Iran J Public Health, Vol. 51, No.7, Jul 2022, pp.1594-1601 Original Article Expression Patterns of miR181a and miR30d in Patients with Breast Cancer Alireza Tavakolpournegari 1,2, *Mehrdad Hashemi 2,3, Shohreh Zare Karizi 4, Arash Matin Ahmadi 4,5 , Seyed Hesamoddin Bidooki 6, Gooya Banaei 1 1. Group of Mutagenesis, Department of Genetics and Microbiology, Faculty of Science and Bioscience, Autonomous University of Barcelona, Bellaterra, Spain 2. Department of Genetics, Faculty of Advanced Science and Technology, Tehran Medical Sciences, Islamic Azad University, Tehran, Iran 3. Farhikhtegan Medical Convergence Sciences Research Center, Farhikhtegan Hospital Tehran Medical Sciences, Islamic Azad University, Tehran, Iran 4. Department of Genetics, Varamin-Pishva Branch, Islamic Azad University, Varamin, Tehran, Iran 5. Biological and Veterinary Sciences Faculty, Cellular and Molecular Biology Group, Nicolaus Copernicus University, Torun, Poland 6. Department of Biochemistry and Molecular and Cellular Biology, Faculty of Veterinary Medicine, Health Research Institute of Aragon, University of Zaragoza, E-50013 Zaragoza, Spain *Corresponding Author: Email: mhashemi@iautmu.ac.ir (Received 16 Feb 2021; accepted 18 Apr 2021) Abstract Background: One of the important molecular pathways in breast cancer is the PTEN-PI3K-AKT pathway. Any change in the activity of the PTEN gene can alter the PI3K-AKT pathway. Moreover, there are subsets of genes and pathways their expression changes by post-transcriptional regulations. For instance, gene regulation alters by non-coding RNAs such as micro-RNAs as post-transcriptional regulators that prevent the expression of the target transcript. Therefore, it is essential to assess the related alterations in micro-RNA expression pat- terns to find out the possible causes of conversions in related transcripts and pathways such as the PTEN- PI3K-AKT pathway in breast cancer. Methods: To determine the expression level of miR-181a and miR-30d in 30 breast tumor samples and 30 adjacent normal samples, the RNA extraction, and cDNA synthesis was performed by RiboEx (GeneAll, Ko- rea). Finally, the Real-Time PCR method was used for quantitative analysis of the expression levels of these miRNAs. all the experimental part of the project in done at Islamic Azad University in 2017. Results: After analyzing comparisons in the expression level of miR-181a and miR-30d in tumor and normal tissues, there was a significant increase in the expression level of miR-181a in tumor samples compared with normal samples. Moreover, the expression level of miR-30d in tumor samples reported a significant decrease in comparison with normal samples (P<0.05). Conclusion: Upregulation of miR-181a may affect the transcription of the PTEN gene resulting in the cell progress to cancer. The Downregulation of miR-30d may also lead to cancer cell growth, due to a reduction in the affecting on the CREB gene transcript. Keywords: Breast Cancer; Micro RNAs; Real-time PCR; Post-transcriptional regulation Copyright © 2022 Tavakolpournegari et al. Published by Tehran University of Medical Sciences. This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International license. (https://creativecommons.org/licenses/by-nc/4.0/). Non-commercial uses of the work are permitted, provided the original work is properly cited 1594 Available at: http://ijph.tums.ac.ir Tavakolpournegari et al.: Expression Patterns of miR181a and miR30d in Patients … Introduction Breast cancer is the most common cancer and shown important roles in many biological func- the second leading cause of death for cancer tions for these types of RNAs such as their role among women in the world (1). Despite several in differentiating, evolving, metabolism, and can- recent advances in breast cancer diagnosis and cer-related processes and even diseases such as treatment such as targeted chemotherapies and diabetes, Alzheimer's, as well as heart disease, their combinations, surgery, hormonal therapy, autism, and fragile X syndrome (11). and radiotherapy (2,3), the treatments for Breast According to the undeniable role of miRNAs in cancer still have many limitations, like resistance biological pathways, we have investigated the and a lack of reliable biomarkers (4). Breast can- miRNAs that have a straight impact on the cer still is a major cause of death in women PTEN pathway. In this