TYPE Original Research PUBLISHED 19 October 2022 DOI 10.3389/fvets.2022.1014475 Diversity of respiratory viruses OPEN ACCESS present in nasal swabs under influenza suspicion in EDITED BY Hua-Ji Qiu, Harbin Veterinary Research Institute (CAAS), China REVIEWED BY respiratory disease cases of Dipak Deka, Assam Agricultural University, India Shuai Li, weaned pigs Yangzhou University, China Montserrat Torremorell, University of Minnesota Twin Cities, Gerard E. Martín-Valls1*† , Yanli Li1† , Ivan Díaz2 , United States Anna Jackova, Esmeralda Cano2 , Silvana Sosa-Portugal1 and Enric Mateu1,2 University of Veterinary Medicine and 1 Department de Sanitat i Anatomia Animals, Faculty of Veterinària, Universitat Autònoma de Pharmacy in Košice, Slovakia Barcelona, Cerdanyola del Vallès, Spain, 2 IRTA, Programa de Sanitat Animal, Centre de Recerca en *CORRESPONDENCE Sanitat Animal (CReSA), Campus de la Universitat Autònoma de Barcelona (UAB), Barcelona, Spain Gerard E. Martín-Valls gerard.martin@uab.cat † Respiratory diseases in weaned pigs are a common problem, with a complex These authors have contributed equally to this work etiology involving both viruses and bacteria. In the present study, we SPECIALTY SECTION investigated the presence of eleven viruses in nasal swabs, collected from This article was submitted to nurseries (55 cases) under the suspicion of swine influenza A virus (swIAV) and Veterinary Infectious Diseases, submitted by swine veterinarians for diagnosis. The other ten viruses included a section of the journal Frontiers in Veterinary Science in the study were influenza B (IBV) and D (IDV), Porcine reproductive and RECEIVED 08 August 2022 respiratory syndrome virus (PRRSV), Porcine respiratory coronavirus (PRCV), ACCEPTED 29 September 2022 Porcine cytomegalovirus (PCMV), Porcine circovirus 2 (PCV2), 3 (PCV3) and PUBLISHED 19 October 2022 4 (PCV), Porcine parainfluenza 1 (PPIV1) and Swine orthopneumovirus (SOV). CITATION Twenty-six swIAV-positive cases and twenty-nine cases of swIAV-negative Martín-Valls GE, Li Y, Díaz I, Cano E, Sosa-Portugal S and Mateu E (2022) respiratory disease were primarily established. While IBV, IDV, PCV4 and PPIV1 Diversity of respiratory viruses present were not found in any of the cases, PRCV, SOV, and PCMV were more likely in nasal swabs under influenza suspicion in respiratory disease cases to be found in swIAV-positive nurseries with respiratory disease (p < 0.05). of weaned pigs. Overall, PCV3, PRRSV, and PCMV were the most frequently detected agents Front. Vet. Sci. 9:1014475. at herd level. Taken individually, virus prevalence was: swIAV, 48.6%; PRCV, doi: 10.3389/fvets.2022.1014475 48.0%; PRRSV, 31.6%; SOV, 33.8%; PCMV, 48.3%, PCV2, 36.0%; and PCV3, 33.0%. COPYRIGHT © 2022 Martín-Valls, Li, Díaz, Cano, Moreover, low Ct values (<30) were common for all agents, except PCV2 and Sosa-Portugal and Mateu. This is an PCV3. When the correlation between pathogens was individually examined, open-access article distributed under the presence of PRRSV was negatively correlated with swIAV and PRCV, while the terms of the Creative Commons Attribution License (CC BY). The use, was positively associated to PCMV (p < 0.05). Also, PRCV and SOV were distribution or reproduction in other positively correlated between them and negatively with PCMV. Besides, the forums is permitted, provided the original author(s) and the copyright analysis of suckling pig samples, collected in subclinically infected farrowing owner(s) are credited and that the units under an influenza monitoring program, showed that circulation of PRCV, original publication in this journal is PCMV, SOV, and PCV3 started during the early weeks of life. Interestingly, cited, in accordance with accepted academic practice. No use, distribution in those subclinically infected units, none of the pathogens was found to or reproduction is permitted which be correlated to any other. Overall, our data may contribute to a better does not comply with these terms. understanding of the complex etiology and epidemiology of respiratory Frontiers in Veterinary Science 01 frontiersin.org Martín-Valls et al. 10.3389/fvets.2022.1014475 diseases in weaners. This is the first report of SOV in Spain and shows, for the first time, the dynamics of this pathogen in swine farms. KEYWORDS respiratory viruses, pig nursery, influenza A, respiratory disease porcine respiratory disease complex, porcine reproductive and respiratory syndrome virus, swine orthopneumovirus, porcine cytomegalovirus Highlights 2 (PCV2) and porcine reproductive and respiratory syndrome virus (PRRSV), may impair or modify host defense mechanisms - Thirty-one virus combinations suggest a complex etiology against other agents (9–13). The immunosuppressive features of pig respiratory diseases. of porcine cytomegalovirus (PCMV) have not been fully proved, - First detection and dynamics description of SOV in Spanish although it is supposed to regulate the expression of different pig farms. cytokines (IL-1, IL-2, IL-12, TNF-α, and IL-10) (14, 15). - PRRSV is negatively correlated with swIAV and PRCV, Bacterial agents also participate in the respiratory disease of while positively with PCMV. weaners. Some, i.e., Mycoplasma hyopneumoniae, are capable of - SOV, PCMV, PRCV and PCV3 detection at early ages causing primary respiratory disease, while others may mainly suggests an important role of sows. act as opportunistic agents. The interactions leading to such complications are poorly understood, the available evidence are partial and sometimes contradictory (16–18). Introduction Nevertheless, a consensus view from the clinical and pathological picture points to the interaction of different agents Respiratory diseases are one of the most common problems with host genetic background and its immune status, under in weaned and growing pigs, with a complex etiology involving specific environmental circumstances [see Saade (19) for an both viral and bacterial agents (1–4). The most common excellent review]. clinical picture is characterized by cough, with or without fever In recent years, several viruses have been added to the and possibly nasal discharge, labored breathing, and increased list of potential porcine respiratory pathogens. Among them, mortality. Since several agents may produce similar lesions, the it is worth mentioning Influenza B (IBV) and D (IDV) (20– pathological picture has an indicative value, but does not allow 23), swine orthopneumovirus (SOV) (24), porcine parainfluenza precise diagnosis. In many nurseries, the outbreaks are recurrent 1 virus (PPIV1, also designated as porcine respirovirus) (25– batch after batch (5). 