TYPE Original Research PUBLISHED 21 October 2022 DOI 10.3389/fphys.2022.1021927 Rainbow trout integrated OPEN ACCESS response after recovery from EDITED BY Abdallah Tageldein Mansour, King Faisal University, Saudi Arabia short-term acute hypoxia REVIEWED BY Marina Paolucci, Irene García-Meilán 1,2*, Lluis Tort 2 and Ali Reza Khansari 2 University of Sannio, Italy 1 Alexander Rebl, Departament de Biologia Cel·lular, Facultat de Biologia, Universitat de Barcelona, Barcelona, Spain, 2 Research Institute for Farm Animal Department of Cell Biology, Physiology and Immunology, Faculty of Biosciences, Universitat Biology (FBN), Germany Autònoma de Barcelona, Bellaterra, Spain *CORRESPONDENCE Irene García-Meilán, irene.garcia@ub.edu SPECIALTY SECTION Overcoming a stress situation, such as hypoxia episodes, which involve an This article was submitted to Aquatic allostatic load, will depend on the ability of fish to modulate physiological and Physiology, biochemical systems to maintain homeostasis. The aim of the study was to a section of the journal Frontiers in Physiology determine the integrated stress response after acute hypoxia of the rainbow RECEIVED 17 August 2022 trout considering the different elements and areas of the stress response: ACCEPTED 20 September 2022 systemic and mucosal, local and global, and from the systemic PUBLISHED 21 October 2022 hypothalamic–pituitary–interrenal axis to skin mucosa. For this purpose, CITATION trout were subjected to acute hypoxia (dissolved O2 down to 2 mg/L) for 1 h García-Meilán I, Tort L and Khansari AR (2022), Rainbow trout integrated and then recovered and sampled at 1, 6, and 24 h after reoxygenation. response after recovery from short- Physiological responses were significantly affected by hypoxic stress and term acute hypoxia. their interaction with time after the challenge, being significant for plasma Front. Physiol. 13:1021927. doi: 10.3389/fphys.2022.1021927 lactate and cortisol levels, in both plasma and skin mucus. At the central brain level, only trh expression was modulated 1 h after hypoxia which indicates that COPYRIGHT © 2022 García-Meilán, Tort and brain function is not heavily affected by this particular stress. Unlike the brain, Khansari. This is an open-access article the head kidney and skin were more affected by hypoxia and reoxygenation. In distributed under the terms of the Creative Commons Attribution License the head kidney, an upregulation in the expression of most of the genes studied (CC BY). The use, distribution or (gr, il1β, il6, tgfβ1, lysozyme, caspase 3, enolase, hif-1, myoglobin, sod2, gpx, gst, reproduction in other forums is and gsr) took place 6 h after recovery, whereas only hsp70 and il10 were permitted, provided the original author(s) and the copyright owner(s) are upregulated after 1 h. On the contrary, in the skin, most of the analyzed credited and that the original genes showed a higher upregulation during 1 h after stress suggesting that, publication in this journal is cited, in accordance with accepted academic in the skin, a local response took place as soon as the stressor was detected, practice. No use, distribution or thus indicating the importance of the skin in the building of a stress response, reproduction is permitted which does whereas the interrenal tissue participated in a later time point to help prevent not comply with these terms. further alteration at the central level. The present results also show that, even though the stressor is a physical/environmental stressor, all components of the biological systems participate in the regulation of the response process and the recovery process, including neuroendocrine, metabolism, and immunity. KEYWORDS hypoxia, stress response, cortisol, gene transcript expression, brain, head kidney, skin, rainbow trout Frontiers in Physiology 01 frontiersin.org García-Meilán et al. 10.3389/fphys.2022.1021927 Introduction stress reactions, such as cortisol, glucose, or immune peptides. In addition, it has been demonstrated that one of these main Overcoming a stress situation, such as hypoxia episodes, will mediators of the stress response, cortisol, shows a consistent depend on the ability of fish to modulate physiological and correlation in its concentration between plasma and mucus biochemical systems, such as changes in energetics and (Declerq et al., 2016; Guardiola et al., 2016; De Mercado et al., metabolism, cardio-respiratory rhythms, and other 2018; Fernández-Alacid et al., 2018; Carbajal et al., 2019). adjustments including behavior (Ton et al., 2003; Dawood Our hypothesis in this work is that acute stress due to et al., 2021) to maintain homeostasis. hypoxia not only affects oxygen distribution systems and When stress is perceived, it triggers the induces metabolic adjustments but also involves effects on the hypothalamic–sympathetic–chromaffin (HSC) axis that activates immune, energetics, and antioxidant systems, and for this reason, a quick response involving adrenaline release to modulate the we have chosen not only the current physiological and metabolic cardio-respiratory system and providing glucose as an energy indicators but also representative genes of immune, endocrine, source (Eiden 2013; Kvetnansky et al., 2013), and later, the and neural systems in key organs such as the brain, HK, and skin. hypothalamic–pituitary–interrenal (HPI) axis plays a central role Consequently, the objective of this work was to determine the in acclimation to stress by cortisol release (Mommsen et al., 1999; integrated stress response after acute hypoxia of rainbow trout Gorissen and Flik, 2016). Moreover, an integrative response that considering the different elements and areas of the stress involves all regulatory systems (neural, endocrine, and immune) is response: systemic and mucosal, local, and global, with the activated. In this sense, some mediators, such as stress hormones or aim of characterizing the different components of this specific inflammatory cytokines, become key interaction molecules integrated response, from the systemic HPI axis to skin of bidirectional immunoendocrine regulation (Engelsma et al., 2002; mucosa. In this sense, hematological and physiological Tort, 2011). indicators, including hematocrit, plasma glucose and lactate, While the lack of oxygen rarely occurs in terrestrial animals, and plasma and skin mucus cortisol, were determined in in the aquatic environment, oxygen can become a limiting factor. rainbow trout, together with the transcript-level pattern of Hypoxia, the condition where dissolved oxygen drops from the specific genes related with stress and hypoxia. normoxic 8 mg O2/L to low levels such as 2.8 mg O2/L (Diaz and Rosenberg, 1995), has been often observed. Hypoxic episodes may occur due to different reasons, such as eutrophication Materials and methods caused by excessive input of nutrients or temperature increase, which may become more common due to global Experimental design and sampling warming in natural environments. Although some fish groups have evolved to survive in environments with low or variable The juveniles of rainbow trout were distributed randomly levels of dissolved oxygen, these fluctuations can lead to in duplicate tanks of 300 L per condition (4 tanks) and temporary hypoxia, becoming an abiotic stressor for fish. acclimatized to the facilities of the AQUAB-lab group Thus, different responses after hypoxia stress have been found (Universitat Autònoma de Barcelona, UAB). The fish were in fish, like suppressive effects on the immune system and fed ad libitum with a commercial diet (Skretting) and expression of the stress-immune- and hypoxia-related genes subjected to a photoperiod of 12L:12D and 18°C in a closed (Welker et al., 2007; Tiedke et al., 2014; He et al., 2019; Mu recirculation system. After the acclimatization period, the et al., 2020; Wang Q. et al., 2021; Schäfer et al., 2021; Hung et al., trout, with a final body weight of 80.8 ± 3.5 g, were 2022), negative effects on growth (Li et al., 2017), feed utilization subjected to a stress challenge by acute hypoxia for 1 h and (Sheng et al., 2019), respiration, and osmoregulation (Sun J.