TYPE Original Research PUBLISHED 10 August 2022 DOI 10.3389/fendo.2022.916698 Genetics: Is LADA just late OPEN ACCESS onset type 1 diabetes? EDITED BY Zhiguang Zhou, Central South University, China M. Hernández 1,2, Y. Nóvoa-Medina 3,4, R. Faner 5, E. Palou 5, REVIEWED BY A. Esquerda 6, E. Castelblanco 7,8, A. M. Wägner 4,9* Giovanni Mario Pes, University of Sassari, Italy and D. Mauricio 10,11,12* David Wagner, 1 Department of Endocrinology and Nutrition, University Hospital Arnau de Vilanova, Lleida, Spain, University of Colorado Anschutz Medical Campus, United States 2 Lleida Biomedical Research Institute (IRB Lleida), University of Lleida (UdL), Lleida, Spain, Yang Xiao, 3 Department of Pediatrics, Complejo Hospitalario Universitario Insular Materno-Infantil, Las Palmas Central South University, China de Gran Canaria, Spain, 4 Research Institute in Biomedical and Health Sciences (IUIBS), University of Nanette Schloot, Las Palmas de Gran Canaria (ULPGC), Las Palmas de Gran Canaria, Spain, 5 Histocompatibility and Eli Lilly, United States Immunogenetics Laboratory, Blood and Tissue Bank, Barcelona, Spain, 6 Department of Laboratory Natalia Wawrusiewicz-Kurylonek, Medicine, University Hospital Arnau de Vilanova, Lleida, Spain, 7 Diabetis en Atenció Primària - Medical University of Bialystok, Poland Catalunya (DAP-Cat) Group, Unitat de Suport a la Recerca Barcelona, Fundació Institut Universitari per a la recerca a l’Atenció Primària de Salut Jordi Gol i Gurina, Barcelona, Spain, 8 Division of *CORRESPONDENCE Endocrinology, Metabolism and Lipid Research, Washington University School of Medicine in St. A. M. Wägner Louis, St. Louis, MO, United States, 9 Department of Endocrinology and Nutrition, Complejo Ana.wagner@ulpgc.es Hospitalario Universitario Insular Materno-Infantil, Las Palmas de Gran Canaria, Spain, 10 Department D. Mauricio of Endocrinology, Hospital de la Santa Creu i Sant Pau & Institut d’Investigació Biomèdica (IIB) Sant didacmauricio@gmail.com Pau, Barcelona, Spain, 11 Consorcio Centro de Investigación Biomédica en Red (CIBER) of Diabetes and Associated Metabolic Diseases, Instituto de Salud Carlos III, Barcelona, Spain, 12 Faculty of SPECIALTY SECTION Medicine, University of Vic & Central University of Catalonia, Vic, Spain This article was submitted to Diabetes: Molecular Mechanisms, a section of the journal Frontiers in Endocrinology RECEIVED 09 April 2022 Background: There is a controversy regarding Latent Autoimmune Diabetes in ACCEPTED 04 July 2022 Adults (LADA) classification and whether it should be considered a slowly PUBLISHED 10 August 2022 progressing form of type 1 (T1) diabetes (DM) or a distinct type of DM CITATION altogether. Hernández M, Nóvoa-Medina Y, Faner R, Palou E, Esquerda A, Castelblanco E, Wägner AM and Methods: This cross-sectional study assessed major genes associated with Mauricio D (2022) Genetics: Is LADA T1DM (class II HLA, PTPN22 [rs2476601] and INS [rs689]) in patients with LADA, just late onset type 1 diabetes? Front. Endocrinol. 13:916698. as compared with participants with T1DM (stratified according to age of diagnosis doi: 10.3389/fendo.2022.916698 before or after 30) and T2DM. HLA genotyping of the DRB1, DQA1 and DQB1 loci COPYRIGHT was performed by reverse PCR sequence-specific oligonucleotides. HLA © 2022 Hernández, Nóvoa-Medina, haplotypes were assigned according to those most frequently described in the Faner, Palou, Esquerda, Castelblanco, Wägner and Mauricio. This is an open- European population. INS and PTPN22 SNPs were genotyped by real-time PCR. access article distributed under the terms of the Creative Commons Results: A total of 578 participants were included: 248 with T1DM (70 Attribution License (CC BY). The use, distribution or reproduction in other diagnosed after the age of 30), 256 with T2DM and 74 with LADA. High risk forums is permitted, provided the HLA alleles were significantly more frequent in LADA than in T2DM, whereas original author(s) and the copyright the opposite was true for protective alleles. We found a lower frequency of the owner(s) are credited and that the original publication in this journal is high-risk DRB1*04-DQB1*03:02-DQA1*03:01 haplotype in LADA (21.1%) than cited, in accordance with accepted in the overall T1DM (34.7%) (p<0.05), whereas no differences were found academic practice. No use, distribution or reproduction is between these groups for DRB1*03-DQB1*02:01-DQA1*05:01 or for permitted which does