27), and porcine circovirus 3 (PCV3) (28). The knowledge Agents causing respiratory diseases are often categorized on the epidemiology of these viruses, their interactions and as primary and secondary/opportunistic pathogens. Primary participation in respiratory disease is limited, with only a few respiratory infectious agents are capable of subverting host reports available (29–33). The role of other recently discovered respiratory defense barriers and establish infections on their agents, such as PCV4 (34) is not known yet (35). own, while opportunistic agents take advantage of the damage The present study aimed to explore the frequency and caused by primary agents to establish the infections. Primary combinations of several respiratory viruses, including SOV, infections are often complicated by opportunistic agents, PPIV, PCV3 and PCV4, together with IBV and IDV, in nasal resulting in more serious respiratory disease outcomes. Some swabs collected from pigs in respiratory disease outbreaks. Swabs agents could act both as primary and opportunistic invaders, were submitted to the laboratory by swine veterinarians under depending on environmental conditions and the homeostasis suspicion of swIAV infection. of pigs. Viral pathogens are generally considered as primary agents of respiratory disease in nurseries. In the field, it is common to detect several respiratory viruses simultaneously Materials and methods circulating in nurseries, making difficult to ascertain the role of each one, or their interactions in a particular case. For some Cases and sample collection pathogens like swine influenza A virus (swIAV), a primary role can be assumed despite the variation of virulence among The study comprised 55 cases, corresponding to the strains (1, 6). For others, like porcine respiratory coronavirus number of respiratory disease outbreaks in nurseries (out (PRCV), their role in respiratory disorders is difficult to be of the 84 received for diagnosis between 2017 and 2019) established (7, 8). Additionally, agents, such as porcine circovirus from Spain and Portugal. Nasal swabs (n = 873) were Frontiers in Veterinary Science 02 frontiersin.org Martín-Valls et al. 10.3389/fvets.2022.1014475 submitted for diagnosis under suspicion of swIAV. Twenty- TABLE 1 List of primers and probes designed for the present study. nine cases were discarded when <10 animals were sampled Primer Sequence Ref. accession or did not fulfill any of the criteria: (1) Noticeable respiratory disease was reported in nurseries, (2) cough and fever Real time PCR were predominant signs in diseased animals, with mortality PPV-1 Fw ATTCGGGCAGAGATGTAACG MF681710 association above-usual in the farm, and (3) nasal swabs were PPV-1 Rv TATCCCACCCCTCGGTCTAT stored at 4◦ C and submitted to the laboratory (Laboratori PPV-1 Probe FAM-GCCCGATAAAATCCACAAAGA-BHQ1 Veterinari de Diagnosi en Malalties Infeccioses, UAB) in <24 h SOV Fw GGGGAGGACTTGATGCTGTA KX364383.1 after collection. SOV Rv AACTTTGCTGCCTCCTTTGA All cases were initially examined for swIAV presence SOV Probe FAM-CTGAAAGCTGAGAAGGCCAG-BHQ1 during a swIAV surveillance project carried out in Spanish PCMV Fw AATGCGTTTTACAACTTCACG KF017583.1 farms (36). The 55 examined cases comprised both swIAV- PCMV Rv CTGAGCATGTCCCGCCCTAT positive (N = 26), as well as swIAV-negative (N = 29). PCMV Probe FAM-CTCTAGCGGCGTCCATCACC-BHQ1 Nasal swab suspensions of each submission were pooled (3–4 PRCV Fw TCAGCCAATTTTGGTGACAG KY406735.1 samples/pool) for the initial analysis. Then, for each pathogen PRCV Rv GATCATCCTTTGGCAAGTGG present, 10 corresponding positive farms were randomly PRCV Probe FAM-ATGGGAGCAGTGCTAAGCAT-BHQ1 selected from positive cases, and animals were analyzed End-point PCR individually. Each farm was assigned a code for the purpose of PRCV Fw AAACACTACTTGTGGTTTTGGTTAT MF462726 anonymized identification. PRCV Rv ACAGTCACACCGAACGGAAT Additionally, since some other farms performed routine PCMV Fw TGACAGTGAGCAGTCGGAAT KX575707.1 monitoring of swIAV in farrowing crates and nurseries, we PCMV Rv TCAGGCGTGGATATGTAACG had the opportunity to test the circulation of respiratory SOV Fw CTATCGGAACCGAATGAGAC KX364383.1 viruses at different ages in 8 additional farms, where animals SOV Rv TGCCAGGAGCCATATTTG did not show overt respiratory disease. This sampling comprised 20 nasal swabs collected from farrowing units and 12 from nurseries. With those numbers, any agent could be detected if present in ≥15 or ≥25% of the animals in the farrowing units and nurseries, respectively, (95% and IDV, and PCV2, PCV3, and PCV4 were detected using confidence). These samples were initially examined by pooling previously described primers (37–42). For PPV1, PCMV, PRCV, (2–3 samples/pool). and SOV, the primers were specifically designed (see Table 1). All PCRs were performed using 5 µl of the extracted nucleic acids, except for PRRSV, where 7 µl was used, as instructed by LSI VetMax PRRS EU/NA v2 (Life Technologies). The Swab processing, nucleic acid extraction primer specificity was evaluated by SANGER sequencing of the and RT-PCR amplified products of samples positive by conventional RT-PCR (see primers in Table 1). In each round of PCR, positive (samples Each nasal swab tip (Sigma-Virocult) was submerged into