Journal of Animal Science, 2022, 100, 1–8 https://doi.org/10.1093/jas/skac161 Advance access publication 3 May 2022 Short Communication Body weight of newborn and suckling piglets affects their intestinal gene expression Sandra Villagómez-Estrada,†,‡,1 José F. Pérez,† Diego Melo-Durán,†,|| Francesc Gonzalez-Solè,† Matilde D’Angelo,† Francisco J. Pérez-Cano,$ and David Solà-Oriol†, † Department of Animal and Food Science, Animal Nutrition and Welfare Service (SNIBA), Autonomous University of Barcelona, Bellaterra 08193, Spain ‡ Carrera de Medicina Veterinaria, Escuela Superior Politécnica de Chimborazo (ESPOCH), Riobamba 060155, Ecuador || Faculty of Medical Sciences “Eugenio Espejo,” UTE University, Quito 17012764, Ecuador $ Department of Biochemistry and Physiology, University of Barcelona, Barcelona 08007, Spain Corresponding author: sandra.villagomez@outlook.es 1 Abstract Modern hyperprolific sows must deal with large litters (16–20 piglets) which reduce piglet birthweight with a concomitant increase in the pro- portion of small and intrauterine growth retarded piglets. However, larger litters do not only have a greater variation of piglet weights, but also a greater variation in colostrum and milk consumption within the litter. To further understand the impact that body weight has on piglets, the present study aimed to evaluate the degree of physiological weakness of the smallest piglets at birth and during the suckling period (20 d) com- pared to their middle-weight littermates through their jejunal gene expression. At birth, light piglets showed a downregulation of genes related to immune response (FAXDC2, HSPB1, PPARGC1α), antioxidant enzymes (SOD2m), digestive enzymes (ANPEP, IDO1, SI), and nutrient transporter (SLC39A4) (P < 0.05) but also a tendency for a higher mRNA expression of GBP1 (inflammatory regulator) and HSD11β1 (stress hormone) genes compared to their heavier littermates (P < 0.10). Excluding HSD11β1 gene, all these intestinal gene expression differences initially observed at birth between light and middle-weight piglets were stabilized at the end of the suckling period, when others appeared. Genes involved in barrier function (CLDN1), pro-inflammatory response (CXCL2, IL6, IDO1), and stress hormone signaling (HSD11β1) over-expressed compared to their middle-weight littermates (P < 0.05). In conclusion, at birth and at the end of suckling period, light body weight piglets seem to have a compromised gene expression and therefore impaired nutrient absorption, immune and stress responses compared to their heavier littermates. Lay Summary Under hyperprolific situations, piglets must deal with a reduced birthweight and a severe sibling competition for nutrients. Therefore, light body weight newborn and suckling piglets may also have physiological disadvantages compared to their middle-weight littermates. To further under- stand the impact that body weight has on piglets, the present study aimed to evaluate the degree of physiological weakness of the smallest piglets at birth and during the suckling period (20 d) compared to their middle-weight littermates through their jejunal gene expression. Newborn light piglets downregulated genes related to immunity, antioxidant, and digestive activities, but also a tendency to upregulate other genes related to inflammation and stress responses. At the end of the suckling period, those genes expression differences vanished while others appear. Light weight piglets showed lower expression of genes involved in barrier function, inflammation, and stress responses compared to their middle-weight littermates. At birth and at the end of lactation, light piglets seem to have a compromised intestinal gene expression for nutrient absorption, immune and stress responses compared to their heavier littermates. Key words: birthweight, gene expression, hyperprolific sows, neonatal pigs, suckling pigs Abbreviations: ACTB, actin beta; ANPEP, alanyl aminopeptidase membrane; ALPI, alkaline phosphatase intestinal; B2M, beta-2-microglobulin; BW, body weight; CCL, chemokine ligand; CCK, cholecystokinin; CLDN, claudins; CRHR1, corticotropin releasing hormone receptor; DAO, d-amino-acid oxidase; FDR, false discovery rate; FAXDC2, fatty acid hydroxylase domain containing; GCG, glucagon; GPX, glutathione peroxidase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GBP1, guanylate binding protein; HSP, heat shock protein; HNMT, histamine N-methyltransferase; HSD11β1, hydroxysteroid (11-beta) dehydrogenase; IDO, indoleamine 2,3-dioxygenase; IGF, insulin-like growth factor; IFNG, interferon gamma; IL, interleukin; IUGR, intrauterine growth-restricted; MT, metallothionein; MUC, mucins; NR, nuclear receptor; OCLN, occludin; PYY, peptide YY; PPARGC1α, peroxisome proliferator activated receptor gamma; REG3G, regenerating family member 3 gamma; SLC, solute carrier; SI, sucrase-isomaltase; SOD, superoxide dismutase; TBP, TATA-box binding protein; TLR, toll-like receptor; TGF-β1, transforming growth factor beta 1; TFF, Trefoil factor; TNF, tumor necrosis factor; ZO, Zonula occludens Introduction proportion of small piglets in large litters as well as the fre- Intensive pressure for a genetic selection of hyper prolificity, quency of intrauterine growth-restricted (IUGR) piglets has based on sow reproductive performance (litter size; 16–20 notably increased (Matheson et al., 2018; Ward et al., 2020). total piglets born), has led to a reduction in the average piglet The initial birthweight variation within litter may reveal that birthweight as well as an increase in the variability of birth- in hyperprolific genetic lines, sows may not be able to ensure weights within the litter (Peltoniemi et al., 2021). Thus, the a satisfactory nutrition for the uneven litter, resulting in an Received April 9, 2022 Accepted April 29, 2022. © The Author(s) 2022. Published by Oxford University Press on behalf of the American Society of Animal Science. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. 2 Journal of Animal Science, 2022, Vol. 100, No. 6 intense pre- and post-natal sibling competition to acquire lim- was recorded manually by daily weighting of the difference ited nutrients and a high mortality risk for weaker offspring between the feed offered and its disappearance. Diets were (Ward et al., 2020). Additionally, most of these IUGR and formulated to cover nutrient requirements (NRC, 2012). Ges- light birthweight piglets may also show long-term negative tation diet main composition includes wheat (35%), barley effects on their organ structure, postnatal growth, and feed (23.5%), wheat bran (20%), sunflower cake (10%), maize efficiency (Ji et al., 2017). Thus, modern commercial farms (7.70%), and lysine 50 (0.44%). The rest of ingredients, need to cull IUGR piglets because there is no effective nutri- amino acids, and macro and micro minerals accounted for tional or management support for their growth or survival 3.36% of the total composition. The nutrient content of ges- during the suckling and post-weaning periods (Kraeling and tation diet was 2,260 kcal/kg net energy, 13.0% crude pro- Webel, 2015). Nonetheless, light birthweight piglets could tein, and 0.67% lysine. Regarding lactation diet, the main show compensatory growth if given optimal management and ingredients were wheat (37%), maize (30%), soybean meal dietary conditions (van Barneveld and Hewitt, 2016; Viott (11.5%), sunflower cake (7%), lysine 50 (0.92%), and other et al., 2018; Farmer and Edwards, 2021). Fetal or neonatal ingredients (13.58%). Lactation diet values for net energy programming occurs during the gestation period leading to were 2,450 kcal/kg, 15.5% for crude protein, and 1.08% for changes in gene transcription resulting in altered activities lysine. of metabolic pathways and homeostatic control processes (Burdge et al., 2007). Insufficient maternal nutrition during Sampling gestation can result in permanent fetal programming alter- From the total of 80 initially housed sows, a subset of 10 mul- ations (Kwon and Kim, 2017). In order to further understand tiparous sows (3rd to 5th parity) were chosen for sampling the impact that the intrauterine fetal overcrowding has on purposes. Thus, two littermates from each litter were selected piglets, the present study aimed to evaluate the changes in to take jejunum samples during farrowing (before colos- jejunal gene expression, as a key indicator of the intestinal trum intake) and during suckling period (20 d). The selec- function and development. Therefore, the gene expression of tion criterion was the piglet body weight (BW) categorized light-weight piglets at birth and at the end of the lactation into two levels: light and middle-weight littermates. Briefly, period was compared with that of their middle-weight lit- a light piglet was defined as having a birth weight between termates, both born to hyperprolific sows under commercial 600 and 800 g (belonging to the lower quartile) at birth conditions. and a BW between 2,500 and 3,800 g on day 20, whereas a middle-weight littermate had a BW within the average of the litter at birth (1,200–1,300 g) and at the end of lactation Materials and Methods (4,000–5,100 g). Piglets with no obvious characteristics of All animal experimentation procedures were approved by the disease or injury were selected. Piglet sex was not considered Ethics Committee of the Universitat Autònoma de Barcelona as sampling indicator. Individual BW was examined and if (CEEAH2788M2) in compliance with the European Union it matched into the light or middle BW category, piglet was guidelines for the care and use of animals in research (Euro- selected to obtain samples. pean Parliament, 2010). Selected piglets were removed from the sow, approximately 150 min (±15) after the start of farrowing, and euthanized Animals and housing by an overdose of sodium pentobarbital (Dolethal, Vetoqui- At 113 d post-mating (± 1.27), the litter characteristics of nol, S.A., Madrid, Spain). Samples for gene expression anal- 80 litters (1,542 total born neonates) from 80 hyperprolific ysis were collected as described in Villagómez-Estrada et al., sows (DanBred hybrid line; Landrace × Yorkshire, parity (2021). Briefly, approximately at the midpoint of the jejunum, 4.78 ± 1.69) were recorded. Sows and their litters were fol- one sample of approximately 1.5 cm was