not comply with protective alleles. Only 12% the overall T1DM group had no risk alleles vs 30% these terms. of LADA (p<0.0005). However, HLA allele distribution was similar in LADA and T1DM diagnosed after the age of 30. A total of 506 individuals (195 with T1DM [21 diagnosed after age 30] 253 with T2DM and 58 with LADA) were genotyped for the PTPN22 and INS SNPs. The G/A genotype of the PTPN22 rs2476601 was more frequent and the T/T genotype of the INS SNP rs689 was less frequent in Frontiers in Endocrinology 01 frontiersin.org Hernández et al. 10.3389/fendo.2022.916698 T1DM compared to LADA. We did not find any significant differences in the frequency of the mentioned SNPs between LADA and T2DM, or between LADA and T1DM diagnosed after the age of 30. Conclusion: In this relatively small cross-sectional study, the genetic profile of subjects with LADA showed a similar T1DM-related risk allele distribution as in participants with T1DM diagnosed after the age of 30, but fewer risk alleles than those diagnosed before 30. Differences were present for HLA, as well as PTPN22 and INS genes. KEYWORDS LADA (latent autoimmune diabetes in adults), genetics, HLA class II, PTPN22, Type 1 diabetes mellitus, INS, age of onset Introduction In the present study, we evaluated differences in the HLA region, as well as in PTPN22 and INS, in patients diagnosed with Latent Autoimmune Diabetes in Adults (LADA) is a slowly LADA compared to patients diagnosed with T1DM and T2DM. progressive autoimmune form of diabetes presenting in adults. There is still debate regarding its classification and whether it should be considered a slowly progressing form of type 1 (T1) Methods diabetes mellitus (DM) or a distinct type of DM (1). A recent consensus statement from the American Diabetes Association Design and setting and the European Association for the Study of Diabetes (EASD) defines age of onset (>30 years), presence of diabetes associated This is a cross-sectional study, performed in Catalonia, autoantibodies and absence of insulin requirements for at least 6 Spain, assessing the major genes associated with T1DM in months after diagnosis as key diagnostic criteria for LADA (2). patients with LADA, as compared with individuals with Also, they recommend an individualized approach that differs T1DM and T2DM. It was part of a more comprehensive from the classical management of T1DM. study, characterizing LADA in our population (3, 8). The It has been shown that individuals with LADA have a study was designed in 2006. PTPN22 and INS, along with distinct metabolic profile compared to patients with T1DM HLA, were selected because they were at that time among the and type 2 (T2) DM, with higher C-peptide concentrations genes described to have more weight in the development of than subjects with T1DM and a lower frequency of metabolic T1DM in genetic association studies (9). syndrome than people with T2DM (3). In addition, there is some evidence that LADA is associated with a genetic background that is different from T1DM and T2DM, with an attenuated influence Patients of key T1DM-associated HLA haplotypes compared to T1DM and an increased presence of PTPN22, INS and SH2B3 We included patients diagnosed with different forms of polymorphisms, compared to T2DM (4). DM and different age groups. T1DM and T2DM were The PTPN22 gene encodes a protein tyrosine phosphatase, a diagnosed according to standard criteria (1). GAD-antibody negative regulator for T cell activation, and a down-regulator of screening was performed in all participants. If they were the immune response. The first study on the association between positive, they were not classified as T2DM. Participants with PTPN22 gene variants with T1DM was reported by Bottini et al T1DM were classified according to an age of onset of below or (5) in 2004. Among the single nucleotide polymorphisms (SNPs) above 30 years of age. Patients with DM (both T1DM and in the gene, rs2476601 has been linked to T1DM (4, 6). The INS LADA) diagnosed after the age of 30 years of age were recruited gene encodes the (pro) insulin protein. Variants in the gene or its from two hospital-based centers in northeastern Spain promotor region might affect its thymic expression, leading to (Barcelona and Lleida). The patients with T1DM diagnosed decreased tolerance and a higher likelihood of developing an before 30 years of age were those entered in the Catalonian autoimmune response (7). T1DM registry between