containing the target virus as confirmed by sequencing) and 1 ml viral transport medium immediately after collection. Upon negative controls (PBS) were included. reception, swabs were resuspended in the transport medium, To evaluate farm prevalence with more precision, individual tubes were vortexed, and three aliquots were stored at −80◦ C samples from 10 cases positive for each pathogen were also until needed. Before nucleic acid extraction, thawed aliquots analyzed by RT-PCR. were centrifuged at 8,000 g during 5 min at 4◦ C to collect supernatants for RNA/DNA extraction (MagMax Core nucleic acid extraction kit, ThermoFisher Scientific). All analyses were carried out with the same RNA batch (a single extraction Statistical analysis per sample). Exogenous internal positive control (IPC) from PRRSV LSI Vetmax PRRS EU/NA kit (Life technologies) was A farm was considered infected by a given virus if at used to validate extraction proficiency. Samples known to be least one sample was positive for that virus. Thus, for each swIAV-positive were also included as positive control for nucleic virus, its presence or absence in the farm was coded as acid extraction. 1/0 or Yes/No depending on the purpose of the analysis. The presence of different viruses was examined by either The associations between pathogens at a farm level were real-time PCR or real-time RT-PCR using AgPath-ID One- initially tested using a tetrachoric correlation matrix (tetrachoric Step RT-PCR Reagents (ThermoFisher Scientific). SwIAV, IBV function in R). Frontiers in Veterinary Science 03 frontiersin.org Martín-Valls et al. 10.3389/fvets.2022.1014475 FIGURE 1 Frequency of detection of the different viruses in the studied cases, based on the swIAV status of the nursery. n.s, not significative. An Exploratory Factor Analysis was then performed Results to identify the underlying relationships between different viruses (packages RcmdrMisc and psych in R). The Kaiser- Prevalence and association of respiratory Meyer-Olkin (KMO) test was performed to determine viruses PRRSV, PRCV, SoV, PCV2, PCV3, sampling adequacy and the Bartlett’s test to determine and PCMV in swIAV-positive and sphericity. Eigenvalues were used to determine the -negative nurseries number of factors to extract (eigenvalues ≥ 1.0). Factor loadings were calculated to identify whether a variable The final sampling comprised 55 respiratory disease cases, was not loaded sufficiently onto any given factor (loading 26 of which in swIAV-positive nurseries. Overall, PCV3 was the < 0.40). most frequently detected agent, present in 43/55 cases (78.2%; The final step was to elaborate regression models, CI95% : 66.6–87.8%). PRRSV and PCMV were found in 40/55 where one virus (presence or absence) was considered cases (72.7%; CI95% : 58.8–83.5%), PRCV in 29/55 cases (52.7%; the respondent variable and the others as independent CI95% : 39.3–66.1%), PCV2 in 18/55 cases (32.7%; CI95% : 21.1– factors (lm function in R). When two or more variables 46.8%), and SOV in 17/55 cases (30.9%; CI95% : 19.5–45.0). IBV, were found to be correlated in the correlation analysis, the IDV, PCV4, and PPIV1 were not detected in any case. To note, interactions between variables were included in the formula. this is the first description of SOV occurrence in pig herds in The Breusch-Pagan test was used to test the heteroscedasticity, Spain and the second in Europe. whereby regression was weighted. The variance inflation Figure 1 shows the proportion of cases in which each factor was calculated to determine how much collinearity pathogen (PRRSV, PRCV, SOV, PCV2, PCV3, PCMV) was found existed in the model. The same scheme of data analysis was based on swIAV status of the farm. Interestingly, the frequency applied to the examination of the database composed of of a given pathogen detected in swIAV-positive cases (on a herd individual results. level) varied from that in swIAV-negative cases. PRCV, SOV, Individual results from 10 outbreaks were used to determine and PCMV were more likely to be found in swIAV-positive the prevalence of these viruses in respiratory outbreaks. In nurseries (69.2 vs. 37.9% for PRCV; 46.2 vs. 19.2% for SOV this case, the average and distribution of Ct-values were also and 88.5 vs. 58.6% for PCMV, p < 0.05). Among 55 farms, compared using Kruskal-Wallis test. All analyses were done in 31 virus combination patterns were displayed (Table 2). In one RStudio 2021.09.2 + 382 “Ghost Orchid” Release for Windows. respiratory outbreak, none of the examined viruses was detected. Frontiers in Veterinary Science 04 frontiersin.org Martín-Valls et al. 10.3389/fvets.2022.1014475 TABLE 2 Distribution of the 55 examined farms according to the combination of respiratory viruses found in the nurseries. swIAV PRRSV PRCV SOV PCV2 PCV3 PCVM N◦ farms - - - - - - - 1 - - - - - - + 1 - - - - - + - 3 - - - - + + - 1 - + - - - - - 2 - + - - - + - 3 - + - - - - + 2 - + - + - - + 1 - + - - - + + 1 - + - - + - + 1 - + - - + + + 2 - + + - - + - 1 - + + - + + - 1 - + + - - + + 2 - + + + - + + 3 - + + - + + + 2 + - - + - + + 1 + - - - + + + 1 + - + - - + + 3 + - + + + + + 2 + + - - - - - 1 + + - - - + - 2 + + - - + + - 1 + + - - - + + 2 + + - - + + + 1 + + + + - - + 1 + + + - - + + 3 + + + + - + + 3 + + + + + - + 1 + + + - + + + 1 + + + + + + + 4 None of the farms were positive for IBV, IDV, PCV4 or PPIV1. Next, a tetrachoric correlation matrix was calculated to Prevalence and association of pathogens determine associations between different pathogens at a farm on an individual level level. The results showed that the swIAV-positive status was positively correlated with the presence of PRCV, SOV, To have further insight on the prevalence of each pathogen, and PCMV (p < 0.05) (Table 3). The presence of PRCV we then performed the analysis at the individual level. Ten was correlated with PCV3 (p < 0.05) SOV, and PCMV (p batches (one batch of each farm) of infected nurseries for each < 0.001). pathogen