paper by considering worldwide (3). Realizing the biology and signaling previous studies on miRNAs and miRNA data- pathways of malignant maladies like breast cancer bases such as mirDB.org and mirbase.org (to is a crucial prerequisite to cope with this problem identify the score of each miRNA that targeting (3). the PTEN pathways genes); we have investigated PTEN pathway is one of the main pathways that the expression level of miRNA181a and miR- play a key role in breast cancer. Since the PTEN NA30d as regulators of the PTEN signaling network contains cell-surface growth factor re- pathway. miR-181a targets very important genes ceptors for activating transcription factors that involved in most significant molecular pathways are in the nucleus and complemented by inter- so that the lack of proper alignment of these connecting with other signaling pathways. In genes can lead to a variety of cancers, including breast cancer, the pathway associated with the breast cancer. PTEN gene is the PI3K-AKT signaling pathway Previous studies on this micro-RNA indicated that in which PTEN acts as a tumor suppressor the effect of miR-181a on the development of (5). Any alteration in this pathway results in ir- breast cancer. For instance, in a study, the associ- reparable consequences such as the progression ation between increased expression of miR-181a of the cell towards cancerous. This pathway was detected by regulating the misleading expres- could be influenced by various types of genetic sion of the ATM gene and the development of factors especially, post-transcriptional regulations. breast cancer (12). miR-181a acts as a negative One of the most important elements, which af- regulator of the progesterone receptor (PR) in fect this pathway, is microRNAs (6,7). breast cancer by increasing its expression (13). MicroRNAs (miRNAs) are a group of non- Moreover, this microRNA is free in body fluids coding RNAs that have a length of about 18-25 and can be also used as a biomarker for the nucleotides and after transcription, have direct prognosis of HER2+ breast cancer type (14) (15). impact on the transcription of their target tran- On the other hand, since, miR-30d is known as a scripts. They trigger this procedure by connecting tumor suppressor, not only acts as a regulator in to complementary sequences, which are often normal and malignant tissues, including cell de- located in the 3'UTR region of the targeted velopment, apoptosis, proliferation, migration, mRNA (8). Of course, these complementary se- invasion, and angiogenesis but also is significantly quences are present in coding regions, 5'UTRs, associated with several tumor-related pathways, and even promoters (8,9). Hundreds of genes in such as Rho family, GTPases and PI3K/AKT the human genome code for these types of signaling pathways (16,17). RNAs. miRNAs control about 30% of the pro- Therefore, we aimed to investigate the miR-181a tein-coding genome (10). Recent studies have and miR-30d expression patterns related to the Available at: http://ijph.tums.ac.ir 1595 Iran J Public Health, Vol. 51, No.7, Jul 2022, pp.1594-1601 PTEN-PI3K pathway in breast cancer to turn on breast cancer in 2017 (Table 1). In all of the sam- a peep light in discovering the causes of conver- ple tissues, the type of breast cancer was infiltrat- sions in this pathway. ing ductal, NOS. Besides, this research was per- formed at Islamic Azad University of Tehran Materials and Methods Medical Sciences and human samples were col- lected from “Biological materials were provided Patient’s characteristics by the Iran National Tumor Bank founded by Human specimens were used to determine the Cancer Institute of Tehran University of Medical expression of miR-181a and miR-30d. Overall, 30 Sciences, for Cancer Research” with the ethical tumor tissues, and adjacent tumor tissues (as a committee with IR.IAU.TMU.REC.1396.213 normal sample) were taken from 30 patients with identification number. Table 1: Pathological features of Breast Cancer Tissues Age(yr) Gender Tumor size Tumor Size Age groups Frequency (%) Male Female 1cm-3cm 3cm-6cm I II III 20-30 1 (3.