collected, rinsed in lowed until weaning (21.6 ± 1.27 d). During the gestation and PBS solution, snap frozen in 1 mL of RNA later (Deltalab, lactation periods, sows were kept under commercial feeding Barcelona, Spain), and stored at −80 °C until processing. and management conditions. Gestation feed intake was indi- vidually controlled using a feeding electronic station (model Gene expression analysis Intec-Mac, Mannebeck, Schuttorf, Germany), whereas during Gene expression in jejunal tissue was performed on 56 genes the lactation period, the feeders were manually filled twice using an Open Array Real-Time PRC Platform (Applied a day (8:00 and 15:00 h) to guarantee ad libitum intake. Biosystems, Waltham, MA). All genes were involved in Sows were fed 2.4 kg/d from weaning to 35 d post-mating multiple physiological functions closely related to intes- and 2.1 kg/d from 35 to 110 d post-mating. Litter perfor- tinal health and were selected based on the literature and mance characteristics were recorded at farrowing and wean- grouped according to their main function as follows: 1) ing. Within 48 h after birth, piglets were processed (e.g., iron barrier function genes such as the family members of clau- administration, ear tagged) and cross-fostered to standardize dins (CLDN), mucins (MUC), zonula occludens (ZO), tre- litter size to 15 piglets/litter (in average, functional teats + 1 foil factor (TFF), and occludin (OCLN) (CLDN1, CLDN4, piglet as standard handling and management of the farm). CLDN15, MUC2, MUC13, ZO1, TFF3, and OCLN); 2) Water was provided ad libitum through a commercial nipples genes involved in immune and inflammatory responses such waterer. as pattern recognition receptors, cytokines, chemokines, and stress proteins [toll-like receptor (TLR2, TLR4); interleukin Experimental diet and measurements (IL-1β, IL6, IL8, IL10, IL17A, IL22); interferon gamma Sow BW was recorded at 35, 110 d of gestation and at wean- (IFNG, IFNGR1); tumor necrosis factor (TNF); trans- ing. Individual feed intake was recorded daily according forming growth factor beta 1 (TGF-β1); chemokine ligand to the electronic feeding station during the gestation phase (CCL20, CXCL2); heat shock protein (HSPB1, HSPA4); (35 to 110 d of gestation) while during lactation feed intake regenerating family member 3 gamma (REG3G); peroxisome Table 1. List of primers used in gene expression analysis by Open Array Real-Time PCR custom designed Gene Name Primer Forward (5´-3´) Primer Reverse (5´-3´) Probe (5´-3´) CLDN1 Claudin-1 CTTCGACTCCTTGCTGAATCTGA CTTCCATGCACTTCATACACTTCAT ACAGCACTTTGCAAGC CLDN4 Claudin-4 CCTCCGTGCTGTTCCTCAA GAGGCACAAGCCCAGCAA CCTTGTGGCACTTTG CLDN15 Claudin-15 GCTATCTCCTGGTATGCCTTCAA GGGACTTCCACACTCCTTGGT ACTTCTTCGACCCCTTGTA MUC2 Mucin 2 AAGGACGACACCATCTACCTCACT GGCCAGCTCGGGAATAGAC CATGGTCAGCACCCCG Villagómez-Estrada et al. MUC13 Mucin 13 CAGTGGAGTTGGCTGTGAAAAC ATCAAGTTCTGTTCTTCCACATTCTTG TCCTCTCATTAAGATCAAAC ZO1 Zonula occludens 1 GCTATGTCCAGAATCTCGGAAAA TGCTTCTTTCAATGCTCCATACC TCACCATCTTTTTACAACTAC TFF3 Trefoil factor 3 AGAACCTGCCCGTGACCAT CACACTGGTTCGCCGACAG AGGCCAGGATGTTCT OCLN Occludin CAGGTGCACCCTCCAGATTG CAGGCCTATAAGGAGGTGGACTT TGACATCAGCCATGTCAT TLR2 Toll-like receptor 2 CTCTCGTTGCGGCTTCCA AAGACCCATGCTGTCCACAAA CAAGGTCAACTCTCTG TLR4 Toll-like receptor 4 CATCCCCACATCAGTCAAGATACT TCAATTGTCTGAATTTCACATCTGG ACAGCAATAGCTTCTCCA IL1B Interleukin 1 beta GGTGACAACAATAATGACCTGTTATTTG GCTCCCATTTCTCAGAGAACCA ATGAAGTGCTGCACCC IL6 Interleukin 6 CCAATCTGGGTTCAATCAGGAG ACAGCCTCGACATTTCCCTTATT AGATATACCTGGACTACCTC IL8 Interleukin 8 GGAAAAGTGGGTGCAGAAGGT GAGAATGGGTTTTTGCTTGTTGT TACAGATATTTTTGAAGAGAACT IL10 Interleukin 10 TGAGGCTGCGGCGCT GAGCTTGCTAAAGGCACTCTTCA AACAAGAGCAAGGCCGT IL17A Interleukin 17 CCAGACGGCCCTCAGATTAC ATCTTCCTTCCCTTCAGCATTG CCATGGACTCTCCAACG IL22 Interleukin 22 TGTTCCCCAACTCTGATAGATTCC GTTGTTCACATTTCTCTGGATATGCT AGCTAAGCCAATGCCGTAT IFNG Interferon gamma TGACTTTGTGTTTTTCTGGCTCTT CACTCTCCTCTTTCCAATTCTTCAA ATCCTAAAGGACTATTTTAAT IFNGR1 Interferon gamma receptor 1 CATGTTACCCAAATCTTTGCTGTCT CAGTATGCACGCTTGAAATTGTC ATATATATCACCCATCACCTACC TNF Tumor necrosis factor alpha CACCACGCTCTTCTGCCTACT GACGGGCTTATCTGAGGTTTGA CAAGGACTCAGATCATCGT TGFB1 Transforming growth factor beta 1 GCGGCAGCTCTACATTGACTT GACCTTGCTGTACTGAGTGTCTAGG CCATGCCAATTTCTGCCT CCL20 Chemokine (C-C motif) ligand 20 GACCATATTCTTCACCCCAGATTT CACACACGGCTAACTTTTTCTTTG ATCAATGCAATCATCTTT CXCL2 Chemokine (C-X-C motif) ligand 2 CATGGTGAAGAAAATCATCGAGAA GCCAGTAAGTTTCCTCCATCTCTCT AACAAGAGCAGTGCCAAC HSPB1 Heat shock protein 27 CGAGGAGCTGACGGTCAAG GCAGCGTGTATTTTCGAGTGAA ACGGCTTCATTTCCCGGT HSPA4 Heat shock protein 70 TCAATTGCCTGCGATTAATGAA GAATGCCCCATGTCTACAAAAAC CAGTTGCTCTTGCATATG REG3G Regenerating-islet derived protein 3 TGCCTGATGCTCCTGTCTCA GGCATAGCAGTAGGAAGCATAGG CCAAGGTGAAGATTC gamma PPARGC1A Peroxisome proliferative activated receptor CTCTGGAACTGCAGGCCTAA TGGAGAAGCCCTAAAAGGGTTAT ACCCACAACTCCTCCT gamma, coactivator 1 alpha FAXDC2 Fatty acid hydrolase domain containing 2 CCATGACTACCACCATCTCAAGTT GCAGGATCGTGTGTCTCTCGTA TGTTCAAGCAGACCAAG GBP1 Guanylate binding protein 1 AGAATCCATCACAGCAGACGAGTA CGGATACAGAGTCGAGGCAGGTTAA TCAAGCTTAAGAAGGGTACCAG GPX2 Glutathione peroxidase 2 