were selected. As a result, a diversity of Cts (from The exploratory factor analysis with two factors explained 15–16 up to 30s) could be found for most of the examined 40.2% of the total variance. Factor 1 included all viruses but viruses, while it was very uncommon to obtain Ct values of PCV3 and Factor 2 included swIAV, SOV, PCV2, and PCV3. PCV2 and PCV3 below 30 (Figure 2; Supplementary material 2). Detailed results are shown in Supplementary material 1. On average, the individual prevalence for the different The regression analysis at the farm level showed a significant viruses were as follows: swIAV 48.6%; PRCV 48.0%; PRRSV model only for PRCV. The presence of PRCV in the farm was 31.6%; SOV 33.8%; PCMV 48.3%, PCV2 36.0%; and PCV3 significantly (p < 0.05) related to the presence of SOV, PCV3, 33.0% (Supplementary material 3). The presence of PCMV was and probably PCMV (p = 0.051) (statistics shown in Table 4A). negatively correlated with SOV and PRCV (p < 0.05) (Table 4B). Frontiers in Veterinary Science 05 frontiersin.org Martín-Valls et al. 10.3389/fvets.2022.1014475 TABLE 3 Tetrachoric correlation coefficients. swIAV PRRSV PRCV SOV PCV2 PCV3 PCMV Farm level swIAV 1.00 PRRSV −0.07 1.00 PRCV 0.50* 0.22 1.00 SOV 0.52* 0.15 0.75*** 1.00 PCV2 0.25 0.05 0.25 0.24 1.00 PCV3 0.41 −0.14 0.57* 0.05 0.32 1.00 PCMV 0.52* 0.19 0.75*** 0.75** 0.36 0.14 1.00 Individual level swIAV 1.00 PRRSV −0.59* 1.00 PRCV 0.14 −0.63* 1.00 SOV 0.31 −0.29 0.71*** 1.00 PCV2 0.40 −0.05 0.13 0.69** 1.00 PCV3 −0.27 0.04 −0.30 −0.31 −0.12 1.00 PCMV −0.32 0.52† −0.82*** −0.84 −0.28 0.44 1.00 The table shows the results of the tetrachoric correlation matrices for the presence or absence of each virus at farm level (upper) or in individuals (lower). † p = 0.06; *p < 0.05; **p < 0.01; ***p < 0.001. The correlation between different pathogens at the weaners had been sampled for influenza monitoring purposes individual level was analyzed as well. As shown in Table 3, were analyzed. In this part, only SOV, PCV3, PCMV, and PRCV PRCV infection was negatively correlated with PRRSV and were included because viral circulation of swIAV, PRRSV, and PCMV and positively associated with SOV (p < 0.05). PCMV PCV2 may start in maternities. Analysis of nasal swabs indicated was positively correlated with PRRSV (p < 0.05) and negatively that PCMV spreads mainly in nurseries, since the frequency correlated with SOV and PRCV (p < 0.05); SOV was positively of positive pools in 7/8 farms reached 100% in that phase correlated with PCV2 (p < 0.05). Apart from these, swIAV and (Figure 3). In contrast, for SOV, PCV3, and PRCV, the infection PRRSV were negatively related (p < 0.05). was mostly found in suckling pigs, suggesting the role of sows Next, the exploratory factorial analysis with in transmitting the infection. Interestingly in these subclinically 3 factors explained in total 55% of the variance infected farms, the tetrachoric correlation (Table 5) shows no (Supplementary material 1). Factor 1 comprised all variables significant correlation between examined viruses. but PCV3 (explaining 28% of the variance, loadings between −0.55 and 0.78). Factor 2 explained 15% of the variance and was composed of swIAV, PRCV, SOV, and PCMV (loadings between Discussion −0.64 and 0.62). Factor 3 explained 12% of the variance and The polymicrobial nature of the porcine respiratory disease was composed of PRCV and PCMV (loadings were −0.64 and complex is a well-established and widely accepted concept. 0.44, respectively). Nevertheless, the participation, contribution and interaction The regression models for individual samples showed a between different agents is not so well understood. One of negative correlation (p < 0.05) between PRCV and PRRSV. the main obstacles is to establish experimental models that Presence of SOV in a sample was positively correlated with can reflect the agent complexity in a herd and the events presence of PCV2 and negatively correlated with the presence taking place under farm conditions. Along with molecular of PCMV. technique advances, the number of viruses known to potentially participate in the respiratory disease in pigs has increased, with the discovery of IBV, IDV, PPIV1, SOV, PCV3, and PCV4 (20, Profiling of respiratory viruses in 21, 23, 24, 27, 28, 43). New high-throughput methods such next subclinically infected farms generation sequencing, combined with novel detection methods as Fluidigm or Swinostics will increase the list of viruses that To examine whether the infection by different viruses started can be studied and improve the knowledge of their role in from the maternal stage, 8 farms where suckling pigs and swine infectious diseases (44–46). However, the current cost of Frontiers in Veterinary Science 06 frontiersin.org Martín-Valls et al. 10.3389/fvets.2022.1014475 TABLE 4 Regression models. The tables show the significant regression models at a farm level (A) or individual level (B). A. Farm level Formula = PRCV ∼ swIAV + PRRSV + PRRSV * swIAV + SOV + PCMV + PCV3 + PCV2 + PRCV*PCMV * SOV + PRCV * PCV3 Estimate Std. Error t-value Pr (>|t|) Intercept −0.276 0.198 −1.424 0.1612 PCMV 0.297 0.148 2.005 0.0509 SOV 0.358 0.138 2.592 0.0128 PCV3 0.342 0.144 2.369 0.0221 Multiple R-squared 0.432 F-statistic 5.005 Adjusted R-squared 0.346 p-value <0.001 Residual standard error 0.301 B. Individual results Formula = PRCV ∼ swIAV + PRRSV + PRRSV * swIAV + SOV + PCMV + PCV3 + PCV2 + PCMV * SOV + PCVM * PRRSV + SOV * PCV2 Estimate Std. Error t-value Pr (>|t|) Intercept 0.531 0.280 1.932 0.059 PRRSV −0.888 0.440 −2.016 0.049 Multiple R2 0.466 F-statistic 4.912 Adjusted R2 0.491 p-value <0.001 Residual standard error 0.382 Formula = SOV ∼ swIAV + PRRSV + PRRSV * swIAV + PCMV + PCV3 + PCV2 + PCMV * PRCV + PRCV * PRRSV Estimate Std. Error t-value Pr (>|t|) Intercept 0.658 0.164 3.990 <0.001 PCMV −0.520 0.141 −3.679 <0.001 PCV2 0.474 0.167 2.829 0.006 Multiple R2 0.534 F-statistic 7.543 Adjusted R2 0.464 