January 1, 1987 and December 31, Frontiers in Endocrinology 02 frontiersin.org Hernández et al. 10.3389/fendo.2022.916698 1988 (10). Cases of LADA were defined as patients aged 30–70 Statistical analysis years at the time of diagnosis of diabetes who did not require insulin for at least 6 months after diagnosis, with glutamic acid Sample size estimations were done for the T1DM group as a decarboxylase (GAD) autoantibody (GADAb) or tyrosine whole. Indeed, the study was designed to detect an absolute 13% phosphatase autoantibody (IA-2Ab) positivity, as described difference between groups in the absence of high-risk haplotypes in previous studies (3). All patients were included, at least, 6 [expected to be 13% in the participants with T1DM, 26% in the months after diagnosis. Most LADA patients were diagnosed LADA group and 40% in the T2DM group] with a 95% clinically, and further confirmed by GAD-antibody confidence. This led to an estimation of 80 participants with measurement at the reference hospital. The rest were LADA, 218 with T2DM and 256 with T1DM.A descriptive identified in primary care among people with a clinical analysis was performed using percentages for qualitative diagnosis of T2DM, after systematic antibody measurement variables and mean (standard deviation [SD]) or median (inter- as part of a larger study (8). quartile range [IQR]) for continuous variables, according to Samples from controls for the genetic analysis of PTPN22 whether their distribution was Gaussian or not, respectively. and INS genes were obtained from umbilical cord blood samples Groups were compared using the Student’s t test or the Mann- from the Barcelona Cord Blood Bank in 2009. Whitney U test (pairwise comparisons) and ANOVA or Kruskal- Wallis tests for continuous variables and chi-squared and Fisher’s test, as appropriate, for percentages. Hardy-Weinberg Equilibrium Genetics was assessed for the SNPs in PTPN22 and INS and comparisons were made using the dominant, codominant, recessive and Automated DNA extraction was performed using the additive models, if possible. Results were expressed as odds Maxwell instrument (Promega, Madison, Wisconsin, USA). ratios and 95% confidence intervals (OR [95% CI]). Both HLA genotyping of the DRB1, DQA1 and DQB1 loci was unadjusted and (age and BMI) adjusted comparisons (using a performe d by r everse PCR-SSO (sequence-speci fic general linear model) were performed. Results were considered oligonucleotides) using INNO-LiPA HLA typing kits statistically significant if p was below 0.05 (Innogenetics, Fujirebio Europe N.V., Ghent, Belgium). High- The study was approved by the Ethics Committees of risk and protective HLA-DRB1 alleles were determined by low Hospital de la Santa Creu i Sant Pau, Barcelona and Hospital resolution (1-field) genotyping, while DQB1 and DQA1 loci were Universitari Arnau de Vilanova, Lleida. typified by 2-field high resolution genotyping. HLA haplotypes were assigned according to the most frequent haplotypes described in European populations (11). Results INS and PTPN22 SNPs were genotyped using an in-house A total of 578 participants were included: 248 with T1DM technique by real-time PCR on a LightCycler 480 PCR system (178 diagnosed below 30 years of age and 70 above that age), 256 (Roche Diagnostics, Basel, Switzerland) using FRET probes. with T2DM and 74 with LADA. Their main features are Primer and probe sequences are shown in Table 1. The −23 displayed in Table 2. HphI polymorphism (rs689) was genotyped as a surrogate marker for the INS-VNTR, based on the almost complete linkage disequilibrium between them (12) (the −23 HphI A Characterization allele corresponds to VNTR class I and the −23 HphI T allele corresponds to VNTR class III). In PTPN22, the SNP Arg620Trp Patients with T1DM were significantly younger compared to (rs2476601) was genotyped. patients with T2DM and LADA. Patients diagnosed with LADA TABLE 1 Primers and probes used for INS and PTPN22 genotyping. Name Sequence 5’ Mod. 3’ Mod. rs689_F CAGCAGGGAGGACGTGGC rs689_R CCCCGCACACTAGGTAGAGA rs689_anchor GCCTTCAGCCTGCCTCAGCCCT 6-FAM-Q rs689s_sensor CCTGTCACCCAGATCAC Cy-5 Phos rs2476601_F CCTCAAACTCAAGGCTC rs2476601_R CCTTTGGATTGTTCTAATTAAC rs2476601_anchor AATCATTTATTGTGGTTGAGGAAGCT Cy-5 Phos rs2476601_sensor ACTTCCTGTACGGACACCT 6-FAM-Q Frontiers in Endocrinology 03 frontiersin.org Hernández et al. 10.3389/fendo.2022.916698 TABLE 2 Characterization of the participants according to type of