-L. then were allowed to recover to the normal rearing condition. et al., 2020), among others. As mentioned previously, hypoxia There were two experimental groups by duplicate: fish under stress induces the activation of the HPI axis, and it has been normoxia (norm) and fish sampled after a hypoxia challenge shown that after hypoxic situations several immune indicators and reoxygenation at different times: 1, 6, and 24 h post- both from humoral and cellular responses are implicated (Welker hypoxia. To carry it out, air pumps were removed from water, et al., 2007). Moreover, when fish are subjected to hypoxia, not and N2 was injected in the system by bubbling, reducing only central organs such as the brain and head kidney (HK) are oxygen levels in water from 8 mg/L to 2 mg/L. The oxygen concerned, but the skin may also play an important role, as it is a levels of the water were continuously monitored during the key surface for sensory environmental perception including experiment using an oximeter (Thermo Scientific, Madrid). hypoxia, among other functions such as communication, After the challenge, eight fish for each treatment (4 fish/tank) respiration, osmoregulation, and locomotion (Sanahuja and and time were euthanized with an overdose of Ibarz, 2015). It should be also noted that this non-keratinized phenoxyethanol, measured, weighed, and samples of blood, multi-layered integument produces skin mucus, a matrix that skin, and mucus were quickly collected, and the brain, HK, includes relevant molecules that play a role as mediators of the and skin were excised. All animal-handling procedures carried Frontiers in Physiology 02 frontiersin.org García-Meilán et al. 10.3389/fphys.2022.1021927 out in this study complied with the Guidelines of the European following the manufacturer’s instructions, using first oligo Union Council directive (EU 2010/63) and were approved by (dT) 15 and random hexamers. the Ethics and Animal Care Committee of the Universitat Autònoma de Barcelona (permit numbers OH4218_4219 and DAAM 11251), following the regulations and procedures Real-time quantitative PCR established by the Spanish and Catalan governments. Transcript levels were analyzed using real-time quantitative PCR (RT-qPCR) in a CFX Touch Real-Time ™ Hematocrit, biochemical, and hormonal PCR Detection System (Bio-Rad, United States). In the brain, analyses HK, and skin, genes related to inflammation and innate responses (il6, il10, il1β, tgfβ1, lysozyme, and caspase3), Blood samples were collected by puncturing the caudal vein antioxidant genes (sod2, cat, gpx, gsr, and gst), stress- using a heparinized syringe, and an aliquot was directly used to related genes (hsp70, crh, trh, and gr), and genes related to determine the hematocrit. After that, the plasma was isolated by hypoxia (hif-1, enolase, and myoglobin) were determined centrifugation (1500 x g, 15 min, 4°C) and stored at −20°C until using βactin and 18S as reference genes. Briefly, specific the analysis. Plasma glucose and lactate concentrations were primers used are listed in table 1. Primers were designed measured with commercial kits (LO-POD glucose and LO- using Primer-Blast. The primer secondary structure and POD lactate, Spinreact, Spain), whose protocols have been annealing specificity were checked using OligoAnalyzer standardized and adapted to microplate dimensions. All tests software (version 3.1) and Primer-Blast software, were carried out in duplicate and were expressed according to the respectively. The undesirable PCR product appearance was commercial standards used. previously verified by a single peak in the melting curve for Skin mucus was sampled according to Xu et al. (2013). each primer set. The primer amplification efficiency was Briefly, skin mucus was collected by gently scraping the fish determined in all tissues included in our study. Real-time skin into a 15-ml Falcon tube and homogenized using a syringe PCR reactions were performed with iTaq Universal SYBR (by taking and blowing out the whole content several times). Green supermix (Bio-Rad Laboratories) using 1:20 cDNA Samples were first centrifuged for 10 min at 1,500 rpm, and the dilution made for genes of interest. Primers for all genes were supernatant was transferred to an Eppendorf tube that was used at a final concentration of 500 nM. The thermal centrifuged again for 10 min 10,000 g at 4°C, and then the conditions used were 3 min at 95 °C of pre-incubation samples were stored at −20°C until further analysis. Skin followed by 40 cycles at 95 °C for 30 s and 60 °C for 30 s. tissue samples (upper-lateral line area behind the dorsal fin, All the reactions were performed in duplicate using left side, and roughly of the same size) were carefully taken to CFX384 Touch Real-Time PCR Detection System (Bio- avoid muscle contamination. The brain and HK were also Rad Laboratories). The efficiency of the amplicon and the sampled and immediately frozen in liquid nitrogen and stored size of the product are presented in Table 1. Quantification at −80°C for further assays. was performed according to the BIORAD formula using 18S Plasma and skin mucus cortisol levels were analyzed by and βactin as reference genes and efficiency of each primer radioimmunoassay (RIA) as previously described by Rotllant set obtained for each tissue. Values for the experimental et al. (2006). Briefly, samples of diluted denatured plasma or skin condition were expressed as normalized relative expression mucus were used, and cortisol was detected using a 1:4,500 final against those of the housekeeping genes 18s and βactin. dilution of antibody purchased from MO Bio-medical LLC (United States). Statistical analysis RNA extraction and cDNA synthesis Statistical Package for Social Science (SPSS, v25) software was used for the analysis. The generalized linear model (GzLM) was The total RNA was isolated from about 100 mg of tissue utilized considering the hypoxia and time dynamics as a two (brain, HK, and skin) in 1 ml of TRI Reagent solution® (Sigma between-subjects factor. This model is more a flexible statistical Aldrich, United States) following the manufacturer’s tool than the standard general linear model (GLM) in terms of instructions. The concentration and purity of RNA were types of distribution and different covariance structures of the determined at 260 nm with an A260/A280 purity ratio using a repeated measures, and does not require homogeneity of NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific variance, and it admits missing values. After the main Inc. United States). The cDNA of each sample was synthesized analysis, appropriate pair-wise comparisons were carried out. from 2 μg of RNA using the High-Capacity cDNA Reverse Differences in all data were considered statistically significant if Transcription Kit (Applied Biosystems, United States) p-values < 0.05 among groups. Frontiers in Physiology 03 frontiersin.org García-Meilán et al. 10.3389/fphys.2022.1021927 TABLE 1 Primers used for transcript-level analysis in rainbow trout. Gene Official name Accession number Sequence 59-39 Efficiency Product length 18S Ribosomal protein S18 XR_005034822.1 FW:TGAGCAATAACAGGTCTGTG 1.96 212 RV:GGGCAGGGACTTAATCAA B-actin Beta actin XM_036972332.1 FW:GGACTTTGAGCAGGAGATGG 1.95 186 RV:ATGATGGAGTTGTAGGTGGTCT Caspase 3 Caspase 3 XM_021561577.2 FW:GAGATGGCCTCCAAGAAGATAGAA 1.96 91 RV:ACCGCATGTACGCATCATCA Cat Catalase XM_021568213.2 FW:GCAGTGCCTTTTTGGGTTAGT 1.82 175 