p-value <0.001 Residual standard error 0.369 Formula = PCMV ∼ swIAV + PRRSV + PRRSV * swIAV + SOV + PCV3 + PCV2 + SOV * PRCV + PRCV * PRRSV Estimate Std. Error t-value Pr (>|t|) Intercept 0.857 0.120 7.127 p < 0.001 PRCV −0.332 0.124 −2.676 0.010 SOV −0.454 0.122 −3.711 p < 0.001 Multiple R2 0.551 F-statistic 9.596 Adjusted R2 0.493 p-value <0.001 Residual standard error 0.350 these instruments and techniques difficult their use in large scale for analysis. Nasal swabs are the main sampling methods in studies. Real-time RT-PCR is sensitive enough and cost-effective. the present study. Although nasal swabs are optimal for those In the present study, we examined the presence of a panel viruses (i.e., swIAV, PRCV or PCMV) replicating in the nasal of 11 viruses in outbreaks of respiratory disease in nurseries. epithelium or higher airways, their use may underestimate The cases included in this work had been initially submitted other pathogens, such as PRRSV, whose replication in nasal for swIAV diagnosis due to clinical signs of affected animals mucosa may depend on viral virulence (47). This bias must be (cough and fever and increased mortality). Certainly, this would considered as well and, probably, favor the detection of more create a selection bias toward more severe cases of respiratory virulent isolates. disease in nurseries. To compensate it, a comparable number The analysis of pooled nasal swabs showed that IBV, IDV, of swIAV-positive and swIAV-negative outbreaks were balanced PPIV1, and PCV4 were not present in any of the outbreaks Frontiers in Veterinary Science 07 frontiersin.org Martín-Valls et al. 10.3389/fvets.2022.1014475 FIGURE 2 The figure shows the distribution of Ct values in 10 nurseries infected by each detected virus. To simplify the graphs, values for negative animals were shown as Ct = 0. The letter in the X-axis indicates the farm code. Detailed values of prevalence, confidence intervals and average Cts are shown in Supplementary material 1. IAV, influenza A virus; PRCV, porcine respiratory coronavirus; PRRSV, porcine reproductive and respiratory syndrome virus; SOV, swine orthopneumovirus; PCMV, porcine cytomegalovirus; PCV2, porcine circovirus 2; PCV3, porcine circovirus 3. analyzed, suggesting a low circulation, if not complete absence, Also, SOV and PRCV seemed to be positively related. of these pathogens in pig herds in Spain. Our results agree with Both agents were negatively correlated with PCMV, while SOV a previous report (48). was positively related to PCV2. The fact that both PCMV Among 55 farms, up to 31 virus combinations were and PCV2 are known immunosuppressive agents (56, 57), displayed, and interestingly, the presence of PRCV, SOV plus the ability of PRCV and other orthopneumoviruses or PCMV was more frequently detected in swIAV positive for inducing interferon responses (58, 59), suggest a role nurseries. The cause for such association is unclear, it might of complex interactions of those viruses with the immune reflect a poorer biosecurity in some farms, or the result system. The confirmation of these associations would of a confounding variable. The limited information available require either a different epidemiological study or, if for those samples submitted for diagnosis makes virtually possible, an experimental co-infection trial. To the best of impossible to further investigate it. our knowledge, no experimental infection with SOV has At the individual level, the presence of swIAV in nasal swabs been reported. was negatively correlated with PRRSV shedding. In vitro, co- Another interesting point to discuss is the different infection of susceptible epithelial CD163+ cells with PRRSV distribution of Ct values between most pathogens and PCV2 and swIAV interfered the replication of each other (49), while and PCV3 (Figure 2). While for swIAV, PRRSV, SOV, PCMV, in pigs, some level of interference could also be observed nasal swabs in a farm most commonly contained either higher when PRRSV infection preceded swIAV inoculation (50). The or lower viral loads (as deduced from Ct values), most animals presence of PRRSV was found to be positively correlated with yielded Ct values above 30 for PCV2 and PCV3. This suggests PCMV. In a previous study carried out in Chinese farms that shedding of PCV2 and PCV3 was relatively low. In the (51), PCMV positive animals were always found to be PRRSV- case of PCV2, this is reasonable because animals probably positive. Upregulation of IL-10 and downregulation of TNF- had high levels of maternally derived antibodies and were α and IL-8 by PCMV in porcine macrophages could be a vaccinated at weaning. But for PCV3, the result is more difficult reason for the interaction with PRRSV, but confirmation would to explain. Zhai et al. (60) found a higher prevalence of require experimental efforts (15). Both PRRSV and PCMV were PCV3 in weaners with severe respiratory disease indicating negatively correlated with PRCV and SOV. This observation that Cts 20–27 were common in diseased animals, while Cts is consistent with the known induction of type I interferon above 30 were found mostly in animals with less severe by PRCV (52) and the susceptibility of cytomegaloviruses to respiratory disease or asymptomatic. This could be the case of interferons (53–55). the present study. Frontiers in Veterinary Science 08 frontiersin.org Martín-Valls et al. 10.3389/fvets.2022.1014475 FIGURE 3 Proportion of positive pools for SOV, PCV3, PCMV and PRCV in suckling pigs and weaners among 8 monitored farms. The numbers within the bars indicate the average Ct value of the positive samples. PRCV, porcine respiratory coronavirus; SOV, swine orthopneumovirus; PCMV, porcine cytomegalovirus; PCV3, porcine circovirus 3. Frontiers in Veterinary Science 09 frontiersin.org Martín-Valls et al. 10.3389/fvets.2022.1014475 TABLE 5 Tetrachoric correlation matrix for results of nasal swabs consent for participation was not obtained from the owners