diabetes. T1DM<30 T1DM>30 LADA T2DM N 178 70 74 256 Female sex [n (%)] 91 (51.1) 32 (45.7) 28 (38.3) 98 (37.8) Age (years) 29.5 (8.6)* 47.9 (12.3)* 54.2 (12.2) 55.9 (9.3)* Diabetes duration (years) 13.3 (5.9)* 5.4 (5) 5.2 (6.6) 2.7 (2.3)* Waist circumference (cm) 87.2 (9.9)* 90.5 (12.7) 94.3 (12.1) 101.7 (13.6)* Body Mass Index (Kg/m2) 22.1 (3.6) 25.7 (5.9) 26.5 (4.2) 30 (5.6) Continuous variables are expressed as mean (standard deviation) T1DM<30: type 1 diabetes diagnosed before the age of 30. T1DM>30: type 1 diabetes diagnosed after the age of 30. *p ≤ 0.004 compared with LADA. T1DM, Type 1 Diabetes Mellitus; LADA, Latent Autoimmune Diabetes of the Adult; T2DM, Type 2 Diabetes Mellitus. also had a longer time since diagnosis compared to patients frequent in T1DM than in LADA (p = 0.06). The absence of diagnosed with T2DM and those diagnosed with T1DM before risk alleles, however, was more frequent in LADA than in T1DM the age of 30. Anthropometrical measurements in the (30.3% vs 12%) (p <0.001). participants with LADA showed values that fell between When comparing the LADA and T2DM groups, we found a T1DM and T2DM (see Table 2). higher frequency of the T1DM risk haplotype DRB1*03- DQB1*02:01-DQA1*05:01 in the former (48.7% vs 18.8%; p <0.001), as well as a decreased frequency of the protective HLA analysis haplotype DRB1*15-DQA1*01:02-DQB1*06:02 (5.3% vs 18%, p <0.01). Table 3 summarizes the results of HLA genotyping. In a first Finally, a third sub analysis comparing the HLA risk and analysis, we compared the frequency of HLA risk alleles between protective alleles in patients diagnosed with LADA vs T1DM patients diagnosed with LADA (n = 74) and with T1DM (n = diagnosed after 30 years of age found no differences between 248). We found a lower frequency of the DRB1*04-DQB1*03:02- both groups. DQA*03:01 allele in LADA (21.1%) vs T1DM (34.7%) (p <0.05). No differences were found regarding the frequency of DRB1*03- DQB1*02:01-DQA1*05:01 between these groups. No difference PTPN22 and INS was found regarding the frequency of the protective alleles (DRB1*15-DQA1*01:02-DQB1*06:02) either. The presence of Table 4 summarizes the results of the PTPN22 and INS SNP both risk haplotypes in the same individual (DRB1*03- genotyping. Regarding PTPN22 (rs2476601), the minor allele DQB1*02:01/DRB1*04-DQB1*03:02) tended to be more (T) frequency was 0.0432 in controls and the genotype TABLE 3 HLA allele and haplotype distribution among groups. T1DM<30 T1DM>30 T1DM T2DM LADA T1DM vs. T2DM vs. T1DM>30 vs. (total) LADA LADA LADA N % N % N % N % N % p-value p-value p-value DRB1*04 92 51.7% 33 45.2% 125 49.8% 71 27.8% 24 31.6% 0.005 0.527 0.087 DRB1*04-DQB1*03:02 83 46.6% 30 41.1% 113 45.0% 58 22.7% 22 28.9% 0.013 0.268 0.120 DRB1*04-DQB1*03:02- 65 36.5% 22 30.1% 87 34.7% 44 17.3% 16 21.1% 0.039 0.157 0.318 DQA1*03:01 DRB1*03-DQB1*02:01- 119 66.9% 28 38.4% 147 58.6% 48 18.8% 37 48.7% 0.128 <0.001 0.204 DQA1*05:01 DQA1*03:01-DQA1*05:01 34 19.1% 5 6.8% 39 15.5% 9 3.5% 5 6.6% 0.045 0.246 0.947 DRB1*03–DQB1*02:01/DRB1*04- 43 24.2% 7 9.6% 50 19.9% 13 5.1% 8 10.5% 0.060 0.088 0.849 DQB1*03:02 DRB1*15 4 2.2% 4 5.5% 8 3.2% 54 21.2% 4 5.3% 0.399 0.001 0.953 DRB1*15–DQA1*01:02- 2 1.1% 2 2.7% 4 1.6% 46 18.0% 4 5.3% 0.088 0.006 0.681 DQB1*06:02 No risk alleles** 11 6.2% 19 26.0% 30 12.0% 149 58.4% 23 30.3% <0.001 <0.001 0.566 **: no DRB1*03 or DRB1*04 or DQB1*02:01 or DQB1*03:02; T1DM, Type 1 Diabetes Mellitus; LADA, Latent Autoimmune Diabetes of the Adult; T2DM, Type 2 Diabetes Mellitus. Frontiers in Endocrinology 04 frontiersin.org Hernández et al. 10.3389/fendo.2022.916698 distribution did not significantly depart from the Hardy viral infections, nutritional practices or increased BMI (14). In Weinberg equilibrium (chi-squared 0.002). When comparisons this context, LADA seems to be one of the lowest risk forms of were made between subjects with LADA and other groups, the T autoimmune diabetes, presenting at a later age. Still, it is worth allele was present more frequently in patients with T1DM (both mentioning that LADA also shows a “spectrum” of presentation, overall and those diagnosed before 30 years of age), than in with age of onset having been associated with the genetic risk controls and patients with T2DM and LADA. We did not find (15) or GAD antibody titers (16). As Desai et al. phrased it, any significant differences in genotype distribution between “supporting the hypothesis that autoimmune diabetes occurring T2DM