%) 0 (0) 30 (100) 18 (60) 12 (40) 4(13) 16(53) 9(30) 30-40 6 (20) 40-50 9 (30) 50-60 8 (26.7) 60-70 6 (20) This research was performed at Islamic Azad total extracted RNA in the final volume was de- University of Tehran Medical Sciences branch termined by spectrophotometry. with the ethical committee identification number: “IR.IAU.TMU.REC.1396.213”. Human samples cDNA synthesis for miRNA and Biological materials are provided by the Iran Concerning the small size of the microRNAs, National Tumor Bank, founded by the Cancer their cDNA synthesis is accomplished with a Institute of Tehran University of Medical Scienc- stem-loop primer. In which mentioned miRNA es, for Cancer Research. primer design, a unique Stem-loop sequence is Concerning Table 2, all of the patients were considered for the synthesis of cDNAs. The women and were in stages 1 to 4 of breast cancer. length of this sequence is 44 nucleotides. To cre- People aged 29-60 yr old. ate the stem-ring primers, 6 nucleotide comple- ments of the end 3', and the studied microRNAs RNA extraction and the desired reference RNA, are added to the Total RNA was isolated from each tumor tissue end of the sequence (18). In this study, specific and its adjacent non-tumor tissue by using Ribo- and separate stem-loop primers for miR-181a-5p Ex (GeneAll, Korea) according to the manufac- and miR-30d-5p were used to synthesize cDNA turer’s specifications, and the concentration of (Table 2). Table 2: Specification and sequences of stem-loop primers used to test the expression of mir-181a-5p and mir30d-5p. miRNA Length Tm GC Sequences % mir-181a-5p 50 79.4 50 5´GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGA TACGACACTCAC3´ Mir-30d-5p 50 85.5 56 5´GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGA TACGACACTCAC3´ RNU44 52 89 57.7 5´GTCGTATCCAGTGCAGGGTCCGACCGGTATTCGACTGG ATACGACAGTCAG3´ 1596 Available at: http://ijph.tums.ac.ir Tavakolpournegari et al.: Expression Patterns of miR181a and miR30d in Patients … Real-time quantitative PCR for two selected microRNAs, PCR amplification Real-time PCR was accomplished by using Step was set to an initial 95 °C for 15 min and then for One Plus™ Real-Time PCR Systems (ABI Ap- mir181a and mir30d, 40 cycles, 95 °C for 15 sec plied Bio-systems, Thermo Fisher Scientific, and 60 °C for 1 min (step and hold). All samples USA). The reaction was in the volume of 15-μl were analyzed by duplicate. RNU44 was used as containing 7.5-μl of RealQ Plus 2x Master Mix an internal control for miRNAs. Gene expression Syber Green High ROX™ (Ampliqon, Den- was calculated using the comparative threshold mark), 1-μl of cDNA, 5.5-μl of H2O and 1-μl of cycle (2-△△CT) method. Primer sequences of forward primer (3Pmol/μl concentration) and mir181a and mir30d and stem-loop sequences for reverse primer (3Pmol/μl concentration). Real- mir181a and mir30d have been shown in Table 3. time PCR amplifications were done as follows: Table 3: Primer Sequences for Amplification of mir181a-5p and mir30d-5p Target miRNA Sequences (5´ 3´) Mir181a-5p Forward 5´CACGCCAACATTCAACGCTG3´ Reverse 5´CCAGTGCAGGGTCCGAGGTA3´ Mir30d-5p Forward 5´CACGCAAGTAAACATCCCCGAC3´ Reverse 5´CCAGTGCAGGGTCCGAGGTA3 RNU44 Forward 5´CCTGGATGATGATAGCAAATG3 Reverse 5´TCGTATCCAGTGCAGGG3´ Statistical Analysis In terms of miR-181a expression, there is a sig- Statistical analysis was performed using the nificant difference between the expression levels GraphPad Prism v7.03 (GraphPad Software Inc. of mir181a in tumor samples in comparison with USA) and t-test. For all tests, P<0.05 was consid- normal samples. Twenty-one cases (70%) of the ered statistically Significant. tumor samples showed an increase in expression compared with normal samples, while 9 (30%) of Results tumor samples showed a decline in expression in comparison with normal samples (P=0.040) (Fig. Related results to the expression level of 1). miRNA181a Fig. 1: Graphs A and B are related to the expression level difference of mir181a in breast tumor samples compared to non-tumor adjacent samples Available at: http://ijph.tums.ac.ir 1597 Iran J Public Health, Vol. 51, No.7, Jul 2022, pp.1594-1601 Outcomes related to the expression level of tumor samples showed an increase in expression miRNA30d compared with normal samples, while 21 cases The expression level of miR-30d has shown a (70%) of tumor samples showed a decline in ex- significant difference between tumor samples in pression in comparison with normal samples comparison with normal samples. 