RV:ACCAAACCACAACTCTTCAGTG Crh Corticotrophin-releasing hormone NM_001124286.1 FW:AAGTTGGGAACATCAGCCG 1.89 127 RV:ATCTGTCGGAGCATGTGGAAC Enolase Enolase XM_036988980.1 FW:CAAAGGTGTCTCAAAAGCCG 2.00 73 RV:GTTGACGTTCTGCCGTACAA Gpx Glutathione peroxidase XM_021569971.2 FW:ATTCCCCTCCGATGACTCCA 1.94 155 RV:TGGTCAGGAACCTTCTGCTG Gr Glucocorticoid receptor NM_001124730.1 FW:GCTGCTTTCCTTTCCTCCCT 1.99 149 RV:GAGACACCAGCCTCCAGAAG Gsr Glutathione reductase XM_021561547.2 FW:CGATTGCTTCCACCCTCTTAC 1.89 196 RV:AGCCGACATTGACACAGGTA Gst Glutathione-S-transferase XM_021561454.2 FW:TATTGTGGGCTAATGTGTAAGAT 1.95 215 RV:CCCTGAAGAGCTTTGTCG hif-1a Hypoxia-inducible factor 1 alpha NM_001124288.1 FW:TTCTCTGTGCTCTTCTGTGCG 1.96 161 RV:TGAGTAAGGAAGCAGGGCAA hsp70 Heat shock protein 70 NM_001124228.1 FW:ATTCTGAACGTAGCAGCGGT 1.99 158 RV:GCCATCTTCTCCCTCTGTGC il1β Interleukin 1 beta XM_036979104.1 FW:CTGAAGCCAGACCTGTAGCC 2.01 100 RV:GCAACCTCCTCTAGGTGCAG il6 Interleukin 6 NM_001124657.1 FW:GAGTTTCAGAAGCCCGTGGA 2.09 149 RV:AGCTGGTACACTTGCAGACC il10 Interleukin10 NM_00124599.1 FW:CGACTTTAAATCTCCCATCGAC 1.89 70 RV:GCATTGGACGATCTCTTTCTT Lys Lysozyme XM_021601582.2 FW:TGCCTGTCAAAATGGGAGTC 1.99 152 RV:CAGCGGATACCACAGACGTT Myoglobin Myoglobin NM_001171862.1 FW:AACAAACACGGAGGACTGGTT 1.97 85 RV:CGATGCCTGCGAACTTAGGG sod2 Superoxide dismutase XM_021612540.2 FW:TCCCTGACCTGACCTACGAC 1.90 201 RV:GGCCTCCTCCATTAAACCTC tgfβ1 Transforming-growth factor beta 1 XM_036961610.1 FW:GGGCGACAGCAGACGATACC 1.97 102 RV:GGCCTCCTCCATTAAACCTC Trh Thyroid-releasing hormone XM_021566749.2 FW:CTGCTCCGCTCCATTCTCAA 2.08 142 RV:TCCCAGGGTGTTGCCTTTTT Results suffering acute stress by hypoxia (Figure 1A). Both glucose and lactate levels increased versus control 1 h after hypoxia (+67.4% Physiological responses were significantly affected by and +51.8%, respectively), being significant for the latter and hypoxic stress, and their interaction with time after the showing recovery 6 h after the stressful challenge (Figure 1B). In challenge was significant for plasma lactate and cortisol levels, addition, a significant increase was observed 1 h after stress in in both plasma and skin mucus (Figure 1). In this sense, rainbow plasma and skin mucus cortisol (+207.5% and +786.3%, trout showed a slight increase in hematocrit 1 and 6 h after respectively). Both parameters showed a similar decrease over Frontiers in Physiology 04 frontiersin.org García-Meilán et al. 10.3389/fphys.2022.1021927 FIGURE 1 (A) Hematocrit, (B) plasma glucose (white bars) and lactate (black bars), and (C) plasma cortisol (white bars) and skin mucus cortisol (black bars) in rainbow trout after normoxia and after acute hypoxia with different recovery times (1 h, 6 h, and 24 h). The values are presented as mean +SEM (n = 8). Significant differences between time points after hypoxia are shown by letters; between hypoxia-treated and normoxia are shown by * (p < 0.05) or ** (p < 0.001). time, reaching values like those of the control group 6 h after transcript expression patterns were similar in HK and skin, stress (Figure 1C). rising significantly 1 and 6 h after recovery when compared to Relative stress-related genes in the brain, HK, and skin of the control fish and recovering at 24 h. Despite this, rainbow trout under normoxia and recovery are shown in differences between tissues were detected. Thus, in the HK, Figure 2. At the brain level, no effect on hsp70, crh, or gr the highest expression levels were reached 6 h after recovery, transcript expression was found by treatment, time, or its whereas in the skin, changes were found 1 h after acute interaction, and their expression was low. Instead, trh hypoxia. As for hsp70, myoglobin transcript expression in transcript expression significantly increased in the brain the skin was very high 1 h after hypoxia, although the 1 h after hypoxia and was downregulated at 24 h compared values quickly recovered (Figure 3C). with that in control fish (Figure 2B). However, a clear effect of Also, several immune-related genes were analyzed (Figure 4). acute hypoxia and reoxygenation was detected on the In the brain, acute hypoxia did not significantly alter the expression of hsp70 transcripts in HK and skin showing an expression of pro-inflammatory or anti-inflammatory upregulation in HK 1h and 6 h after acute stress (Figure 2A). cytokines when compared to the normoxia condition (Figures Meanwhile, in the peripheral tissue, significant differences 4A–D). Despite this, il10 transcript expression in the brain was due to treatment were found at 1 and 6 h after hypoxia, affected by hypoxia showing a reduction compared to the control exhibiting 7.4 and 5.1 times higher relative transcript group at 24 h post-stress (Figure 4C). Concerning innate levels than trout under normoxia, to end up recovering immune key genes, significant changes were found for similar values to control at 24 h (Figure 2A). lysozyme, but no effect was detected in caspase 3 expression Corticotrophin-releasing hormone expression (crh) was not (Figures 4E, F). In HK, most genes were affected by acute hypoxia detected in HK, but in the skin, it showed a tendency to stress, except for il10 and caspase3. On the contrary, in the skin, increase at 1h and 6 h after hypoxia compared to that in no effect of hypoxia was detected, but the recovery time and its control fish (Figure 2C). Glucocorticoid receptor (gr) showed interaction with treatment were significant. In this sense, both a similar expression pattern in both the brain and HK over il1β transcript expression and il10 transcript expression rose 1 h time after hypoxia, but significant changes were only found in after the challenge, recovering basal values for il10 at 24 h, the later 6 h after acute hypoxia. Moreover, high levels of gr whereas il1β still remained high in HK (Figures 4A, C). transcript expression were detected in the skin, with 5.8 and However, for il6 in both tissues and tgfβ1in HK, changes were 7.1 times higher at 1h and 6 h post-stress versus control fish, found 6 h after recovery, the expression of the former being only showing recovery at 24 h (Figure 2D). significant in the skin, whereas tgfβ1 was significantly Hypoxia-related genes including enolase, hif-1, and upregulated 1 h after hypoxia (Figures 4B, D). Moreover, the myoglobin were also evaluated after the hypoxic treatment expression profiles of lysozyme and caspase3 in HK were the in the brain, HK, and skin (Figures 3A–C). In this sense, no same, showing the highest expression 6 h after hypoxia (Figures clear effects after acute hypoxia or during the recovery period 4E, F). In the skin, an upregulation of lysozyme expression was were found in the brain, except for myoglobin transcript found 1 h after hypoxia, whereas no effects were found for expression that was negatively affected by hypoxia. On the caspase 3. contrary, a clear effect of acute hypoxia treatment was No effects on antioxidant transcript expression were detected in HK and skin for these three genes. Enolase found in the brain (Figure 5). Contrary to the brain, in the Frontiers in Physiology 05 frontiersin.org García-Meilán et al. 10.3389/fphys.2022.1021927 FIGURE 2 Transcript levels of (A) hsp70, (B) trh, (C) crh, and (D) gr in rainbow trout brain, head kidney, and skin after normoxia and acute hypoxia with different recovery times (1, 6, and 24 h) (nd: no detected). The values are presented as mean +SEM (n = 8). Significant differences between time points after hypoxia are shown by letters; between hypoxia treated and normoxia are shown by * (p < 0.05) or ** (p < 0.001). HK, a clear effect of hypoxia treatment and time (6 h after Discussion recovery) was found in most of the genes studied compared to the fish under normoxia. Thus, sod2, gpx, gst, and gsr The present work intended to determine what are the transcript