CAACCAATTTGGACATCAGGAG GGGTAAAGGTGGGCTGGAAT AGATCCTGAACAGCCTCA SOD2 Superoxide dismutase GGGTTGGCTCGGTTTCAA CATGCTCCCACACGTCGAT CTGCAAGGAACAACAGGTCT ALPI Intestinal alkaline phosphatase ATGTCTTCTCTTTTGGTGGCTACA GGAGGTATATGGCTTGAGATCCA AAGCTCCGTTTTTGGCCT SI Sucrase-isomaltase CGACCCCTTTTGCATGAGTT AAGGCTGGACCCCATAGGAA TTTAATGAAAAGCCAACCTG DAO1 Diamine oxidase GGAACCAACAGACCTTCAACTATCTC TTCGGAATCCCAGGACCAT CCGGACCCTTACTGGAAA HNMT Histamine N-methyltransferase TGTTGAACCAAGTGCTGAACAAAT ACTTTATGTTCTCGAGGTTTGATGTCTT ACCAAGTACAAAGAGCTT ANPEP Aminopeptidase-N AGGGCAACGTCAAAAAGGTG GTCAAAGCATGGGAAGGATTTC ACACAGATGCAGTCTACAG IDO1 Indoleamine 2,3 dioxygenase TTGGCAAATTGGAAGAAAAAGG CCGGAAATGAGAAGAGAATATCCAT CCAGTGGGCCCATGACTTAC 3 4 Table 1. Continued Gene Name Primer Forward (5´-3´) Primer Reverse (5´-3´) Probe (5´-3´) GCG Glucagon AGGCGTGCCCAGGATTTT CATCGTGACGTTTGGCAATG CACCAAGAGGAACAAGAA CCK Cholecystokinin CAGCAGGCTCGAAAAGCAC AATCCATCCAGCCCATGTAGTC CAGCCACAGAATAAGTGA IGF1R Insulin-like growth factor 1 receptor CCGACGCGGCAACAAC TCAGGAAGGACAAGGAGACCAA CTACGTGAAGATCCGCCA PYY Peptide tyrosine tyrosine CAGAGGTATGGGAAACGTGACA CCTTCTGGCCACGACTTGAC CAAACTGCTCTTCCCTGAA SLC5A1 Solute carrier family 5 (sodium/glucose GGCCATCTTTCTCTTACTGGCA TCCCACTTCATGAAAAGCAAAC TTTATACGGATACCTTGCAGAC cotransporter) member 1 SLC16A1 Monocarboxylate transporter 1 CCTTGTTGGACCTCAGAGATTCTC CCAGTATGTGTATTTATAGTCTCCG- CCACCACTTTTAGGTCGTC TATATGTC SLC7A8 Solute carrier family 7 (amino acid trans- TGTCGCTTATGTCACTGCAATGT GACAGGGCGACGGAAATG CTGTGACTTTTGGAGAGAA porter light chain, L System) member 8 SLC15A1 Solute carrier family 15 (oligopeptide GGTTATCCCTTGAGCATCTTCTTC AGTGCTCTCATTCCATAGTAGGAAAA TCAACGAGTTCTGTGAAAG transporter) member 1 SLC13A1 Solute carrier family 13 (sodium/sulfate GGTACCTCCACCAACTTGATCTTC ATCCAAAGTTGATGCAGTGACAAT ATTTCAATATGCGCTACCC symporters) member 1 SLC11A2 Solute carrier family 11 (proton-coupled GTCTTTGCCGAAGCGTTTTTT ACCACGCCCCCTTTGTAGA CCAACCAGCAGGTGGT divalent metal ion transporter) member 2 SLC30A1 Solute carrier family 30 (zinc transporter) AATTGGACCGGACAGATCCA TCTCTGATAAGATTCCCATTCACTTG AAAAGTCCAGAAGTGATGC member 1 SLC39A4 Solute carrier family 39 (zinc transporter) ATCTTTGGGCTCTTGCTCCTT GCAGCCCCAGCACCTTAG CTGCTACCCACTACGTCA member 4 MT1A Metallothionein 1A TGAATCCGCGTTGCTCTCT CAGGAGCAGCAGCTCTTCTT ACGTGCAAAACCTGCAGA CRHR1 Corticotropin releasing hormone receptor CAGGGCCCCATGATATTGG CCGGAGTTTGGTCATGAGGAT CTGATCAACTTTATCTTCC 1 NR3C1 Glucocorticoid receptor GGCAATACCAGGATTCAGGAACT CCATGAGAAACATCCATGAATACTG TGACCAAATGACCCTCCT HSD11B1 Hydroxysteroid (11-beta) dehydrogenase 1 GGTCAGAAGAAACTCTCAAGAAGGTG GCGAAGGTCATGTCCTCCAT TCTTCAGCACACTACGTTG B2M Beta-2-microglobulin TCACTCCTAACGCTGTGGATCA CGGTTAGTGGTCTCGATCCC AGCACGTGACTCTCGATA GAPDH Glyceraldehyde-phosphate-dehydrogenase TTCGTCAAGCTCATTTCCTGGTA TCCTCGCGTGCTCTTGCT AATTTGGCTACAGCAACAG TBP TATA-box binding protein CAGAATGATCAAACCGAGAATTGT CTGCTCTGACTTTAGCACCTGTTAA TTTGTCTCTGGAAAAGTTGT Journal of Animal Science, 2022, Vol. 100, No. 6 Villagómez-Estrada et al. 5 proliferator activated receptor gamma (PPARGC1α); fatty Table 2. Reproductive performance and growth of sow and piglets during acid hydroxylase domain containing (FAXDC2) and gua- the studied period nylate binding protein (GBP1)]; 3) antioxidant enzymes genes (glutathione peroxidase, GPX2; superoxide dismutase, Item Mean SD SOD2); 4) digestive enzymes and hormones genes involved Sows, n 80 – in the digestion and metabolism processes [alkaline phospha- Sow BW, kg tase intestinal (ALPI); sucrase-isomaltase (SI); d-amino-acid  Gestation (d 35) 248.3 36.97 oxidase (DAO1); histamine N-methyltransferase (HNMT); alanyl aminopeptidase membrane (ANPEP); indoleamine  Gestation (d 110) 270.9 28.80 2,3-dioxygenase (IDO1); glucagon (GCG); cholecystokinin  Weaning (d 24) 259.7 33.32 (CCK); insulin-like growth factor (IGF1R); and peptide YY Average daily feed intake gestation, kg 2.33 0.09 (PYY)]; 5) nutrient transport coding genes [(solute carrier Average daily feed intake lactation, kg 7.45 1.22 family (SLC5A1, SLC16A1, SLC7A8, SLC15A1, SLC13A1, Reproductive parameters SLC11A2, SLC30A1, SLC39A4) and Metallothionein At birth (MT1A)]; and 6) stress response genes [corticotropin releas-  Total born pigs1, n 19.3 4.02 ing hormone receptor (CRHR1); nuclear receptor (NR3C1);  Pigs born alive, n 16.1 3.44 and hydroxysteroid (11-beta) dehydrogenase (HSD11β1)]. Four housekeeping genes were used to calculate the relative  Born alive litter birth weight, kg 21.0 3.90 values for gene data [actin beta (ACTB); beta-2-microglob-  Born alive pig weight, kg 1.3 0.20 ulin (B2M); glyceraldehyde-3-phosphate dehydrogenase At weaning (GAPDH); and TATA-box binding protein (TBP)]. The RNA  Total weaned pigs, n 14.2 1.69 gene expression analysis was performed according to the  Litter weaning weight, kg 74.7 14.63 methodology described in Villagómez-Estrada et al., (2021).  