of cardiac ing pathway in glucose-­induced cardiomyocyte hypertrophy. carnitine palmitoyltransferase 2 results in rapamycin-­ Biochem Cell Biol. 2014;92(3):183-­190. resistant, acetylation-­independent hypertrophy. J Biol Chem. 75. Carniel E, Taylor MR, Sinagra G, et al. Alpha-­myosin heavy 2017;292(45):18443-­18456. chain: a sarcomeric gene associated with dilated and hy- pertrophic phenotypes of cardiomyopathy. Circulation. SUPPORTING INFORMATION 2005;112(1):54-­59. 76. Hershberger RE, Norton N, Morales A, Li D, Siegfried JD, Additional supporting information may be found in the Gonzalez-­Quintana J. Coding sequence rare variants identified online version of the article at the publisher’s website. in MYBPC3, MYH6, TPM1, TNNC1, and TNNI3 from 312 pa- tients with familial or idiopathic dilated cardiomyopathy. Circ Cardiovasc Genet. 2010;3(2):155-­161. How to cite this article: García-­Padilla C, 77. Holm H, Gudbjartsson DF, Arnar DO, et al. Several common Domínguez JN, Lodde V, et al. Identification of variants modulate heart rate, PR interval and QRS duration. atrial-­enriched lncRNA Walras linked to Nat Genet. 2010;42(2):117-­122. cardiomyocyte cytoarchitecture and atrial 78. Granados-­Riveron JT, Ghosh TK, Pope M, et al. Alpha-­cardiac fibrillation. FASEB J. 2022;36:e22051. doi:10.1096/ myosin heavy chain (MYH6) mutations affecting myofibril for- fj.20210​0844RR mation are associated with congenital heart defects. Hum Mol Genet. 2010;19(20):4007-­4016. 79. Nielsen JB, Thorolfsdottir RB, Fritsche LG, et al. Biobank-­ driven genomic discovery yields new insight into atrial fibrilla- tion biology. Nat Genet. 2018;50(9):1234-­1239.