9 (30%) of the (P=0.042) (Fig. 2). Fig. 2: Graphs A and B are related to the expression level difference of mir30d in breast tumor samples compared to non-tumor adjacent samples Discussion AKT pathway. This pathway plays a key role in cell cycle regulation, cell proliferation, cell surviv- About one in nine women, one person develops al, and cancer. Since the PTEN gene plays a key breast cancer over a lifetime. In Iran, breast can- role in the progression of this pathway, any irreg- cer with a 32% outbreak is the most common ularity in the pattern of expression of this gene cancer among women (19). About 6.6% of all can disrupt this pathway and thus lead the cell to breast cancers in women under 40 yr of age, become cancerous. 2.4% in women under 35, and 65.6% in women MicroRNAs are one of the post-transcriptional below 30 yr of age have been identified (20). regulators for gene expression and by considering Therefore, the identification of molecular path- the mentioned studies on PTEN expression, now ways and agents involved in these ways is im- we know that this gene as a tumor suppressor portant for better identification and treatment shows decreased expression pattern in breast (21). cancer. Therefore, it would be interesting to in- PTEN gene is one of the important key roles in vestigate the major causes of this decline in ex- Breast cancer that any changes in the mRNA ex- pression because by this, we can have more in- pression of this gene can promote Breast cancer. formation to find breast cancer related bi- Previous studies on the PTEN gene have agreed omarkers. to the reduced expression level of the PTEN Following microRNAs related to the PTEN gene in most cancers. The most important signal- gene, we assessed the expression status of miR- ing pathway for the PTEN gene is the PI3K- 181a and miR-30d. Multitudes of research have been carried out on micro-RNA 181a. The ex- 1598 Available at: http://ijph.tums.ac.ir Tavakolpournegari et al.: Expression Patterns of miR181a and miR30d in Patients … pression level of miR-181a was examined in pa- miR-181a occurred in the early stages of cancer, tients with gastric cancer by Real-Time PCR. In which shows the role of this microRNA as a fac- this study, the miR-181a expression level in tu- tor affecting the PI3K-AKT pathway. Since the mor samples was found to be higher than expres- increase in the expression level of miR-181a is sion in normal samples (22). The expression level meaningful in the prototypes that are in the early of miR-181a was investigated in tissue samples of stages of cancer, if further investigations and oth- patients with liver cancer using Real-Time PCR. er conditions are taken into account, this micro- In this study, the expression level of mir181a in RNA can be considered as an early diagnostic tumor samples showed an enhancement in ex- biomarker to detect breast cancer in the early pression level in comparison with normal sam- stages of cancer. ples (23). The miR-181a activity in cooperation Besides, the expression level of miR-30d was ex- with the PI3K-AKT pathway was also assessed in amined in this study. Wide range of studies have lung cancer (24). According to studies, performed investigated the miR-30d expression level in vari- on miR-181a and the results obtained from these ous cancers. The expression of miR-30d was ex- studies, miR-181a demonstrated upregulation and amined in a sample of intestinal cancer tissue us- downregulation in various cancers. In the PI3K- ing the Real Time-PCR technique, in which miR- AKT signaling pathway, PTEN acts as a negative 30 d was downregulated in the tumor samples in regulator and, by its phosphatase action, converts comparison with normal samples (25). The ex- the PIP3 generated by the PI3K activity to PIP2. pression level of miR-30d was investigated in 12 PTEN, by its phosphatase action, prevents the tumor samples and 12 adjacent normal tumor pathway of PI3K-AKT that confirms PTEN ac- tissues in patients with prostate cancer using Real tivity as a tumor suppressor gene. In such a case, Time-PCR, in which miR-30d showed a signifi- a change in the activity or pattern of PTEN gene cant increase in tumor samples compared with expression can have deleterious effects on im- normal ones (16). The expression pattern of miR- portant cellular processes. One of the most im- 30d was investigated in tissue samples of patients portant factors in PTEN's natural activity is the with intestinal cancer using Real Time-PCR, in uncontrolled activity of micro-RNAs as factors which miR-30d