Weaned pig mean BW, kg 5.3 0.82 Briefly, from 50 mg of frozen jejunum tissue, the RNA was  BW Q1 3.6 0.52 obtained using the RiboPure kit (Ambion, Austin, TX) and  BW Q2 4.8 0.27 following the manufacturer’s instruction. The quality and quantity of RNA was assessed with a NanoDropND-1000  BW Q3 5.7 0.23 spectrophotometer (NanoDrop products, Wilmington, DE),  BW Q4 7.0 0.73 whereas the RNA integrity was checked with Agilent Bioan- At sampling2 alyzer-2100 equipment (Agilent Technologies, Santa Clara, Litter, n 10 – CA). Reverse transcription of approximately 1 µg of total  Birthweight light, kg 0.7 0.10 RNA to single-stranded cDNA in a final volume of 20 μL  Birthweight middle, kg 1.3 0.17 was performed using a High-Capacity cDNA Reverse Tran-  Weaning light, kg 3.1 0.48 scription kit (Applied Biosystems, Foster City, CA) and ran-  Weaning middle, kg 4.7 0.34 dom hexamer primers. The thermal cycler conditions applied were as follows: 25 °C 10 min; 37 °C 120 min; 85 °C 5 min; SD, standard deviation. and 4 °C hold. Description of primers used are shown in 1 Total born includes born alive and stillborn piglets. Table 1. Gene expression analysis was performed in dupli- 2 Data are arithmetic means of 10 piglets for each category and period. cates for each sample. Data were collected and analyzed using the ThermoFisher Cloud software 1.0 (Applied Biosys- Results tems) applying the 2−ΔΔCt method for relative quantification and using the sample with the lowest expression as a cali- Description of the sow and litter performance is shown brator. The maximum cycle relative threshold was adjusted in Table 2. The average BW of the sampled light and mid- at 26, amplification score < 1.240, quantification cycle con- dle-weigh piglets at birth was 741 and 1,367 g, whereas fidence > 0.8, and the maximum standard deviation between at the end of suckling period was 3,125 and 4,733 g, duplicates was set at < 0.38. respectively. All samples showed an adequate amplifica- tion. The effect of piglet BW on the intestinal expression of some genes involved in multiple physiological functions Statistical analysis is shown in Table 3. At birth, light piglets showed a down- Data of gene expression were analyzed with one-way ANOVA regulation of genes from immune response (FAXDC2, considering BW piglet category as a main factor. The effect HSPB1, PPARGC1α), antioxidant enzymes (SOD2m), of sow was not considered within the statistical model. Two digestive enzymes (ANPEP, IDO1, SI), and nutrient trans- separate analyses were performed, at birth and at the end of porter (SLC39A4) (P < 0.05), but also a tendency for a the lactation period. Gene expression data were subjected to higher mRNA expression of GBP1 (immune/inflammation a logarithmic transformation to get closer to the Gaussian response) and HSD11β1 (stress enzyme) compared to their distribution. The Benjamini and Hochberg false discovery heavier littermates (P < 0.10). In fact, the tendency for rate (FDR) multiple testing correction was also performed HSD11β1 higher gene expression in light piglets was also using the p.adjust function of R software v.3.4.3 (Benjamini observed at the end of the suckling period. At that age, the and Hochberg, 1995). All statistical analyses were performed light piglets of the litter had a higher mRNA expression of using R software and Bioconductor software (Gentleman et five genes involved in barrier function (CLDN1), pro-in- al., 2004). Significance was declared at a probability P ≤ 0.05, flammatory response (CXCL2, IL6), digestive enzyme and tendencies were considered when P-value was between (IDO1), and stress hormone signaling (HSD11β1) com- >0.05 and <0.10 using Tukey adjust. pared to the middle-weight piglets (P < 0.05). Likewise, 6 Journal of Animal Science, 2022, Vol. 100, No. 6 Table 3. Relative gene expression in light and middle weight piglets at birth and at weaning (20 d)1 Function Birth weight Weaning weight Gene Light Middle SEM P FDR Light Middle SEM P FDR Barrier function Claudin-1 CLDN1 1.10 0.94 0.071 0.322 0.650 2.41 1.02 0.091 0.046 0.415 Immune response Fatty acid hydrolase domain FAXDC2 1.70 3.12 0.063 0.010 0.138 107.57 129.83 0.152 0.702 0.887 containing 2 Guanylate binding protein 1 GBP1 0.31 0.06 0.141 0.062 0.319 1.53 1.19 0.093 0.806 0.907 Heat shock protein 1 HSPB1 1.27 1.81 0.029 0.002 0.083 3.47 3.33 0.045 0.970 0.992 Peroxisome proliferative activated PPARGC1α 2.87 4.79 0.062 0.012 0.138 2.73 2.67 0.102 0.391 0.815 receptor gamma, coactivator 1 alpha Interleukin 6 IL6 1.18 1.44 0.119 0.517 0.820 6.38 1.90 0.097 0.007 0.165 Chemokine ligand 2 CXCL2 1.20 0.90 0.078 0.263 0.650 10.99 4.08 0.101 0.025 0.283 Antioxidant enzyme Superoxide dismutase SOD2m 1.17 1.37 0.027 0.100 0.462 1.40 1.20 0.059 0.673 0.887 Digestive enzyme Aminopeptidase-N ANPEP 0.61 0.72 0.027 0.047 0.311 1.68 1.44 0.092 0.615 0.887 Indoleamine 2,3-dioxygenase IDO1 1.40 4.72 0.120 0.040 0.310 12.90 3.30 0.115 0.024 0.283 Sucrase-isomaltase SI 7.27 55.70 0.171 0.006 0.131 130.06 84.69 0.573 0.206 0.815 Nutrient transporter Solute carrier family 39 member 4 SLC39A4 1.31 2.19 0.074 0.028 0.258 1.88 1.64 0.095 0.752 0.887 (Zn transporter) Stress enzyme Hydroxysteroid (11-beta) dehydro- HS- 2.88 1.92 0.029 0.062 0.319 3.60 1.73 0.056 0.002 0.079 genase 1 D11β1 Stress hormone Corticotropin releasing hormone CRHR1 2.33 2.39 0.094 0.982 0.985 7.15 3.63 0.120 0.060 0.451 receptor 1 1 Data are means of 10 piglets for each category and correspond