expression increased 1 h after the hypoxic responses of rainbow trout under the experimental challenge and kept upregulated even more than 6 h after circumstance of an acute decrease of dissolved oxygen in the recovery and recovered in similar levels to the control fish water (down to 2 mg/L), followed by a recovery period of 1, 6, at 24 h (Figures 5A,C–E). In the skin, a clear effect of acute and 24 h. This type of transient episodes may take place in case of hypoxia, time, and its interaction was detected for sod2, cat, a sudden power supply or failure of RAS aeration systems or in and gpx. Sod2 that constitutes the first line of defense against nature due to episodes that can occur more frequently due to oxidative stress upregulated its expression 1 h after hypoxia global warming. Other than previous works associated with air and slowly decreased over time, showing slight differences exposure, the present results want to determine the response with control rainbow trout after 24 h (Figure 5A). On the once the fish has experienced water hypoxia and their alarm other hand, cat and gpx, antioxidants of the second line of systems have been activated and put in place the mechanisms of defense, showed a peak of expression at 1 h after acute hypoxia recovery. Moreover, this work assessed gene transcript levels and recovered 6 h post-stress (Figures 5B, C). associated to neuroendocrine and immune systems, oxidative Frontiers in Physiology 06 frontiersin.org García-Meilán et al. 10.3389/fphys.2022.1021927 which is noteworthy in response to biotic and abiotic environmental stressors. Dissolved oxygen (DO) is a key environmental element for fish, since water has low capacitance and diffusion constant (Richards, 2009). Thus, the reduction in DO involves adaptation of physiological mechanisms to compensate for the lower water extraction and distribution, or fish must reduce their energetic expenditure to match oxygen availability (Abdel- Tawwab et al., 2019; Yoann et al., 2019). A hypoxic environment thus becomes a significant stressor, so fish trigger stress responses, with the adrenergic responses, increase in respiration rates, and gill ventilation being the first reaction (Hou et al., 2020; Bergstedt et al., 2021). Nevertheless, some fish may use other strategies associated to behavior such as remaining quiet to decrease their metabolic rate or moving upward to the water surface and using transient air breathing (Chapman and McKenzie, 2009; Bowyer et al., 2014; Obirikorang et al., 2020). In the present study, rainbow trout, a hypoxia- sensitive species, would combine both strategies during the hour that were kept in hypoxia at 2 mg O2/L, as also suggested by other authors that exposed trout to DO in water below normoxic levels (7 mg/L) (Abdel-Tawwab et al., 2019; Hou et al., 2020). After hypoxia, the non-specific stress response was induced, the HPI axis was activated, and cortisol was released showing significantly higher levels of plasma cortisol 1 h after hypoxia and returning to basal levels after 6 h recovery, which is in agreement with a similar response found in other species (Weendelar-Bonga, 1997; Abdel-Tawwab et al., 2019; Pinedo-Gil et al., 2019). This hormone is considered a highly sensitive signal of stressed fish since the difference between basal and stressed levels is very high (Mommsen et al., 1999; Ellis et al., 2012). A previous work of our team showed that rainbow trout needed longer time to recover basal cortisol levels when the stressor was 1 min of air exposure (Khansari et al., 2019), suggesting that the stressor was stronger for trout, indicating that the type of stressor is a very important factor to consider. Also, plasma glucose and lactate were increased at 1 h sampling time, showing a positive correlation with cortisol and recovering basal values 6 h after hypoxia. Similar results were observed in triploid rainbow trout by Han et al. (2022), in turbot (Jia et al., 2021), and in rainbow trout exposed to acute stress hypoxia (4 mg O2/L) and crowding within 10 min (Pinedo-Gil et al., 2019). The absence of time effect on glycemic levels after hypoxia could be due to the fact that the FIGURE 3 Transcript levels of (A) enolase, (B) hyf-1, and (C) myoglobin stressor was not intense enough to induce sufficient in rainbow trout brain, head kidney, and skin after normoxia and gluconeogenesis and glycogenolytic action, or to the fact that after acute hypoxia with different recovery times (1, 6, and 24 h). The values are presented as mean +SEM (n = 8). Significant one of the mediators of such response, catecholamines, shows a differences between time points after hypoxia are shown by very quick response (Weendelar-Bonga, 1997), which did not letters; between hypoxia-treated and normoxia are shown by * help to detect significant changes at the sampling time assessed. (p < 0.05) or ** (p < 0.001). The increase in plasma lactate indicates the switch from aerobic to anaerobic metabolism, leading to an accumulation of lactate stress, and metabolism in order to provide a wider overview of and protons (Wang and Richards, 2011). This generates an the recovery process. It should be mentioned that the present oxygen deficit; since during the recovery period, oxygen is study also intends to emphasize the response and the role of skin needed for the oxidation of anaerobic metabolites and energy Frontiers in Physiology 07 frontiersin.org García-Meilán et al. 10.3389/fphys.2022.1021927 FIGURE 4 Transcript levels of pro-inflammatory (A) il1β, (B) il6, anti-inflammatory (C) il10 and (D) tgfβ1, and innate immune response genes (E) lysozyme and (F) caspase 3 in rainbow trout brain, head kidney, and skin after normoxia and after acute hypoxia with different recovery times (1, 6, and 24 h). The values are presented as mean +SEM (n = 8). Significant differences between time points after hypoxia are shown by letters; between hypoxia treated and normoxia are shown by * (p < 0.05) or ** (p < 0.001). Frontiers in Physiology 08 frontiersin.org García-Meilán et al. 10.3389/fphys.2022.1021927 FIGURE 5 Transcript levels of antioxidants (A) sod2, (B) cat, (C) gpx, (D) gst, and (E) gsr in rainbow trout brain, head kidney, and skin after normoxia and acute hypoxia with different recovery times (1, 6, and 24 h). The values are presented as mean +SEM (n = 8). Significant differences between time points after hypoxia are shown by letters; between hypoxia treated and normoxia are shown by * (p < 0.05) or ** (p < 0.001). store refilling (Bergstedt et al., 2021). In this sense, a lower oxygen rainbow trout after 1 h in hypoxia took place 6 h after stress, deficit is related with a higher hypoxia tolerance (Svendsen et al., pointing out to a rapid clearance of accumulated metabolic by- 2012; Genz et al., 2013). The recovery of lactate basal levels in products and promoting survival avoiding lactic acidosis. Also, Frontiers in Physiology 09 frontiersin.org García-Meilán et al. 10.3389/fphys.2022.1021927 an increase in hematocrit was found due to hypoxia treatment and its fast reaction can be attributed to the potential of this tissue that could be due to adrenaline-induced erythrocyte swelling, to respond to direct contact with the environment. release of preformed red blood cells by spleen contraction (Lai Stress generates a non-specific and integrated response et al., 2006), changes in plasma volume, plasma skimming, and involving all regulatory systems (neural, endocrine, and new red blood cell formation, as described in previous works immune), and some of the molecules implicated in such a (Nikinmaa, 1990; Weendelar-Bonga, 1997; Gallaugher and non-specific response are pro-inflammatory cytokines even if Farrell, 1998; Pichavant et al., 2002; Nikinmaa and Tervonen, the stressor is not a pathogen or a microorganism (Castillo et al., 2004; Aboagye and Allen, 2018; Léger et al., 2021). 