collected in asymptomatic infected farms. because the data used in the present paper comes from routine PRCV SOV PCV3 PCMV diagnostic of pig farms. Also, the data in the present work is used anonymously. Subclinical infection PRCV 1.00 SOV 0.11 1.00 Author contributions PCV3 0.08 0.39 1.00 PCMV 0.01 −0.07 0.09 1.00 GM-V, YL, and EM participated in the design of the study. GM-V, YL, SS-P, ID, and EC performed The table shows the results of the tetrachoric correlation matrices for the presence or the sample processing and analysis. EM performed absence of each virus at farm with subclinical infection. All correlation values were non-significant (p > 0.05). the statistical analysis. All authors contributed in the writing process. Since for some farms we had samples from both suckling piglets and nurseries, we examined the presence of four Funding of the tested viruses (SOV, PCV3, PRCV and PCMV) in both compartments within the same farm. The results This work was partially funded by CEVA Santé Animale revealed that all these agents started to circulate in the (swIAV analysis). farrowing units, in a pattern already observed in other diseases. For example, transmission of swIAV in endemic Acknowledgments farms has been well documented to start as early as the first week of age (61, 62). Interestingly, no correlation between SS-P was supported by an FIP fellowship of Universitat the pathogens examined could be found when animals did Autònoma de Barcelona thanks to funding of CEVA Santé not show evident signs of respiratory disease, indicating Animale. Our grateful thanks to Gwenaelle Dauphin, Kathrin that serious respiratory disease is caused largely by co- Lillie-Jaschinski, and Stefan Pesch for the critical reading of infections. the manuscript. In summary, the present study shows the complexity of the interaction between viruses present in nasal swabs of diseased, or subclinically infected animals, suggesting the existence of Conflict of interest interactions among them that deserve further study. Moreover, we report the presence of SOV in Spain for the first time. The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Data availability statement The raw data supporting the conclusions of this article will Publisher’s note be made available by the authors, without undue reservation. All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated Ethics statement organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or Ethical review and approval was not required for the animal claim that may be made by its manufacturer, is not guaranteed study because the authors confirm that the ethical policies of or endorsed by the publisher. the journal, as noted on the journal’s author guidelines page have been adhered to. Samples used in this work were submitted by field veterinarians for diagnostic purposes on the basis Supplementary material of clinical testing. Therefore, according to Directive 63/2010 -Article 1, point 5(b) non-experimental clinical veterinary The Supplementary Material for this article can be practices- the procedure carried out to obtain data is not found online at: https://www.frontiersin.org/articles/10.3389/ within the scope of the named directive. Written informed fvets.2022.1014475/full#supplementary-material Frontiers in Veterinary Science 10 frontiersin.org Martín-Valls et al. 10.3389/fvets.2022.1014475 References 1. Gillespie TG. Diagnosing endemic swine influenza virus in nursery 21. Hause BM, Ducatez M, Collin EA, Ran Z, Liu R, Sheng Z, et al. pigs using crossectional serologic profiling. Swine Health Product. (1999) Isolation of a novel swine influenza virus from Oklahoma in 2011 which is 7:81–3. distantly related to human influenza C viruses. PLoS Pathog. (2013) 9:e1003176. doi: 10.1371/journal.ppat.1003176 2. Haimi-Hakala M, Hälli O, Laurila T, Raunio-Saarnisto M, Nokireki T, Laine T, et al. Etiology of acute respiratory disease in fattening pigs in Finland. Porc Health 22. Ran Z, Shen H, Lang Y, Kolb EA, Turan N, Zhu L, et al. Domestic pigs Manag. (2017) 3:19. doi: 10.1186/s40813-017-0065-2 are susceptible to infection with influenza B viruses. J Virol. (2015) 89:4818–26. doi: 10.1128/JVI.00059-15 3. Qin S, Ruan W, Yue H, Tang C, Zhou K, Zhang B. Viral communities associated with porcine respiratory disease complex in intensive 23. Tsai C-P, Tsai H-J. Influenza B viruses in pigs, Taiwan. Influenza Other Respi commercial farms in Sichuan province, China. Sci Rep. (2018) 8:13341. Viruses. (2019) 13:91–105. doi: 10.1111/irv.12588 doi: 10.1038/s41598-018-31554-8 24. Hause BM, Padmanabhan A, Pedersen K, Gidlewski T. Feral swine 4. Ruggeri J, Salogni C, Giovannini S, Vitale N, Boniotti MB, Corradi A, et al. virome is dominated by single-stranded DNA viruses and contains a novel Association between infectious agents and lesions in post-weaned piglets and orthopneumovirus which circulates both in feral and domestic swine. J Gen Virol. fattening heavy pigs with porcine respiratory disease complex (PRDC). Front Vet (2016) 97:2090–5. doi: 10.1099/jgv.0.000554 Sci. (2020) 7:636. doi: 10.3389/fvets.2020.00636 25. Dénes L, Cságola A, Schönhardt K, Halas M, Solymosi N, Balka G. First 5. Toya R, Sasaki Y, Uemura R, Sueyoshi M. Indications and patterns of report of porcine parainfluenza virus 1 (species Porcine respirovirus 1) in Europe. antimicrobial use in pig farms in the southern Kyushu, Japan: large amounts of Transbound Emerg Dis. (2021) 68:1731–5. doi: 10.1111/tbed.13869 tetracyclines used to treat respiratory disease in post-weaning and fattening pigs. J Vet Med Sci. (2021) 83:322–8. doi: 10.1292/jvms.20-0436 26. Ku J, Wo A, Cybulski P, Denes L, Balka G, Stadejek T. Detection of porcine respirovirus 1 (PRV1) in Poland: incidence of co-infections with influenza A virus 6. Torremorell M, Juarez A, Chavez E, Yescas J, Doporto JM, Gramer M. (IAV) and porcine reproductive and respiratory syndrome virus (PRRSV) in herds Procedures to eliminate H3N2 swine influenza virus from a pig herd. Vet Record. with a respiratory disease. Viruses. (2022) 14:148. doi: 10.3390/v14010148 (2009) 165:74–7. doi: 10.1136/vetrec.165.3.74 27. Lau SKP, Woo PCY, Wu Y, Wong AYP, Wong BHL, Lau CCY, 7. O’Toole D, Brown I, Bridges A, Cartwright SF. Pathogenicity of experimental et al. Identification and characterization of a novel paramyxovirus, porcine infection with ‘pneumotropic’ porcine coronavirus. Res Vet Sci. (1989) 47:23–9. parainfluenza virus 1, from deceased pigs. J Gen Virol. (2013) 94:2184–90. doi: 10.1016/S0034-5288(18)31226-8 doi: 10.1099/vir.0.052985-0 8. Lanza I, Brown IH, Paton DJ. Pathogenicity of concurrent infection of pigs 28. Chen S, Zhang L, Li X, Niu G, Ren L. Recent progress on epidemiology with porcine respiratory coronavirus and swine influenza virus. Res Vet Sci. (1992) and pathobiology of porcine circovirus 3. Viruses. (2021) 13:1944. 