to back-transformed values. Gene expression values are indicated as ratios of cycle relative threshold value for each gene normalized to that of the reference sample. Only significant (P-value < 0.05) and tendency (P-value < 0.10) differences are presented. SEM, standard error of the mean; FDR, false discovery rate. a tendency for an up-regulation of CRHR1 gene in light- regulation of the nutrient transport gene (SLC39A4) of Zn, weight piglets was observed (P < 0.10; Table 3). considered as the major intracellular Zn transporter (Mar- tin et al., 2013), may be involved in the changes observed in other physiological genes that need Zn for their proper Discussion expression (Suttle, 2010). Considering that the small intes- The intestinal mucosa possesses a complex function; it does tine plays an essential role not only in diet digestion and not only play an important role in epithelial barrier and nutri- nutrient absorption but also in immune response, this ent digestion but is also part of a well-organized immune reduced gene expression observed in piglets of light birth- system (Okumura and Takeda, 2017). Like BW, the devel- weight may seriously compromise immunity functionality, opment and functionality of the gastrointestinal tract can be as previously noted (Michiels et al., 2013; Qi et al., 2019; impaired due to prenatal events (Dong et al., 2014; Farmer Li et al., 2021). Indeed, a decreased development of gastro- and Edwards, 2021). This becomes especially important at intestinal tract (e.g., length, weight, and secretory capacity), weaning when stress and pro-inflammatory events occurred. even after 18 to 28 d post-weaning, has been observed in In the present study, intestinal gene expression at birth showed piglets with light birthweight compared to their average birth the immaturity of the light piglets intestine due to a reduced weight littermates (912 g vs. 1,287 g BW; Michiels et al., activation of digestive (ANPEP, IDO1, SI), nutrient trans- 2013). Noteworthy, an over-expression of HSD11β1 gene port (SLC39A4), immunity/inflammation (FAXDC2, GBP1, was found in piglets with lower BW both at birth and at HSPB1, PPARGC1α), and antioxidant (SOD2m) genes weaning. The HSD11β1 gene is encoding for the enzyme that accompanied also by an overexpression of the stress enzyme converts inactive cortisone to the active cortisol, therefore gene HSD11β1. For instance, the down-regulated digestive regulating tissue glucocorticoid levels and playing a critical genes such as ANPEP, IDO1, and SI are mainly involved role in metabolism and inflammatory response (Nixon et al., in the final digestive process of proteins, amino acids, and 2012; Huang et al., 2020). The fact that it remains elevated carbohydrates but may also act in an anti-inflammatory way until the end of lactation shows that the fetal distress and the (Trevisi et al., 2012; Xu et al., 2015). Moreover, the down- neonatal inflammatory condition are not reverted with age, Villagómez-Estrada et al. 7 hence suggesting that this negative impact may last until later Acknowledgments in life. Since newborn piglets were not allowed to consume We gratefully acknowledge the support of the UAB-Banco de colostrum, further studies are needed to assess the influence Santander Talent Program for the provision of research schol- of colostrum, the primary source of nutrients and immuno- arship for David Solà-Oriol. globulins to piglets, in improving these physiological func- tions of piglets impaired by uterine overcrowding. Excluding HSD11β1 gene, all these intestinal gene expres- Conflict of Interest Statement sion differences initially observed at birth between light and middle-weight piglets disappeared at the end of the suckling The authors declare no real or perceived conflicts of interest. period, indicating the normal acquisition of these functions along the suckling phase. Interestingly, at the end of the suckling period, a posi- Literature Cited tive up-regulation of CLDN1 gene (barrier function) was van Barneveld, R. J., and R. J. E. Hewitt. 2016. Reducing variation in observed in light piglets, together with an overexpression of pork production systems through maternal and pre- and post-wean- some important pro-inflammatory genes (IL6 and CXCL2, ing nutrition strategies. Anim. Prod. Sci. 56:1248. doi:10.1071/ IDO1) and stress hormone receptor (CRHR1, HSD11β1) AN15396. compared to heavier piglets. On the one hand, the upregula- Benjamini, Y., and Y. Hochberg. 1995. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J. R. tion of CLDN1, an essential structural and functional com- Stat. Soc. Ser. B. (Methodol) 57(1):289–300. http://www.jstor.org/ ponent of tight junctions (Günzel and Yu, 2013), may suggest stable/2346101. an enhancement in the regulation of intestinal permeability. Bérard, J., M. Kreuzer, and G. Bee. 2008. Effect of litter size and However, the concomitant upregulation of stress hormone birth weight on growth, carcass and pork quality, and their rela- signaling (CRHR1, HSD11β1) and pro-inflammatory genes tionship to postmortem proteolysis. J. Anim. Sci. 86:2357–2368. (IL6) and their cofactors (IDO1) might be also highlighting doi:10.2527/jas.2008-0893. the stressful status that light piglets are experiencing. Partic- Burdge, G. C., M. A. Hanson, J. L. Slater-Jefferies, and K. A. Lilly- ularly, HSD11β1 and CRHR1 genes have been suggested as crop. 2007. Epigenetic regulation of transcription: a mechanism stress-induced mediators of an impaired intestinal barrier and for inducing variations in phenotype (fetal programming) by dif- hypersecretion on early weaned piglets (Meddings and Swain, ferences in nutrition during early life? Br. J. Nutr. 97:1036–1046. doi:10.1017/S0007114507682920. 