2009; Khansari et al., 2019). The pro- and anti-inflammatory Regarding the gene expression patterns, it was intended again responses in both the HK and skin followed a similar increment to assess key genes implicated in stress, immunity, and pattern, suggesting the existence of a fine adjustment of these metabolism. An upregulation in trh was found in brain 1 h components, since their imbalance may lead to tissue damage after hypoxia, followed by a significant downregulation after and immune dysfunction (Delves et al., 2006; Verburg-van 24 h. A downregulation has also been previously found over time Kemenade et al., 2011). In the skin, transcript level response in the sea bream brain after air exposure suggesting an inhibition was faster than the HK, showing a significant increase 1 h after of the thyroid hormone axis, preventing unnecessary energy loss recovery, except for il6 that reached a maximum of 6 h after (Skrzynska et al., 2018; Liu et al., 2019), and similar results were hypoxia. Accordingly, high levels of skin mucus cortisol were also also found for this species due to salinity changes (Ruiz-Jarabo found 1 h after recovery, that were also correlated with those et al., 2017). In the present study, crh, gr, or hsp70 did not show found in plasma, reaching basal values 6 h after hypoxia relevant changes at the brain level, suggesting that the kind of exposure. The results found in the skin are in accordance hypoxia challenge applied was mild or moderate. Contrarily, with a previous experiment in rainbow trout after 1 min hsp70 and gr transcript expression was significantly upregulated under air exposure (Khansari et al., 2018), and the fast in both the HK and skin of rainbow trout. Similar results to those upregulation of the genes might be induced by both on hsp70 in the HK were found in the rainbow trout spleen after recirculation and local cortisol secretion. On the contrary, in air exposure (Khansari et al., 2019), suggesting that both tissues the HK, most of the gene upregulation takes place 6 h after stress, are more intensively involved in immunological functions than suggesting that in the peripheral tissue, a local immune response in other non-specific stress responses. In addition, gr mediates takes place as soon as the stressor is detected, whereas the the influence of cortisol in modulating gene expression in target interrenal tissue participates in a later response and possibly tissues post-stress (Vijayan et al., 2003). On the contrary, hsp70 prevents further alteration at the central level by this type of regulation in the liver, an organ more related to metabolism, stress, since no differences in the transcript levels were found in presented a different expression pattern after air exposure, the brain. Enolase, a metabolic and energetic marker involved in showing tissue-specific response after stress (Khansari et al., glycolysis, would act as a heat-shock protein protecting cells after 2019). Regarding the skin, the transcript-level profile of hsp70 hypoxia by providing faster access to energetic resources previously found after air exposure over time by Khansari et al. (Soengas et al., 1998; Roland et al., 2000; Gracey et al., 2001). (2018) was completely different from the one found in the Moreover, a clear upregulation was found in the HK and skin, present study, where a significant increase was found even at although in the latter, the changes were not significant. These 24 h after hypoxia. Other studies on common carp (Cyprinus results were in accordance with a previous study on Sparus carpio L.) skin showed low levels of crh expression, like in the aurata in which a significant upregulation was found in the present study, suggesting the putative presence of a local brain after an in vivo LPS challenge (Ribas et al., 2004). cutaneous CRH system. Thus, Mazon et al. (2006) observed Oxygen homeostasis in mammals is regulated by the hypoxia- CRH-positive cells in the dermis and epidermis of common carp, inducible factor (HIF) gene that affects the use and transport of and it should be mentioned that this cutaneous CRH system is oxygen by regulating its expression during hypoxia (Nikinmaa and well-established in mammals, as CRH has been demonstrated to Rees, 2005; Rimoldi et al., 2012; Baptista et al., 2016; Wang M. et al., be produced by various immune cells in peripheral areas, 2021). In our results, both the HK and skin showed upregulation in including macrophages (Baker et al., 2003). So, CRH can been hif-1 transcript levels by hypoxia, since their levels were significantly found in several peripheral tissues and may be involved in the higher 6 h after recovery in the HK and 1 and 6 h post-hypoxia in regulation of the distribution of immune cells after acute stress the skin. In yellow catfish, hypoxia also induced alteration in hif-1 (Huising et al., 2003) or infection (Scharsack et al., 2003). This expression in the brain, liver, and gills (Wang M. et al., 2021). The idea was reinforced by the transcript levels found in the skin, main difference that could explain the absence of changes in the since most of them were significantly upregulated just 1 h after brain between that study and ours could be the species and sampling recovery, whereas the HK response was found later (in most time. Thus, while Wang et al. sampled just after 1 h hypoxia, we cases, 6 h after hypoxia) and at lower levels, as for glucocorticoid sampled 1 h after recovery, that is, after 1 h in hypoxia followed by receptor (gr) expression. Thus, the results confirm that the skin 1 h in normoxia. Despite this, the transcript level profile found after plays a significant role in reacting to environmental challenges, recovery was similar in both studies. Frontiers in Physiology 10 frontiersin.org García-Meilán et al. 10.3389/fphys.2022.1021927 Stressful factors, like hypoxia, could contribute to the rise of both the HK and skin. A recent study demonstrated the ROS production (Lushchak, 2011; Pascoli et al., 2011; Rahal et al., peroxidase activity of myoglobin, with a wide reductive 2014), as well as the reoxygenation after hypoxia (recovery substrate-specificity and activation by low pH (Mannino et al., period) (Bergstedt et al., 2021). Cells have enzymatic and non- 2019). Thus, its activation led to a faster and more efficient enzymatic antioxidants to prevent oxidative damage to proteins, cellular response to hypoxia–reoxygenation-induced oxidative lipids, and nucleic acids avoiding cell death (Halliwell and stress than the novo synthesis of other antioxidants. Gutteridge, 2015; Pinedo-Gil et al., 2019). If the balance Overall, these results suggest that the type of stressor applied between oxidative damage and antioxidants is broken, (1 h transient hypoxia at 2 mg O2/L) had a mild or moderate inflammatory reactions are triggered that can negatively affect effect on rainbow trout, since only moderate changes at the fish cells; therefore, the ability to avoid and/or repair cellular central brain level indicate that fish were able to cope with this damage becomes crucial. In this sense, an upregulation was particular stressor. Unlike the brain, HK and skin were more found in HK 1 and 6 h after hypoxia in sod2, gpx, gst, and affected by hypoxia and reoxygenation. Thus, the results support gsr, whereas a slight increase was observed for catalase transcript the important role of the HK as an important endocrine and levels, that could be due to both hypoxia and recovery period hematopoietic-lymphoid organ in teleostean fish (Gallo and under normoxia since their expression was even higher 6 h post- Civinini, 2003; Uribe et al., 2011), particularly after stress stress. Catalase activity is often related with high levels of situations. For