and LADA, nor between T1DM diagnosed after the in adults is an age-related extension of the pathophysiological age of 30 and LADA in any of the models assessed. process presenting as childhood-onset T1DM” (15). Regarding INS (rs689), the frequency of the minor allele (T) To our knowledge, this is one of the first genetic studies to in controls was 0.294, and the genotype distribution did not directly compare LADA and T1DM diagnosed after the age of significantly depart from the Hardy-Weinberg equilibrium (chi- 30. Indeed, previous genetic studies comparing LADA and squared 0.0003). Patients diagnosed with T1DM before 30 years T1DM are scarce overall. Other strengths of this study include of age showed significantly more risk (A) alleles than the LADA the relatively large population and the adjustment for potential group, both using the recessive and the dominant models, confounders (age and BMI). whereas T2DM showed fewer risk alleles, and a similar As genetic analysis has become more accessible to medical genotype distribution to controls. No significant differences and research centers around the world, the number of studies were found between patients with LADA and those with evaluating the genetic differences between the subtypes of DM T1DM diagnosed after the age of 30 using any of the models. has increased in recent years, providing novel insights into the pathogenic routes of the disease. In 2018, Cousminer et al (4) published the first Genome Wide Association Study (GWAS) in Discussion subjects with LADA (see Table 5), whom they compared not only to healthy controls, but also to patients diagnosed with Our results show genetic differences between T1DM and T1DM and T2DM. They showed mixed genetic influence, LADA in all the analyzed genes (HLA, PTPN22 and INS), but sharing risk loci with both T1DM and T2DM. Compared to only in patients with T1DM diagnosed before 30 years of age. T1DM, the only significant differences were found in the HLA However, no significant differences were found between LADA region, with LADA showing lower frequencies of high T1DM and the group with T1DM diagnosed after the age of 30. When risk alleles. Compared to T2DM, LADA patients showed an compared with T2DM, LADA patients had similar or higher increased frequency of T1DM risk alleles in HLA, INS (rs689), frequencies of T1DM risk alleles. PTPN22 (rs2476601) and SHB3 (rs3184504). Similar results The role of high risk alleles in the age of diagnosis of were published by Buzzetti et al. in 2007 (23), reporting higher autoimmune diabetes has been previously studied by other frequencies of moderate and high risk class II HLA haplotypes in authors, suggesting an earlier onset in those patients with the subjects diagnosed with LADA compared with patients highest risk alleles (13), thus establishing a continuum from the diagnosed with T2DM. pediatric age to adulthood. Still, environmental factors can alter In the present study, the patients diagnosed with T1DM this “continuum”, favoring earlier onset in those patients with overall also showed a higher frequency of the HLA risk lower genetic risk exposed to environmental triggers (12) such as haplotype DRB1*04-DQB1*03:02-DQA1*03:01 compared to TABLE 4 Polymorphisms in PTPN22 and INS gene analysis in samples from controls (umbilical cord) and patients diagnosed with T1DM before (T1DM<30) and after 30 years of age (T1DM>30), LADA and T2DM. Gene SNP Umbilical Cord T1DM<30* T1DM>30 LADA T2DM C/C 224 (91.4%) 127 (73.0%) 16 (76.2%) 50 (86.2%) 220 (87%) PTPN22 C/T 21 (8.6%) 46 (26.4%) 5 (23.8%) 8 (13.8) 32 (12.6%) T/T 0 (0%) 1 (0.6%) 0 (0%) 0 (0%) 1 (0.4%) A/A 123 (50.2%) 115 (66.1%) 12 (57.1%) 32 (55.2%) 121(47.8%) INS A/T 100 (40.8%) 55 (31.6%) 8 (38.1%) 20 (34.5%) 106 (41.9%) T/T 22 (9.0%) 4 (2.3%) 1 (4.8%) 6 (10.3%) 26 (10.6%) *distribution among genotypes is significantly different (p<0.05) from LADA. SNP: single nucleotide polymorphism; PTPN22: Protein Tyrosine Phosphatase Non-Receptor Type 22 gene; INS: Insulin gene; T1DM: Type 1 Diabetes Mellitus; LADA: Latent Autoimmune Diabetes of the Adult; T2DM: Type 2 Diabetes Mellitus. Frontiers in Endocrinology 05 frontiersin.org Hernández et al. 10.3389/fendo.2022.916698 TABLE 5 Studies assessing HLA, PTPN22 and INS in LADA, type 1 and type 2 diabetes. Author Year Type of Subjects HLA PTPN22 (rs2476601)* INS (rs689) article. (Diagnosis Population (N)) Cervin et 2008 Original. T1DM (718), Similar high-risk HLA in LADA vs T1DM. Risk