demonstrated a significant reduc- regulating gene expression in the post- tion in the expression level of tumor samples transcription phase. According to our results, compared to normal specimens (26). MiR-30d miR-181a has a significant increase in expression. had reduced and increased expression patterns in This enhancement in expression may affect the various types of cancers. One of the signaling PTEN gene expression by targeting its mRNA pathways associated with breast cancer is the that leads to cancer cell growth. In other words, PI3K-AKT signaling pathway. by increasing the activity of miR-181a, this mi- In this molecular pathway, after binding the lig- croRNA targets the PTEN gene transcript and and to a receptor and following the receptor acti- leads to downregulation of the PTEN gene. Since vation, the PI3K is activated and connected to this gene is known as a tumor suppressor gene, the receptor membrane protein and by its kinase therefore, this uncontrolled progression may activity, can result in the conversion of PIP2 to cause impairment in the pathway of PI3K-AKT PIP3. In which case, PIP3 causes the PDK to and, as a result, the progression of the cell to activate AKT by phosphorylating the threonine cancerous cell. The significant increase in miR- 308 region, thereby continuing the signaling 181a expression with P=0.04 can partly prove the pathway in which the AKT is activated and af- role of miR-181a in the disruption of the cell sig- fecting a wide range of proteins and other regula- naling pathway by targeting PTEN gene tran- tory factors and the molecular pathways in the scription. Since most specimens were in the early direction of the cell targets going ahead. Mean- stages of cancer (13% in stage 1 and 53.3% in while, one of the pathways resulting from AKT stage 2 cancers), the alteration in expression of activity is the activation of the CREB transcrip- Available at: http://ijph.tums.ac.ir 1599 Iran J Public Health, Vol. 51, No.7, Jul 2022, pp.1594-1601 tion factor. In fact, after AKT phosphorylation by PDK, AKT induces phosphorylation and acti- Acknowledgements vation of the CREB transcription factor, and CREB causes the transcription of different genes. We thank our colleagues from Islamic Azad Uni- One of the goals of CREB activation is the tran- versity of Medical Sciences branch and “The Iran scription of genes that contribute to cell prolifer- National Tumor Bank founded by Cancer Insti- ation and differentiation. In this case, any change tute of Tehran University of Medical Sciences, in the CREB activity causes uncontrolled expres- for Cancer Research”. That provided insight, ex- sion of genes that contribute to cell proliferation pertise, biological materials, and human samples. and differentiation, and one of the related results of this uncontrolled expression is cancer. Conflict of interest In the present study, miR-30d showed a signifi- cant reduction in expression in tumor samples The authors declare that there is no conflict of compared to normal ones. Since the miR-30d interest. expression declines, the regulatory process for the expression of the CREB gene can be im- References paired and it could be expressed more than usual. Since this reduction is significant in the speci- 1. Crivelli P, Ledda R, Parascandolo N, Fara A, So- mens that are in the early stages of cancer, so it ro A, Conti M (2018). A New Challenge for can be considered that if more research is done Radiologists: Radiomics in Breast Cancer. Bi- and other conditions are taken into account, this omed Res Int, 2018:6120703. micro-RNA can be detected as an early diagnos- 2. Dandawate PR, Subramaniam D, Jensen RA, tic biomarker to detect breast cancer in the early Anant S (2016). Targeting cancer stem cells stages of cancer. Finally, this study was designed and signaling pathways by phytochemicals: as a pilot study, and further investigations are re- Novel approach for breast cancer therapy. quired to confirm our findings. Semin Cancer Biol, 40-41: 192-208. 3. de la Mare JA, Contu L, Hunter MC, et al (2014). Breast cancer: current developments in mo- Conclusion lecular approaches to diagnosis and treatment. Recent Pat Anticancer Drug Discov, 9(2): 153-175. After evaluating the expression level of mir181a 4. Wu L, Yang X (2018). Targeting the Hippo and mir30d, significant upregulation in mir181a, Pathway for Breast Cancer Therapy. Cancers and significant downregulation in mir30d were (Basel), 10(11) : 422. seen. miR-181a might affect the transcription of 5. Keniry M, Parsons R (2008).. The role of PTEN the PTEN gene that results in the cell progress to signaling perturbations in cancer and in tar- cancer. In addition, the downregulation of miR- geted therapy. Oncogene, 27(41): 5477-5485. 