the skin, our results also showed gene oxidative stress (Box et al., 2007; Gutteridge and Halliwell, upregulation in general terms, indicating a relevant degree of 2010; Halliwell and Gutteridge, 2015). Thus, the absence of a responsiveness of this peripheral tissue. Since the skin is in direct significant catalase transcript level regulation suggests that, contact with the hypoxic environment, it could act as a sensory despite time and low DO, rainbow trout did not have system that could first develop a local response, subsequently problems to deal with oxidative stress at the interrenal level. leading to a systemic neuroendocrine response (Schreck and However, in the skin, the antioxidant transcript levels were Tort, 2016). quickly upregulated (1 h after recovery) for sod2, catalase, and In conclusion, the present work shows that transient hypoxic gpx, suggesting that this tissue needs to avoid and/or repair episodes in the water–oxygen content may be regulated by fish, cellular damage caused by ROS arising from reoxygenation, since including oxygen-sensitive species such as rainbow trout, even the skin is in direct contact with water (Bergstedt et al., 2021). under acute oxygen reduction (2 mg/L). The present results show Previous studies also found an increase in the SOD activity in the that brain function is not heavily affected and that most of the fish liver and intestine after hypoxia–reoxygenation (Lushchak regulatory processes are carried out by other coordinated organs et al., 2005; Lushchak and Bagnyukova, 2007; Sun Y. et al., 2020; and structures, mostly the HK and skin. One relevant result of the Li et al., 2020) and an increment in antioxidant gene expression present work is the important role of the skin as a sensory and in the channel catfish skin after Aeromonas hydrophila infection responsive organ dealing with environmental variables such as (Li et al., 2013), suggesting its possible involvement in defense oxygen availability. The present results show both high skin against pathogens or in skin wound repair (Espinosa-Ruíz and sensitivity and a wide range of responses both in time and change Esteban, 2021). rates, even more in other central structures such as the brain, Similarly, a study on Schizothorax prenanti showed that the under this experimental condition. The present results also show antioxidant expression response had two differentiated phases that, even though the stressor is a physical/environmental after acute hypoxic stress: an initial one with suppressed sod, stressor, all components of the biological systems participate catalase, and gpx expression and a later recovery one where there in the regulation of the response process and the recovery was increased expression of sod, catalase, and gpx (Zhao et al., process, including neuroendocrine, metabolism, and immunity. 2020). On the contrary, Han et al. (2022) found that sod, catalase, and gpx transcript levels in the liver from triploid rainbow trout Data availability statement were downregulated or unchanged after 10 min under hypoxia and crowding. These differences during hypoxia–reoxygenation The original contributions presented in the study are could be due to species-, tissue-, and time-specificity, thus included in the article/Supplementary Materials; further resulting in different dynamics. inquiries can be directed to the corresponding author. Myoglobin expression was also studied, since its function was commonly associated with oxygen storage and diffusion. This protein is known to accumulate in some vertebrate tissues, such Ethics statement as in the brain of common carp (Helbo et al., 2012; Mannino et al., 2019) and the brain and heart of goldfish (Roesner et al., The experiment complied with the Guiding Principles for 2008), which are both hypoxia-tolerant fish. Our results showed a Biomedical Research Involving Animals (EU2010/63), the similar transcript level pattern for myoglobin and antioxidants in guidelines of the Spanish laws (law 32/2007 and RD 53/2013). Frontiers in Physiology 11 frontiersin.org García-Meilán et al. 10.3389/fphys.2022.1021927 Author contributions Conflict of interest Conceptualization, IG-M, LT, and ARKH; methodology, The authors declare that the research was conducted in the IGM and ARKH; software, IG-M and ARKH; validation, IG- absence of any commercial or financial relationships that could M, LT, and ARKH; formal analysis, IG-M and LT; investigation, be construed as a potential conflict of interest. IG-M, LT, and ARKH; data curation, IG-M; writing—original draft preparation, IG-M, LT, and ARKH; writing—review and editing, IG-M, LT, and ARKH; supervision, IG-M, LT, and Publisher’s note ARKH; and funding acquisition, LT. All authors have read and agreed to the published version of the manuscript. All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the Funding editors, and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its This work was supported by the project PID 2020-117557RB- manufacturer, is not guaranteed or endorsed by the C21/AEI-MICINN Spain/DOI: 10.13039/501100011033. publisher. References Abdel-Tawwab, M., Monier, M. N., Hoseinifar, S. H., and Faggio, C. (2019). Fish Delves, P. J., Martin, S. J., Burton, D. R., and Roitt, I. M. (2006). Roitt’s essential response to hypoxia stress: Growth, physiological, and immunological biomarkers. immunology. Wiley-Blackwell. Fish. Physiol. Biochem. 45, 997–1013. doi:10.1007/s10695-019-00614-9 Diaz, R. J., and Rosenberg, R. (1995). Marine benthic hypoxia: A review of its Aboagye, D. L., and Allen, P. J. (2018). Effects of acute and chronic hypoxia on ecological effects and the behavioural responses of benthic macrofauna. Oceanogr. acid-base regulation, hematology, ion, and osmoregulation of juvenile American Mar. Biol. 33, 245–303. paddlefish. J. Comp. Physiol. B 188, 77–88. doi:10.1007/s00360-017-1104-7 Eiden, L. E. (2013). Neuropeptide-catecholamine interactions in stress. Adv. Baker, C., Richards, L. J., Dayan, C. M., and Jessop, D. S. (2003). Corticotropin- Pharmacol. 68, 399–404. doi:10.1016/B978-0-12-411512-5.00018-X releasing hormone immunoreactivity in human T and B cells and macrophages: Ellis, T., Yildiz, H. Y., López-Olmeda, J., Spedicato, M. T., Tort, L., Øverli, Ø., et al. Colocalization with arginine vasopressin. J. Neuroendocrinol. 15, 1070–1074. doi:10. (2012). Cortisol and finfish welfare. Fish. Physiol. Biochem. 38, 163–188. doi:10. 1046/j.1365-2826.2003.01099.x 1007/s10695-011-9568-y Baptista, R. B., Souza-Castro, N., and Almeida-Val, V. M. F. (2016). Acute Engelsma, M. Y., Huising, M. O., van Muiswinkel, W. B., Flik, G., Kwang, J., Savelkoul, hypoxia up-regulates HIF-1α and VEGF mRNA levels in Amazon hypoxia-tolerant H. F. J., et al. (2002). Neuroendocrine-immune interactions in fish: A role for interleukin- Oscar (Astronotus ocellatus). Fish. Physiol. Biochem. 42, 1307–1318. doi:10.1007/ 1. Vet. Immunol. Immunopathol. 87, 467–479. doi:10.1016/s0165-2427(02)00077-6 s10695-016-0219-1 Espinosa-Ruíz, C., and Esteban, M. Á. (2021). Wound-induced changes in Bergstedt, J. H., Pfalzgraff, T., and Skov, P. V. (2021). Hypoxia tolerance and antioxidant enzyme activities in skin mucus and in gene expression in the skin metabolic coping strategies in Oreochromis niloticus. Comp. Biochem. Physiol. A of gilthead seabream (Sparus aurata L). Fishes 6, 15. doi:10.3390/fishes6020015 Mol. Integr. Physiol. 257, 110956. doi:10.1016/j.cbpa.2021.110956 Fernández-Alacid, L., Sanahuja, I., Ordóñez-Grande, B., Sánchez-Nuño, S., Bowyer, J. N., Booth, M. A., Qin, J. G., D’Antignana, M. J. S., and Stone, D. A. J. Viscor, G., Gisbert, E., et al. (2018). Skin mucus metabolites in response to (2014). Temperature and dissolved oxygen influence growth and digestive enzyme physiological challenges: A valuable non-invasive method to study teleost activities of yellowtail kingfish Seriola lalandi (Valenciennes, 1833). Aquac. Res. 45, marine species. Sci. Total Environ. 