genotypes (CT/TT) Risk genotype (AA) al. (17) Sweden LADA (361), Increased protective HLA in LADA vs T1DM increased in both T1DM and increased in T1DM and T2DM (1676) & LADA vs controls LADA vs controls healthy controls (1704) Pettersen et 2010 Original. T1DM (120), Risk haplotype decreased and protective Associated with T1DM but not Associated with T1DM al. (16) Norway LADA (126), haplotype increased in the following order: with LADA but not with LADA T2DM (1090) & early T1D–late T1DM–high antiGAD LADA– healthy controls low antiGAD LADA–T2DM–control (1503) Andersen 2010 Original. T1DM>35y (257), Risk genotypes more frequent in T1DM vs Risk genotypes more frequent in Risk genotypes linked to et al. (18) Finland T2DM & LADA LADA, and in LADA vs T2DM T1DM vs LADA, and in LADA T1DM. No difference in (213) vs T2DM LADA vs T2DM Weber et 2010 Original. T1DM>35y (41), High risk alleles (DRB1*03, 04) more frequent ———————— ———————— al. (19) Czech LADA (61) & in T1DM vs LADA and vs controls Republic healthy controls (99) Kisand et 2012 Original. T1DM (154), LADA associated with T1DM protective Increased risk of T1DM (T/T Protective for T1DM (T/ al. (20) Estonia T2DM (260), haplotypes OR=7.2) vs controls. No effect T phenotype, OR=0.06). LADA (65) & found on LADA No effect on LADA healthy controls (229) Okruszko 2012 Original. T1DM (175), Frequency of high-risk genotypes decreased T/T genotype was more ———————— et al. (13) Poland LADA (80) & with age for both 30 years age group compared to male participants exceeds that of females. This may have the overall T1DM population we cannot rule out the existence of influenced some of the results. Also, we limited our study to differences. Indeed, other authors have reported differences three of the main genes related to T1DM risk. More extensive between these two groups (18, 24). studies assessing polygenic risk scores, would be interesting The presence of the T allele in rs2476601 in PTPN22 has to perform. been reported to increase the risk of T1DM (20, 26) and LADA To summarize, we present one of the few studies to directly (17, 25) by some authors, though it is not a generalized finding in compare differences in the genetic profile of patients with T1DM the latter (20). Studies focused on evaluating the differences and LADA. We believe this differentiation is important because between its frequency in patients with T1DM and patients with the underlying autoimmune process against the b-cell can have LADA are scarce. We found the risk variant more frequently in consequences for the prognosis, complications and treatment of patients diagnosed with T1DM before de age of 30 years than in patients (24). We report a similar T1DM risk allele distribution those with LADA, even though the result was statistically in patients with LADA compared to individuals with T1DM borderline (p=0.045). No differences were found on those diagnosed after the age of 30, but less risk alleles than in those diagnosed after the age of 30 (see Table 4). Authors have diagnosed before the age of 30 years. Our results suggest that, reported an increased presence of the risk (T) allele in both from a genetic point of view, LADA holds genetic similarities to patients with T1DM and LADA when compared to healthy late-onset forms of T1DM. Our study supports the importance controls (17). Dong et al. reported a similar effect of the PTPN22 of genetic studies in the characterization of LADA, but also of gene (rs2476601) in their 2014 meta-analysis, when comparing comparing the study group with appropriate controls, although patients diagnosed with LADA with healthy controls. They the confidence in the results is limited by sample size. found an increased risk for LADA in carriers of the risk allele (21). Similarly, this T allele has also been shown to confer an increased risk of T1DM (5, 25–27). Data availability statement On the other hand, Kisand et al. (20) reported no association between PTPN22 genotypes and LADA susceptibility, but did The original contributions presented in the study are find an increased risk for T1DM associated to rs2476601, when included in the article/supplementary files. Further inquiries comparing both types of DM with controls. Interestingly, there can be directed to the corresponding authors. was a 30-year difference in the mean age of diagnosis between the groups. In their 2019 meta-analysis, Ramu et al. (22) also compared subjects with LADA and healthy controls, and