53:309–14. doi: 10.1016/0034-5288(92)90131-K doi: 10.3390/v13101944 9. Segalés J, Domingo M, Chianini F, Majó N, Domínguez J, Darwich L, et al. 29. Richard C-A, Hervet C, Ménard D, Gutsche I, Normand V, Renois F, et al. Immunosuppression in postweaning multisystemic wasting syndrome affected First demonstration of the circulation of a pneumovirus in French pigs by detection pigs. Vet Microbiol. (2004) 98:151–8. doi: 10.1016/j.vetmic.2003.10.007 of anti-swine orthopneumovirus nucleoprotein antibodies. Vet Res. (2018) 49:118. 10. Meng X-J. Porcine circovirus type 2 (PCV2): pathogenesis and doi: 10.1186/s13567-018-0615-x interaction with the immune system. Ann Rev Anim Biosci. (2013) 1:43–64. 30. Park JY, Welch MW, Harmon KM, Zhang J, Piñeyro PE, Li G, et al. Detection, doi: 10.1146/annurev-animal-031412-103720 isolation, and in vitro characterization of porcine parainfluenza virus type 1 11. Bordet E, Blanc F, Tiret M, Crisci E, Bouguyon E, Renson P, et al. Porcine isolated from respiratory diagnostic specimens in swine. Vet Microbiol. (2019) reproductive and respiratory syndrome virus type 13 lena triggers conventional 228:219–25. doi: 10.1016/j.vetmic.2018.12.002 dendritic cells 1 activation and t helper 1 immune response without infecting 31. Gaudino M, Moreno A, Snoeck CJ, Zohari S, Saegerman C, O’Donovan T, dendritic cells. Front Immunol. (2018) 9:2299. doi: 10.3389/fimmu.2018.02299 et al. Emerging Influenza D virus infection in European livestock as determined in 12. Nedumpun T, Techakriengkrai N, Thanawongnuwech R, Suradhat S. serology studies: are we underestimating its spread over the continent? Transbound Negative Immunomodulatory Effects of Type 2 Porcine Reproductive and Emerg Dis. (2021) 68:1125–35. doi: 10.1111/tbed.13812 Respiratory syndrome virus-induced interleukin-1 receptor antagonist on 32. Sanogo IN, Kouakou C, Batawui K, Djegui F, Byarugaba DK, Adjin R, et al. porcine innate and adaptive immune functions. Front Immunol. (2019) 10:579. Serological surveillance of influenza D virus in ruminants and swine in West and doi: 10.3389/fimmu.2019.00579 East Africa, 2017-2020. Viruses. (2021) 13:1749. doi: 10.3390/v13091749 13. Li Y, Mateu E. Interaction of type 1 porcine reproductive and respiratory 33. Schuele L, Lizarazo-Forero E, Cassidy H, Strutzberg-Minder K, Boehmer J, syndrome virus with in vitro derived conventional dendritic cells. Front Immunol. Schuetze S, et al. First detection of porcine respirovirus 1 in Germany and the (2021) 12:674185. doi: 10.3389/fimmu.2021.674185 Netherlands. Transbound Emerg Dis. (2021) 68:3120–5. doi: 10.1111/tbed.14100 14. Liu X, Xu Z, Zhu L, Liao S, Guo W. Transcriptome analysis of porcine 34. Zhang H, Hu W, Li J, Liu T, Zhou J, Opriessnig T, et al. Novel thymus following porcine cytomegalovirus infection. PLoS ONE. (2014) 9:e113921. circovirus species identified in farmed pigs designated as porcine circovirus doi: 10.1371/journal.pone.0113921 4, Hunan province, China. Transbound Emerg Dis. (2020) 67:1057–61. 15. Kavanová L, Moutelíková R, Prodělalová J, Faldyna M, Toman M, doi: 10.1111/tbed.13446 Salát J. Monocyte derived macrophages as an appropriate model for porcine 35. Rakibuzzaman A, Ramamoorthy S. Comparative immunopathogenesis and cytomegalovirus immunobiology studies. Vet Immunol Immunopathol. (2018) biology of recently discovered porcine circoviruses. Transbound Emerg Dis. (2021) 197:58–62. doi: 10.1016/j.vetimm.2018.01.008 68:2957–68. doi: 10.1111/tbed.14244 16. Opriessnig T, Giménez-Lirola LG, Halbur PG. Polymicrobial 36. Sosa Portugal S, Cortey M, Tello M, Casanovas C, Mesonero-Escuredo S, respiratory disease in pigs. Anim Health Res Rev. (2011) 12:133–48. Barrabés S, et al. Diversity of influenza A viruses retrieved from respiratory disease doi: 10.1017/S1466252311000120 outbreaks and subclinically infected herds in Spain (2017–2019). Transbound 17. Lin X, Huang C, Shi J, Wang R, Sun X, Liu X, et al. Investigation of Emerg Dis. (2021) 68:519–30. doi: 10.1111/tbed.13709 pathogenesis of H1N1 influenza virus and swine streptococcus suis serotype 37. Schweiger B, Zadow I, Heckler R, Timm H, Pauli G. Application 2 co-infection in pigs by microarray analysis. PLoS ONE. (2015) 10:e0124086. of a fluorogenic PCR assay for typing and subtyping of influenza doi: 10.1371/journal.pone.0124086 viruses in respiratory samples. J Clin Microbiol. (2000) 38:1552–8. 