644, 1323–1335. doi:10.1016/j.scitotenv.2018. 2010–2020. doi:10.1111/are.12146 07.083 Box, A., Sureda, A., Galgani, F., Pons, A., and Deudero, S. (2007). Assessment of Gallaugher, P., and Farrell, A. P. (1998). “Hematocrit and blood oxygen-carrying environmental pollution at Balearic Islands applying oxidative stress biomarkers in capacity,” in Fish respiration. Editors S. F. Perry SF and B. L. Tufts (San Diego: the mussel Mytilus galloprovincialis. Comp. Biochem. Physiol. C. Toxicol. Academic), 185–227. Pharmacol. 146, 531–539. doi:10.1016/j.cbpc.2007.06.006 Gallo, V. P., and Civinini, A. (2003). Survey of the adrenal homolog in teleosts. Carbajal, A., Reyes-López, F. E., Tallo-Parra, O., Lopez-Bejar, M., and Tort, L. Int. Rev. Cytol. 230, 89–187. doi:10.1016/s0074-7696(03)30003-8 (2019). Comparative assessment of cortisol in plasma, skin mucus and scales as a measure of the hypothalamic-pituitary-interrenal axis activity in fish. Aquaculture Genz, J., Jyde, M. B., Svendsen, J. C., Steffensen, J. F., and Ramløv, H. (2013). 506, 410–416. doi:10.1016/j.aquaculture.2019.04.005 Excess post-hypoxic oxygen consumption is independent from lactate accumulation in two cyprinid fishes. Comp. Biochem. Physiol. A Mol. Integr. Castillo, J., Teles, M., Mackenzie, S., and Tort, L. (2009). Stress-related hormones Physiol. 165, 54–60. doi:10.1016/j.cbpa.2013.02.002 modulate cytokine expression in the head kidney of gilthead sea bream (Sparus aurata). Fish. Shellfish Immunol. 27, 493–499. doi:10.1016/j.fsi.2009.06.021 Gorissen, M., and Flik, G. (2016). “The endocrinology of the stress response in fish: An adaptation-physiological view,” in Biology of stress in fish. Editors Chapman, L. J., and McKenzie, D. J. (2009). “Hypoxia,” in Fish Physiology. Editors C. Schreck, L. Tort, A. P. Farrell, and C. B. Brauner (Cambridge, MA: J. G. Richards, A. P. Farrell, and C. J. Brauner (Academic Press), 27, 25–77. Academic Press), 75–111. doi:10.1016/b978-0-12-802728-8.00003-5 Dawood, M. A. O., Noreldin, A. E., and Sewilam, H. (2021). Long term salinity Gracey, A. Y., Troll, J. V., and Somero, G. N. (2001). Hypoxia-induced gene disrupts the hepatic function, intestinal health, and gills antioxidative status in Nile expression profiling in the euryoxic fish Gillichthys mirabilis. Proc. Natl. Acad. Sci. tilapia stressed with hypoxia. Ecotoxicol. Environ. Saf. 220, 112412. doi:10.1016/j. U. S. A. 98–1998. doi:10.1073/pnas.98.4.1993 ecoenv.2021.112412 Guardiola, F. A., Cuesta, A., and Esteban, M. Á. (2016). Using skin mucus to De Mercado, E., Larrán, A. M., Pinedo, J., and Tomás-Almenar, C. (2018). Skin evaluate stress in gilthead seabream (Sparus aurata L). Fish. Shellfish Immunol. 59, mucous: A new approach to assess stress in rainbow trout. Aquaculture 484, 90–97. 323–330. doi:10.1016/j.fsi.2016.11.005 doi:10.1016/j.aquaculture.2017.10.031 Gutteridge, J. M. C., and Halliwell, B. (2010). Antioxidants: Molecules, medicines, Declerq, A. M., Aerts, J., Ampe, B., Haesebrouck, F., De Saeger, S., and Decostere, and myths. Biochem. Biophys. Res. Commun. 393, 561–564. doi:10.1016/j.bbrc.2010. A. (2016). Cortisol directly impacts Flavobacterium columnare in vitro growth 02.071 characteristics. Vet. Res. 47, 84–89. doi:10.1186/s13567-016-0370-9 Frontiers in Physiology 12 frontiersin.org García-Meilán et al. 10.3389/fphys.2022.1021927 Halliwell, B., and Gutteridge, J. M. C. (2015). Free radicals in biology and Mannino, M. H., Patel, R. S., Eccardt, A. M., Perez Magnelli, R. A., Robinson, C. L. medicine. 5th ed. Croydon, UK: Oxford University Press. C., Janowiak, B. E., et al. (2019). Myoglobin as a versatile peroxidase: Implications for a more important role for vertebrate striated muscle in antioxidant defense. Han, B., Meng, Y., Tian, H., Li, C., Li, Y., Gongbao, C., et al. (2022). Effects of Comp. Biochem. Physiol. B Biochem. Mol. Biol. 234, 9–17. doi:10.1016/j.cbpb.2019. acute hypoxic stress on physiological and hepatic metabolic responses of triploid 04.005 rainbow trout (Oncorhynchus mykiss). Front. Physiol. 13, 921709. doi:10.3389/ fphys.2022.921709 Mazon, A. F., Verburg-van Kemenade, B. M. L., Flick, G., and Huising, M. O. (2006). Corticotropin-releasing hormone-receptor 1 (CRH-R1) and CRH-binding He, J., Yu, Y., Qin, X-W., Zeng, R-Y., Wang, Y-Y., Li, Z-M., et al. (2019). protein/CRH-BP) are expressed in the gills and skin of common carp Cyprinus Identification and functional analysis of the Mandarin fis (Siniperca chuatsi) carpio L. and respond to acute stress and infection. J. Exp. Biol. 209, 510–517. doi:10. hypoxia-inducible factor-1α involved in the immune response. Fish. Shellfish 1242/jeb.01973 Immunol. 92, 141–150. doi:10.1016/j.fsi.2019.04.298 Mommsen, T. P., Vijayan, M. M., and Moon, T. W. (1999). Cortisol in teleosts: Helbo, S., Dewilde, S., Williams, D. R., Berghmans, H., Berenbrink, M., Cossins, Dynamics, mechanisms of action, and metabolic regulation. Rev. Fish. Biol. Fish. 9, A. R., et al. (2012). Functional differentiation of myoglobin isoforms in hypoxia- 211–268. doi:10.1023/A:1008924418720 tolerant carp indicates tissue-specific protective roles. Am. J. Physiol. Regul. Integr. Comp. Physiol. 302, R693–R701. doi:10.1152/ajpregu.00501.2011 Mu, Y., Li, W., Wu, B., Chen, J., and Chen, X. (2020). Transcriptome analysis reveals new insights into immune response to hypoxia challenge of large yellow Hou, Z.-S., Wen, H.-S., Li, J.-F., He, F., Li, Y., and Qi, X. (2020). Environmental croaker (Larimichthys crocea). Fish. Shellfish Immunol. 98, 738–747. doi:10.1016/j. hypoxia causes growth retardation, osteoclast differentiation and calcium fsi.2019.11.021 dyshomeostasis in juvenile rainbow trout (Oncorhynchus mykiss). Sci. Total Environ. 705, 135272–135313. doi:10.1016/j.scitotenv.2019.135272 Nikinmaa, M., and Rees, B. B. (2005). Oxygen-dependent gene expression in fishes. Am. J. Physiol. Regul. Integr. Comp. Physiol. 288, R1079–R1090. doi:10.1152/ Huising, M. O., Guichelaar, T., Hoek, C., Verburg-van Kemenade, B. M., Flik, G., ajpregu.00626.2004 Savelkoul, H. F., et al. (2003). Increased efficacy of immersion vaccination in fish with hyperosmotic pretreatment. Vaccine 21, 4178–4193. doi:10.1016/s0264- Nikinmaa, M., and Tervonen, V. (2004). “Regulation of blood haemoglobin 410x(03)00497-3 concentration in hypoxic fish,” in Proceedings of the 7th international symposium on fish Physiology, toxicology, and water quality. Editors G. L. Rupp and M. D. White Hung, K.-S., Chen, S.-Y., Hsu, P.-H., Lin, B.-A., Hu, C.-H., Yang, C.-H., et al. (Athens, GA: U.S. Environmental Protection Agency, Ecosystems Research (2022). Comparative transcriptome analysis of organ-specific adaptive responses to Division), 243–252. hypoxia provides insights to human diseases. Genes 13, 1096. doi:10.3390/ genes13061096 Nikinmaa, M. (1990). Vertebrate red blood cells. Heidelberg: Springer. Jia, Y., Wang, J., Gao, Y., and Huang, B. (2021). Hypoxia tolerance, hematological, Obirikorang, K. A., Acheampong, J. N., Duodu, C. P., and Skov, P. V. (2020). and biochemical response in juvenile turbot (Scophthalmus maximus L). Growth, metabolism and respiration in Nile tilapia (Oreochromis niloticus) exposed Aquaculture 535, 736380. doi:10.1016/j.aquaculture.2021.736380 to chronic or periodic hypoxia. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 248, 110768. doi:10.1016/j.cbpa.2020.110768 Khansari, A. R., Balasch, J. C., Vallejos-Vidal, E., Parra, D., Reyes-Lopez, F. E., and Tort, L. (2018). Comparative immune- and stress-related transcript response Pascoli, F., Negrato, E., Di Giancamillo, A., Bertotto, D., Domeneghini, C., induced by air exposure and Vibrio anguillarum bacterin in rainbow trout Simontacchi, C., et al. (2011). Evaluation of oxidative stress biomarkers in (Oncorhynchus mykiss) and Gilthead seabream (Sparus aurata) mucosal Zosterisessor ophiocephalus from the Venice Lagoon, Italy. Aquat. Toxicol. 