reported a significant association for the risk allele in Ethics statement rs2476601 with LADA in the codominant, dominant and The studies involving human participants were reviewed and recessive models. approved by Ethics Committees of Hospital de la Santa Creu i Regarding the INS rs689 SNP, we also found a different Sant Pau, Barcelona and Hospital Universitari Arnau de genotypic distribution among our patients, with a reduced Vilanova, Lleida. The patients/participants provided their frequency of the (T) minor allele in patients diagnosed with written informed consent to participate in this study. T1DM when compared with LADA or T2DM, though no significant difference was seen between LADA and T1DM patients with an onset of >30 years (see Table 4). Kisand et al. (19) reported similar findings after comparing their patients Author contributions with T1DM, T2DM and LADA. The T allele was associated with a reduced risk of T1DM, but was not associated with the risk of MH and DM were responsible for study conception and LADA. In their meta-analysis, Ramu et al. (22) also showed an design, RF, EP, AE, EC and MH participated in data acquisition. inverse association between LADA and the presence of the T RF and EP performed data analysis. AM and YN-M drafted the allele in the codominant, dominant and recessive models. first version of the manuscript. MH, DM, AM and YN-M made We acknowledge this study has some limitations. Even subsequent revisions to the manuscript. All authors revised and though our study is one of the largest published to date approved the final version of the paper. Frontiers in Endocrinology 07 frontiersin.org Hernández et al. 10.3389/fendo.2022.916698 Funding Conflict of interest This project was supported by a grant from Instituto de The authors declare that the research was conducted in the Salud Carlos III, Spain (Project FIS 061104). absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Acknowledgments Publisher’s note The authors thank Associació Catalana de Diabetis (ACD) All claims expressed in this article are solely those of the authors for providing the samples and clinical information of the and do not necessarily represent those of their affiliated organizations, patients included in the register. We acknowledge Joan or those of the publisher, the editors and the reviewers. Any product Verdaguer, from the University of Lleida (UdL), for logistic that may be evaluated in this article, or claim that may be made by its support with the genetic studies. manufacturer, is not guaranteed or endorsed by the publisher. References 1. Clasification and diagnosis of Diabetes. Standards of medical care in diabetes mellitus is associated with lower risk HLA genes. Diabetes Res Clin Pract Diabetes-2021. Diabetes Care (2021) 44(Suppl. 1):S15–S33. doi: 10.2337/dc21-S002 (2014) 104(3):e69–71. doi: 10.1016/j.diabres.2014.03.009 2. Buzzetti R, Tuomi T, Mauricio D, Pietropaolo M, Zhou Z, Pozzilli P, et al. 15. Desai M, Zeggini E, Horton VA, Owen KR, Hattersley AT, Levy JC, et al. An Management of latent autoimmune diabetes in adults: A consensus statement from an association analysis of the HLA gene region in latent autoimmune diabetes in international expert panel. Diabetes (2020) 69(10):2037–47. doi: 10.2337/dbi20-0017 adults. Diabetologia (2007) 50(1):68–73. doi: 10.1007/s00125-006-0513-z 3. Mollo A, Hernandez M, Marsal JR, Esquerda A, Rius F, Blanco-Vaca, et al. 16. Pettersen E, Skorpen F, Kvaløy K, Midthjell K, Grill V. Genetic Latent autoimmune diabetes in adults is perched between type 1 and type 2: heterogeneity in latent autoimmune diabetes is linked to various degrees of evidence from adults in one region of Spain. Diabetes Metab Res Rev (2013) 29 autoimmune activity. Diabetes (2010) 59(1):302–10. doi: 10.2337/db09-0923 (6):446–51. doi: 10.1002/dmrr.2411 17. Cervin C, Lyssenko V, Bakhtadze E, Lindholm E, Nilsson P, Tuomi T, et al. 4. Cousminer DL, Ahlqvist E, Mishra R, Andersen M, Chesi A, Hawa M, et al. Genetic similarities between latent autoimmune diabetes in adults, type 1 diabetes, First genome-wide association study of latent autoimmune diabetes in adults and type 2 diabetes. Diabetes (2008) 57(5):1433–7. doi: 10.2337/db07-0299 reveals novel insights linking immune and metabolic diabetes. Diabetes Care (2018) 18. Andersen MK, Lundgren V, Turunen JA, Forsblom C, Isomaa B, Groop PH, 41(11):2396–403. doi: 10.2337/dc18-1032 et al. Latent Autoimmune Diabetes in Adults Differs