2000; Smith et al., 2010) and in piglets under a lipopolysac- Dong, L., X. Zhong, H. Ahmad, W. Li, Y. Wang, L. Zhang, and T. charide challenge (Zhu et al., 2016). The IDO1 gene encodes Wang. 2014. Intrauterine growth restriction impairs small intesti- the enzyme Indoleamine 2,3-dioxygenase that catalyzes nal mucosal immunity in neonatal Piglets. J. Histochem. Cytochem. L-tryptophan degradation, but also acts as an immunoregula- 62:510–518. doi:10.1369/0022155414532655. tor which activity seems to be increased under pro-inflamma- European Parliament. 2010. Directive 2010/63/EU of the European tory circumstances (Frumento et al., 2002). Parliament and of the Council of 22 of September 2010 on the Taking together these findings, the postnatal growth retar- protection of animals used for scientific purposes. Off. J. 33–79. dation not only impairs farm economic performance but Available on: http://data.europa.eu/eli/dir/2010/63/oj. also negatively affects several physiological functions by Farmer, C., and S. A. Edwards. 2021. Review: improving the perfor- increasing pro-inflammatory and stress responses. Among mance of neonatal piglets. Animal 100350. doi:10.1016/j.ani- mal.2021.100350. the pathophysiological changes associated with proinflam- Frumento, G., R. Rotondo, M. Tonetti, G. Damonte, U. Benatti, and matory cytokines and stress molecules is the redistribution G. B. Ferrara. 2002. Tryptophan-derived catabolites are responsi- of nutrients, such as energy and amino acids, that were ini- ble for inhibition of T and natural killer cell proliferation induced tially destined for growth (Huntley et al., 2018). It could be by indoleamine 2,3-dioxygenase. J. Exp. Med. 196:459–468. speculated that in young pigs, nutrient and immune provi- doi:10.1084/jem.20020121. sions during the lactation period are not enough to satisfy the Gentleman, R. C., V. J. Carey, D. M. Bates, B. Bolstad, M. Dettling, needs of the poorly developed piglets that must compete with S. Dudoit, B. Ellis, L. Gautier, Y. Ge, J. Gentry, et al. 2004. Bio- their littermates for milk provision. In fact, light piglets have conductor: open software development for computational biol- shown a deteriorated post-natal and post-weaning develop- ogy and bioinformatics. Genome Biol. 5(10):1–16. Article R80. ment (Bérard et al., 2008; Ji et al., 2017; Rodrigues et al., doi:10.1186/gb-2004-5-10-r80. Günzel, D., and A. S. L. Yu. 2013. Claudins and the modulation of tight 2020), with impaired characteristics of organs and carcasses junction permeability. Physiol. Rev. 93:525–569. doi:10.1152/ (Rehfeldt and Kuhn, 2006; Bérard et al., 2008) compared to physrev.00019.2012. those of piglets with heavier weights. The impaired physio- Huang, P., Y. Li, C. Xu, G. Melino, C. Shao, and Y. Shi. 2020. HSD11B1 logical functions of light piglets observed in the present study is upregulated synergistically by IFNγ and TNFα and mediates support the concept that the unsatisfactory nutrient supply TSG-6 expression in human UC-MSCs. Cell Death Discov. 6:24. to the fetus/neonate is an important factor influencing their doi:10.1038/s41420-020-0262-7. postnatal physiological performance (Larriestra et al., 2006; Huntley, N. F., C. M. Nyachoti, and J. F. Patience. 2018. Lipopolysac- Farmer and Edwards, 2021). charide immune stimulation but not β-mannanase supplementation In conclusion, light BW piglets at birth and at the end of affects maintenance energy requirements in young weaned pigs. J. suckling period seem to have an impaired gut development Anim. Sci. Biotechnol. 9:47. doi:10.1186/s40104-018-0264-y. Ji, Y., Z. Wu, Z. Dai, X. Wang, J. Li, B. Wang, and G. Wu. 2017. Fetal and nutrient absorption, as well as higher pro-inflammatory and neonatal programming of postnatal growth and feed efficiency responses compared to their average weight littermates. Fur- in swine. J. Anim. Sci. Biotechnol. 8:1–15. doi:10.1186/s40104- ther studies are needed to investigate the short- and long-term 017-0173-5. consequences of the gut immaturity of light BW piglets, com- Kraeling, R. R., and S. K. Webel. 2015. Current strategies for reproduc- ing from large litters, on their feed efficiency as well as their tive management of gilts and sows in North America. J. Anim. Sci. abilities to cope with post-weaning challenges. Biotechnol. 6:3. doi:10.1186/2049-1891-6-3. 