30d may also lead to cancer cell growth, due to a 6. Leslie NR, Foti M (2011). Non-genomic loss of reduction in the affecting on the CREB gene PTEN function in cancer: not in my genes . Trends Pharmacol Sci, 32(3): 131-140. transcript 7. Wahid F, Shehzad A, Khan T, Kim YY (2010). MicroRNAs: synthesis, mechanism, function, Journalism Ethics considerations and recent clinical trials. Biochim Biophys Acta, 1803(11): 1231-1243. Ethical issues (Including plagiarism, informed 8. Wang F, Hou J, Jin W, et al (2014). Increased cir- consent, misconduct, data fabrication and/or fal- culating microRNA-155 as a potential bi- sification, double publication and/or submission, omarker for breast cancer screening: a meta- redundancy, etc.) have been completely observed analysis. Molecules, 19(5): 6282-6293. by the authors. 9. Cohen MS, Chen YQ, McCauley M, et al (2011). Prevention of HIV-1 infection with early an- 1600 Available at: http://ijph.tums.ac.ir Tavakolpournegari et al.: Expression Patterns of miR181a and miR30d in Patients … tiretroviral therapy. N Engl J Med, 365(6): 493- stem-loop RT-PCR. Nucleic Acids Res, 33(20): 505. e179. 10. Shenouda SK, Alahari SK (2009). MicroRNA 19. Ataollahi MR, Sharifi J, Paknahad MR, Paknahad function in cancer: oncogene or a tumor sup- A (2015). Breast cancer and associated fac- pressor?. Cancer Metastasis Rev, 28(3-4): 369- tors: a review. J Med Life, 8(Spec Iss 4):6-11. 378. 20. Assi HA, Khoury KE, Dbouk H, Khalil LE, 11. Huang Y, Shen XJ, Zou Q, Wang SP, Tang SM, Mouhieddine TH, El Saghir NS (2013). Epi- Zhang GZ (2011). Biological functions of demiology and prognosis of breast cancer in microRNAs: a review. J Physiol Biochem, 67(1): young women. J Thorac Dis, 5 Suppl 1(Suppl 129-139. 1):S2-8. 12. Bisso A, Faleschini M, Zampa F, et al (2013). 21. Nwabo Kamdje AH, Seke Etet PF, Vecchio L, Oncogenic miR-181a/b affect the DNA Muller JM, Krampera M, Lukong KE (2014). damage response in aggressive breast cancer. Signaling pathways in breast cancer: therapeu- Cell Cycle, 12(11): 1679-1687. tic targeting of the microenvironment. Cell 13. Maritz J, Benatar M, Dave JA, et al (2010). HIV Signal., 26(12): 2843-2856. neuropathy in South Africans: frequency, 22. Zhang X, Nie Y, Du Y, Cao J, Shen B, Li Y characteristics, and risk factors. Muscle Nerve, (2012). MicroRNA-181a promotes gastric 41(5): 599-606. cancer by negatively regulating tumor sup- 14. Hook MA, Moreno G, Woller S, et al (2009). pressor KLF6. Tumour Biol, 33(5): 1589-1597. Intrathecal morphine attenuates recovery of 23. Yang J, He Y, Zhai N, Ding S, Li J, Peng Z function after a spinal cord injury. (2018). MicroRNA-181a inhibits autophagy J Neurotrauma, 26(5): 741-752. by targeting Atg5 in hepatocellular carcinoma. 15. Do Canto LM, Marian C, Willey S, et al (2016). Front Biosci (Landmark Ed), 23(2): 388-396. MicroRNA analysis of breast ductal fluid in 24. Liu J, Xing Y, Rong L (2018). miR-181 regulates breast cancer patients. Int J Oncol, 48(5): 2071- cisplatin-resistant non-small cell lung cancer 2078. via downregulation of autophagy through the 16. Lin ZY, Chen G, Zhang YQ, et al (2017). Mi- PTEN/PI3K/AKT pathway. Oncol Rep, croRNA-30d promotes angiogenesis and tu- 39(4): 1631-1639. mor growth via MYPT1/c-JUN/VEGFA 25. Chen D, Guo W, Qiu Z, et al (2015). Mi- pathway and predicts aggressive outcome in croRNA-30d-5p inhibits tumour cell prolifer- prostate cancer. Mol Cancer, (1): 48. ation and motility by directly targeting 17. Chang S, Chen B, Wang X, Wu K, Sun Y (2017). CCNE2 in non-small cell lung cancer. Cancer Long non-coding RNA XIST regulates Lett, 362(2): 208-217. PTEN expression by sponging miR-181a and 26. Yan L, Qiu J, Yao J (2017). Downregulation of promotes hepatocellular carcinoma progres- microRNA-30d promotes cell proliferation sion. BMC Cancer, 17(1): 248. and invasion by targeting LRH-1 in colorectal 18. Chen C, Ridzon DA, Broomer AJ, et al (2005). carcinoma. Int J Mol Med, 39(6): 1371-1380. Real-time quantification of microRNAs by Available at: http://ijph.tums.ac.ir 1601