Genetically From Classical 5. Bottini N, Musumeci L, Alonso A, Rahmouni S, Nika K, Rostamkhani M, Type 1 Diabetes Diagnosed After the Age of 35 Years. Diabetes Care (2010) 33 et al. A functional variant of lymphoid tyrosine phosphatase is associated with type (9):2062–64. doi: 10.2337/dc09-2188 I diabetes. Nat Genet (2004) 36(4):337–8. doi: 10.1038/ng1323 19. Weber P, Meluzı́nová H, Kubesová H, Ambrosová P, Polcarová V, Cejkova 6. Howson JMM, Walker NM, Smyth DJ, Todd JA. Analysis of 19 genes for P, et al. Type 1 diabetes and LADA–occurrence of HLA-DRB1 *03 and DRB1 *04 association with type I diabetes in the type I diabetes genetics consortium families. alleles in two age different groups of diabetics. Adv Gerontol = Uspekhi Gerontol. Genes Immun (2009) 10(S1):S74–84. doi: 10.1038/gene.2009.96 (2010) 23(2):243–8. 7. Vafiadis P, Ounissi-Benkalha H, Palumbo M, Grabs R, Rousseau M, Goodyer C, 20. Kisand K, Uibo R. LADA and T1D in Estonian population — Two different et al. Class III alleles of the variable number of tandem repeat insulin polymorphism genetic risk profiles. Gene (2012) 497(2):285–91. doi: 10.1016/j.gene.2012.01.089 associated with silencing of thymic insulin predispose to type 1 diabetes. J Clin 21. Dong F, Yang G, Pan H-W, Huang WH, Jing LP, Liang WK, et al. The Endocrinol Metab (2001) 86(8):3705–10. doi: 10.1210/jcem.86.8.7733 association of PTPN22 rs2476601 polymorphism and CTLA-4 rs231775 8. Hawa MI, Thivolet C, Mauricio D, Alemanno I, Cipponeri E, Collier D, et al. polymorphism with LADA risks: a systematic review and meta-analysis. Acta Metabolic syndrome and autoimmune diabetes: Action LADA 3. Diabetes Care Diabetol (2014) 51(5):691–703. doi: 10.1007/s00592-014-0613-z (2009) 32(1):160–4. doi: 10.2337/dc08-1419 22. Ramu D, Perumal V, Paul SFD. Association of common type 1 and type 2 9. Report of the Expert Committee on the Diagnosis and Classification of diabetes gene variants with latent autoimmune diabetes in adults: A meta-analysis. Diabetes Mellitus. Diabetes Care (2003) 26(Supplement 1):S5–S20. doi: 10.2337/ J Diabetes (2019) 11(6):484–96. doi: 10.1111/1753-0407.12879 diacare.26.2007.S5 23. Buzzetti R, Di Pietro S, Giaccari A, Petrone A, Locatelli M, Suraci C, et al. 10. Cantó n A, Castań er MF, Conget I, Carreras G, Castell C, Tresserras R. Type High titer of autoantibodies to GAD identifies a specific phenotype of adult-onset 1 diabetes mellitus in Catalonia: Chronic complications and metabolic control ten autoimmune diabetes. Diabetes Care (2007) 30(4):932–8. doi: 10.2337/dc06-1696 years after onset. Med Sci Monit (2004) 10(5):185–90. 24. Herná ndez M, Mauricio D. Latent Autoimmune Diabetes in Adults: A 11. Klitz W, Maiers M, Spellman S, Baxter-Lowe LA, Schmeckpeper B, Williams Review of Clinically Relevant Issues. Adv Exp Med Biol (2021) 1307(3):29–41. TM, et al. New HLA haplotype frequency reference standards: High-resolution and doi: 10.1007/5584_2020_533 large sample typing of HLA DR-DQ haplotypes in a sample of European americans. 25. Abdelrahman HM, Sherief LM, Abd Elrahman DM, Alghobashy A, Tissue Antigens (2003) 62(4):296–307. doi: 10.1034/j.1399-0039.2003.00103.x Elsaadani HF, Mohamed RH. The association of PTPN22 (rs2476601) and 12. Rewers M, Zimmet P. The rising tide of childhood type 1 diabetes–what is IL2RA (rs11594656) polymorphisms with T1D in Egyptian children. Hum the elusive environmental trigger? Lancet (2004) 364(9446):1645–7. doi: 10.1016/ Immunol (2016) 77(8):682–6. doi: 10.1016/j.humimm.2016.06.006 S0140-6736(04)17368-6 26. Sharma CR, Ali B, Osman W, Afandi B, Aburawi EH, Beshyah SA, et al. 13. Okruszko A, Szepietowska B, Wawrusiewicz-Kurylonek N, Gó rska M, Association of variants in PTPN22 , CTLA-4 , IL2-RA , and INS genes with type 1 Krętowski A, Szelachowska M. HLA-DR, HLA-DQB1 and PTPN22 gene diabetes in emiratis. Ann Hum Genet (2021) 85(2):48–57. doi: 10.1111/ahg.12406 polymorphism: association with age at onset for autoimmune diabetes. Arch 27. Xuan C, Lun L-M, Zhao J-X, Wang HW, Zhu BZ, Yu S, et al. PTPN22 gene Med Sci (2012) 8:874–8. doi: 10.5114/aoms.2012.31619 polymorphism (C1858T) is associated with susceptibility to type 1 diabetes: a meta- 14. Fourlanos S, Elkassaby S, Varney MD, Colman PG, Harrison LC. Higher analysis of 19,495 cases and 25,341 controls. Ann Hum Genet (2013) 77(3):191– body mass index in adults at diagnosis of the slowly progressive form of type 1 203. doi: 10.1111/ahg.12016 Frontiers in Endocrinology 08 frontiersin.org