8 Journal of Animal Science, 2022, Vol. 100, No. 6 Kwon, E. J., and Y. J. Kim. 2017. What is fetal programming?: a lifetime Rehfeldt, C., and G. Kuhn. 2006. Consequences of birth weight for post- health is under the control of in utero health. Obstet. Gynecol. Sci. natal growth performance and carcass quality in pigs as related to 60:506. doi:10.5468/ogs.2017.60.6.506. myogenesis. J. Anim. Sci. 84:E113–E123. doi:10.2527/2006.8413_ Larriestra, A. J., S. Wattanaphansak, E. J. Neumann, J. Bradford, R. B. supplE113x. Morrison, and J. Deen. 2006. Pig characteristics associated with Rodrigues, L. A., M. O. Wellington, J. M. Sands, L. P. Weber, T. D. Olver, mortality and light exit weight for the nursery phase. Can. Vet. J. D. P. Ferguson, and D. A. Columbus. 2020. Characterization of a 47(6):560–566. PMID: 16808228; PMCID: PMC1461411. swine model of birth weight and neonatal nutrient restriction. Curr. Li, T., S. Huang, L. Lei, S. Tao, Y. Xiong, G. Wu, J. Hu, X. Yuan, S. Zhao, Dev. Nutr. 4(8):nzaa116:1–8. doi:10.1093/cdn/nzaa116. B. Zuo, et al. 2021. Intrauterine growth restriction alters nutrient Smith, F., J. E. Clark, B. L. Overman, C. C. Tozel, J. H. Huang, J. E. metabolism in the intestine of porcine offspring. J. Anim. Sci. Bio- F. Rivier, A. T. Blisklager, and A. J. Moeser. 2010. Early weaning technol. 12:15. doi:10.1186/s40104-020-00538-y. stress impairs development of mucosal barrier function in the Martin, L., R. Pieper, N. Schunter, W. Vahjen, and J. Zentek. 2013. porcine intestine. Am. J. Physiol. Liver Physiol. 298:G352–G363. Performance, organ zinc concentration, jejunal brush border mem- doi:10.1152/ajpgi.00081.2009. brane enzyme activities and mRNA expression in piglets fed with Suttle, N. F. 2010. Mineral Nutrition of Livestock, 4th ed. Oxon, Unit- different levels of dietary zinc. Arch. Anim. Nutr. 67:248–261. doi: ed Kingdom. 10.1080/1745039X.2013.801138. Trevisi, P., E. Corrent, S. Messori, S. Formica, D. Priori, and P. Bosi. Matheson, S. M., G. A. Walling, and S. A. Edwards. 2018. Genetic selec- 2012. Supplementary tryptophan downregulates the expression of tion against intrauterine growth retardation in piglets: a problem genes induced by the gut microbiota in healthy weaned pigs sus- at the piglet level with a solution at the sow level. Genet. Sel. Evol. ceptible to enterotoxigenic Escherichia coli F4. Livest. Sci. 147:96– 50:1–11. doi:10.1186/s12711-018-0417-7. 103. doi:10.1016/j.livsci.2012.04.008. Meddings, J. B., and M. G. Swain. 2000. Environmental stress–induced Villagómez-Estrada, S., J. F. Pérez, S. van Kuijk, D. Melo-Durán, A. gastrointestinal permeability is mediated by endogenous glucocor- Forouzandeh, F. Gonzalez-Solè, M. D., ’ Angelo, F. J. Pérez-Cano, ticoids in the rat. Gastroenterology 119:1019–1028. doi:10.1053/ and D. Solà-Oriol. 2021. Strategies of inorganic and organic trace gast.2000.18152. mineral supplementation in gestating hyperprolific sow diets: ef- Michiels, J., M. De Vos, J. Missotten, A. Ovyn, S. De Smet, and C. Van Gin- fects on the offspring performance and fetal programming. J. Anim. neken. 2013. Maturation of digestive function is retarded and plas- Sci. 99:1–14. doi:10.1093/jas/skab178. ma antioxidant capacity lowered in fully weaned low birth weight Viott, R. C., T. A. Menezes, A. P. G. Mellagi, M. L. Bernardi, I. Wentz, piglets. Br. J. Nutr. 109:65–75. doi:10.1017/S0007114512000670. and F. P. Bortolozzo. 2018. Performance of low birth-weight piglets Nixon, M., D. J. Wake, D. E. Livingstone, R. H. Stimson, C. L. Esteves, upon protein-energy and/or colostrum supplementation. Arq. Bras. J. R. Seckl, K. E. Chapman, R. Andrew, and B. R. Walker. 2012. Med. Veterinária e Zootec. 70:1293–1300. doi:10.1590/1678- Salicylate downregulates 11β-HSD1 expression in adipose tissue in 4162-9798. obese mice and in humans, mediating insulin sensitization. Diabe- Ward, S. A., R. N. Kirkwood, and K. J. Plush. 2020. Are larger litters tes 61:790–796. doi:10.2337/db11-0931. a concern for piglet survival or an effectively manageable trait? NRC. 2012. Nutrient requirements of swine. 12th ed. National Acade- Animals 10:309. doi:10.3390/ani10020309. mies Press, Washington, D.C. Xu, S., D. Wang, P. Zhang, Y. Lin, Z. Fang, L. Che, and D. Wu. 2015. Okumura, R., and K. Takeda. 2017. Roles of intestinal epithelial cells Oral administration of Lactococcus lactis-expressed recombinant in the maintenance of gut homeostasis. Exp. Mol. Med. 49:e338– porcine epidermal growth factor stimulates the development and e338. doi:10.1038/emm.2017.20. promotes the health of small intestines in early-weaned piglets. J. Peltoniemi, O., J. Yun, S. Björkman, and T. Han. 2021. Coping with Appl. Microbiol. 119:225–235. doi:10.1111/jam.12833. large litters: the management of neonatal piglets and sow repro- Zhu, H., Y. Liu, S. Chen, X. Wang, D. Pi, W. Leng, F. Chen, J. Zhang, duction. J. Anim. Sci. Technol. 63:1–15. doi:10.5187/jast.2021.e3. and P. Kang. 2016. Fish oil enhances intestinal barrier function and Qi, M., B. Tan, J. Wang, J. Li, S. Liao, J. Yan, Y. Liu, and Y. Yin. 2019. Small inhibits corticotropin-releasing hormone/corticotropin-releasing intestinal transcriptome analysis revealed changes of genes involved hormone receptor 1 signalling pathway in weaned pigs after lipo- in nutrition metabolism and immune responses in growth retardation polysaccharide challenge. Br. J. Nutr. 115:1947–1957. doi:10.1017/ piglets. J. Anim. Sci. 97:3795–3808. doi:10.1093/jas/skz205. S0007114516001100.