18. Obradovic MR, Segura M, Segalés J, Gottschalk M. Review of the speculative doi: 10.1128/JCM.38.4.1552-1558.2000 role of co-infections in Streptococcus suis-associated diseases in pigs. Vet Res. 38. Olvera A, Sibila M, Calsamiglia M, Segalés J, Domingo M. Comparison (2021) 52:49. doi: 10.1186/s13567-021-00918-w of porcine circovirus type 2 load in serum quantified by a real time PCR 19. Saade G, Deblanc C, Bougon J, Marois-Créhan C, Fablet C, Auray G, et al. in postweaning multisystemic wasting syndrome and porcine dermatitis and Coinfections and their molecular consequences in the porcine respiratory tract. nephropathy syndrome naturally affected pigs. J Virol Methods. (2004) 117:75–80. Vet Res. (2020) 51:80. doi: 10.1186/s13567-020-00807-8 doi: 10.1016/j.jviromet.2003.12.007 20. Ducatez MF, Pelletier C, Meyer G. Influenza D virus in cattle, France, 39. Busquets N, Segalés J, Córdoba L, Mussá T, Crisci E, Martín-Valls GE, et al. 2011-2014. Emerg Infect Dis. (2015) 21:368–71. doi: 10.3201/eid2102.141449 Experimental infection with H1N1 European swine influenza virus protects pigs Frontiers in Veterinary Science 11 frontiersin.org Martín-Valls et al. 10.3389/fvets.2022.1014475 from an infection with the 2009 pandemic H1N1 human influenza virus. Vet Res. viruses. Vet Microbiol. (2014) 169:18–32. doi: 10.1016/j.vetmic.2013. (2010) 41:74. doi: 10.1051/vetres/2010046 11.037 40. Faccini S, de Mattia A, Chiapponi C, Barbieri I, Boniotti MB, Rosignoli 51. Liu X, Liao S, Zhu L, Xu Z, Zhou Y. Molecular epidemiology of porcine C, et al. Development and evaluation of a new Real-Time RT-PCR assay for cytomegalovirus (PCMV) in Sichuan Province, China: 2010-2012. PLoS ONE. detection of proposed influenza D virus. J Virol Methods. (2017) 243:31–4. (2013) 8:e0064648. doi: 10.1371/journal.pone.0064648 doi: 10.1016/j.jviromet.2017.01.019 52. van Reeth K, Labarque G, Nauwynck H, Pensaert M. Differential production 41. Franzo G, Legnardi M, Centelleghe C, Tucciarone CM, Cecchinato M, of proinflammatory cytokines in the pig lung during different respiratory Cortey M, et al. Development and validation of direct PCR and quantitative virus infections: correlations with pathogenicity. Res Vet Sci. (1999) 67:47–52. PCR assays for the rapid, sensitive, and economical detection of porcine doi: 10.1053/rvsc.1998.0277 circovirus 3. J Vet Diagn Invest. (2018) 30:538–44. doi: 10.1177/104063871 53. Buddaert W, van Reeth K, Pensaert M. In vivo and in vitro interferon (IFN) 8770495 studies with the porcine reproductive and respiratory syndrome virus (PRRSV). 42. Sun W, Du Q, Han Z, Bi J, Lan T, Wang W, et al. Detection and genetic Adv Exp Med Biol. (1998) 440:461–7. doi: 10.1007/978-1-4615-5331-1_59 characterization of porcine circovirus 4 (PCV4) in Guangxi, China. Gene. (2021) 54. Lee S-M, Schommer SK, Kleiboeker SB. Porcine reproductive and respiratory 773:145384. doi: 10.1016/j.gene.2020.145384 syndrome virus field isolates differ in in vitro interferon phenotypes. Vet Immunol 43. Hou C-Y, Zhang L-H, Zhang Y-H, Cui J-T, Zhao L, Zheng L-L, et al. Immunopathol. (2004) 102:217–31. doi: 10.1016/j.vetimm.2004.09.009 Phylogenetic analysis of porcine circovirus 4 in Henan Province of China: a 55. Holzki JK, Dag F, Dekhtiarenko I, Rand U, Casalegno-Garduño R, Trittel retrospective study from 2011 to 2021. Transbound Emerg Dis. (2021) 69:1890–901. S, et al. Type I interferon released by myeloid dendritic cells reversibly impairs doi: 10.1111/tbed.14172 cytomegalovirus replication by inhibiting immediate early gene expression. J Virol. 44. Cortey M, Díaz I, Vidal A, Martín-Valls G, Franzo G, Gómez de Nova (2015) 89:9886–95. doi: 10.1128/JVI.01459-15 PJ, et al. High levels of unreported intraspecific diversity among RNA viruses 56. Darwich L, Mateu E. Immunology of porcine circovirus type 2 (PCV2). Virus in faeces of neonatal piglets with diarrhoea. BMC Vet Res. (2019) 15:441. Res. (2012) 164:61–7. doi: 10.1016/j.virusres.2011.12.003 doi: 10.1186/s12917-019-2204-2 57. Dix RD, Mocarski E, Rowland-Jones S, Raj A, Patro K. Subversion of 45. Goecke NB, Hjulsager CK, Krog JS, Skovgaard K, Larsen LE. Development Immune Response by Human Cytomegalovirus. Front Immunol. (2019) 1:1155. of a high-throughput real-time PCR system for detection of enzootic doi: 10.3389/fimmu.2019.01155 pathogens in pigs. J Vet Diagn Invest. (2020) 32:51–64. doi: 10.1177/104063871 9890863 58. Russell CD, Unger SA, Walton M, Schwarze J. The human immune response to respiratory syncytial virus infection. Clin Microbiol Rev. (2017) 30:481–502. 46. Montagnese C, Barattini P, Giusti A, Balka G, Bruno U, Bossis I, et al. A doi: 10.1128/CMR.00090-16 diagnostic device for in-situ detection of swine viral diseases: the swinostics project. Sensors. (2019) 19:407. doi: 10.3390/s19020407 59. Saif LJ, Jung K. Comparative pathogenesis of bovine and porcine respiratory coronaviruses in the animal host species and SARS-CoV-2 in humans. J Clin 47. Frydas IS, Nauwynck HJ. Replication characteristics of eight virulent and Microbiol. (2020) 58:e01355-20. doi: 10.1128/JCM.01355-20 two attenuated genotype 1 and 2 porcine reproductive and respiratory syndrome virus (PRRSV) strains in nasal mucosa explants. Vet Microbiol. (2016) 182:156–62. 60. Zhai S-L, Zhou X, Zhang H, Hause BM, Lin T, Liu R, et al. Comparative doi: 10.1016/j.vetmic.2015.11.016 epidemiology of porcine circovirus type 3 in pigs with different clinical presentations. Virol J. (2017) 14:222. doi: 10.1186/s12985-017-0892-4 48. Franzo G, Ruiz A, Grassi L, Sibila M, Drigo M, Segalés J. Lack of porcine circovirus 4 Genome Detection in Pig Samples from Italy and Spain. Pathogens. 61. Bhatta TR, Ryt-Hansen P, Nielsen JP, Larsen LE, Larsen I, Chamings A, et al. (2020) 9:433. doi: 10.3390/pathogens9060433 Infection dynamics of swine influenza virus in a danish pig herd reveals recurrent 49. Provost C, Hamonic G, Gagnon CA, Meurens F. Dual infections of CD163 infections with different variants of the H1N2 swine influenza A virus subtype. expressing NPTr epithelial cells with influenza A virus and PRRSV. Vet Microbiol. Viruses. (2020) 12:1013. doi: 10.3390/v12091013 (2017) 207:143–8. doi: 10.1016/j.vetmic.2017.06.012 62. Garrido-Mantilla J, Sanhueza J, Alvarez J, Culhane MR, Davies 50. Dobrescu I, Levast B, Lai K, Delgado-Ortega M, Walker S, P, Allerson MW, et al. Impact of nurse sows on influenza A virus Banman S, et al. In vitro and ex vivo analyses of co-infections with transmission in pigs under field conditions. Prev Vet Med. (2021) 188:105257. swine influenza and porcine reproductive and respiratory syndrome doi: 10.1016/j.prevetmed.2021.105257 Frontiers in Veterinary Science 12 frontiersin.org