101, surfaces. Front. Immunol. 9, 856. doi:10.3389/fimmu.2018.00856 512–520. doi:10.1016/j.aquatox.2010.12.003 Khansari, A. R., Balasch, J. C., Vallejos-Vidal, E., Teles, M., Tort, L., Reyes-Lopez, Pichavant, K., Maxime, V., Th´ebault, M. T., Ollivier, H., Garnier, J. P., Bousquet, F. E., et al. (2019). Comparative study of stress- and immune-related transcript B., et al. (2002). Effects of hypoxia and subsequent recovery on turbot Scophthalmus outcomes triggered by Vibrio anguillarum bacterin and air exposure stress in liver maximus: Hormonal changes and anaerobic metabolism. Mar. Ecol. Prog. Ser. 225, and spleen of gilthead seabream (Sparus aurata), zebrafish (Danio rerio) and 275–285. doi:10.3354/meps225275 rainbow trout (Oncorhynchus mykiss). Fish. Shellfish Immunol. 86, 436–448. Pinedo-Gil, J., Martín-Diana, A. B., Bertotto, D., Sanz-Calvo, M. Á., Jover-Cerdá, doi:10.1016/j.fsi.2018.11.063 M., and Tomás-Vidal, A. (2019). Effects of dietary barley on rainbow trout exposed Kvetnansky, R., Lu, X., and ZieglerMG (2013). Stress-triggered changes in to an acute stress challenge. Aquaculture 501, 32–38. doi:10.1016/j.aquaculture. peripheral catecholaminergic systems. Adv. Pharmacol. 68, 359–397. doi:10. 2018.10.070 1016/B978-0-12-411512-5.00017-8 Rahal, A., Kumar, A., Singh, V., Yadav, B., Tiwari, R., Chakraborty, S., et al. Lai, J. C. C., Kakuta, I., Mok, H. O. L., Rummer, J. L., and Randall, D. (2006). (2014). Oxidative stress, prooxidants, and antioxidants: The interplay. Biomed. Res. Effects of moderate and substantial hypoxia on erythropoietin levels in rainbow Int. 761264, 1–19. doi:10.1155/2014/761264 trout kidney and spleen. J. Exp. Biol. 209, 2734–2738. doi:10.1242/jeb.02279 Ribas, L., Planas, J. V., Barton, B., Monetti, C., Bernadini, G., Saroglia, M., et al. Léger, J. A. D., Athanasio, C. G., Zhera, A., Chauhan, M. F., and Simmons, D. B. (2004). A differentially expressed enolase gene isolated from the gilthead sea bream D. (2021). Hypoxic responses in Oncorhynchus mykiss involve angiogenesis, lipid, (Sparus aurata) under high-density conditions is up regulated in brain after in vivo and lactate metabolism, which may be triggered by the cortisol stress response and lipopolysaccharide challenge. Aquaculture 241, 195–206. doi:10.1016/j.aquaculture. epigenetic methylation. Comp. Biochem. Physiol. Part D. Genomics Proteomics 39, 2004.07.015 100860. doi:10.1016/j.cbd.2021.100860 Richards, J. G. (2009). “Metabolic and molecular responses of fish to hypoxia in Li, C., Beck, B., Su, B., Terhune, J., and Peatman, E. (2013). Early mucosal Richards,” in Fish. Physiol. Editors A. P. Farrell and J. B. Colin, 27, 443–485. doi:10. responses in blue catfish (Ictalurus furcatus) skin to Aeromonas hydrophila 1016/S1546-5098(08)00010-1 infection. Fish. Shellfish Immunol. 34, 920–928. doi:10.1016/j.fsi.2013.01.002 Rimoldi, S., Terova, G., Ceccuzzi, P., Marelli, S., Antonini, M., and Saroglia, M. Li, H. L., Lin, H. R., and Xia, J. H. (2017). Differential gene expression profiles and (2012). HIF-1α mRNA levels in Eurasian perch (Perca fluviatilis) exposed to acute alternative isoform regulations in gill of Nile tilapia in response to acute hypoxia. and chronic hypoxia. Mol. Biol. Rep. 39, 4009–4015. doi:10.1007/s11033-011- Mar. Biotechnol. 19, 551–562. doi:10.1007/s10126-017-9774-4 1181-8 Li, H., Lu, L., Wu, M., Xiong, X., Luo, L., Ma, Y., et al. (2020). The effects of dietary Roesner, A., Mitz, S. A., Hankeln, T., and Burmester, T. (2008). Globins and extract of mulberry leaf on growth performance, hypoxia-reoxygenation stress and hypoxia adaptation in the goldfish, Carassius auratus. FEBS J. 275, 3633–3643. biochemical parameters in various organs of fish. Aquac. Rep. 18, 100494. doi:10. doi:10.1111/j.1742-4658.2008.06508.x 1016/j.aqrep.2020.100494 Roland, I., Minet, E., Ernest, I., Pascal, T., Michel, G., Remacle, J., et al. (2000). Liu, X. H., Khansari, A. R., Teles, M., Martínez-Rodríguez, G., Zhang, Y. G., Identification of hypoxia-responsive messengers expressed in human microvascular Mancera, J. M., et al. (2019). Brain and pituitary response to vaccination in gilthead endothelial cells using differential display RT-PCR. Eur. J. Biochem. 267, seabream (Sparus aurata L.). Front. Physiol. 10, 717. doi:10.3389/fphys.2019.00717 3567–3574. doi:10.1046/j.1432-1327.2000.01385.x Lushchak, V. I., and Bagnyukova, T. V. (2007). Hypoxia induces oxidative stress Rotllant, J., Ruane, N. M., Dinis, M. T., Canarion, A. V. M., and Power, D. M. in tissues of a goby, the rotan Perccottus glenii. Comp. Biochem. Physiol. B Biochem. (2006). Intra-adrenal interactions in fish: Catecholamine stimulated cortisol release Mol. Biol. 148, 390–397. doi:10.1016/j.cbpb.2007.07.007 in sea bass (Dicentrarchus labrax L). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 143, 375–381. doi:10.1016/j.cbpa.2005.12.027 Lushchak, V. I., Bagnyukova, T. V., Lushchak, O. V., Storey, J. M., and Storey, K. B. (2005). Hypoxia and recovery perturb free radical processes and antioxidant Ruiz-Jarabo, I., Klaren, P. H. M., Louro, B., Martos-Sitcha, J. A., Pinto, P. I. S., potential in common carp (Cyprinus carpio) tissues. Int. J. Biochem., Cell Biol. 37, Vargas-Chacoff, L., et al. (2017). Characterization of the peripheral thyroid 1319–1330. doi:10.1016/j.biocel.2005.01.006 system of gilthead seabream acclimated to different ambient salinities. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 203, 24–31. doi:10.1016/j. Lushchak, V. I. (2011). Environmentally induced oxidative stress in aquatic cbpa.2016.08.013 animals. Aquat. Toxicol. 101, 13–30. doi:10.1016/j.aquatox.2010.10.006 Frontiers in Physiology 13 frontiersin.org García-Meilán et al. 10.3389/fphys.2022.1021927 Sanahuja, I., and Ibarz, A. (2015). Skin mucus proteome of gilthead sea bream: A Ton, C., Stamatiou, D., and Liew, C-C. (2003). Gene expression profile of non-invasive method to screen for welfare indicators. Fish. Shellfish Immunol. 46, zebrafish exposed to hypoxia during development. Physiol. Genomics 13, 426–435. doi:10.1016/j.fsi.2015.05.056 97–106. doi:10.1152/physiolgenomics.00128.2002 Schäfer, N., Matoušek, J., Rebl, A., Stejskal, V., Brunner, R. M., Goldammer, T., Tort, L. (2011). Stress and immune modulation in fish. Dev. Comp. Immunol. 35, et al. (2021). Effects of chronic hypoxia on the immune status of Pikeperch (Sander 1366–1375. doi:10.1016/j.dci.2011.07.002 lucioperca Linnaeus, 1758). Biology 10, 649. doi:10.3390/biology10070649 Uribe, C., Folch, H., Enriquez, R., and Moran, G. (2011). Innate and adaptive Scharsack, J. P., Steinhagen, D., Kleczka, C., Schmidt, J. O., Korting, W., Michael, immunity in teleost fish: A review. Veterinarni Med. 56, 486–503. doi:10.17221/ R. D., et al. (2003). The haemoflagellate Trypanoplasma borreli induces the 3294-vetmed production of nitric oxide, which is associated with modulation of carp Verburg-van Kemenade, B. M. L., Ribeiro, C. M. S., and Chadzinsk, M. (2011). (Cyprinus carpio L.) leucocyte functions. Fish. Shellfish Immunol. 14, 207–222. Neuroendocrine-immune interaction in fish: Differential regulation of phagocyte doi:10.1006/fsim.2002.0430 activity by neuroendocrine factors. Gen. Comp. Endocrinol. 172, 31–38. doi:10. Schreck, C. B., and Tort, L. (2016). “The concept of stress in fish” in Biology of 1016/j.ygcen.2011.01.004 Stress in Fish,” in Fish Physiology series. Editors C. B. Schreck, L. Tort, A. T. Farrell, Vijayan, M. M., Raptis, S., and Sathiyaa, R. (2003). Cortisol treatment affects and C. J. Brauner (Cambridge, MA: Academic Press), 35, 2–34. glucocorticoid receptor and glucocorticoid-responsive genes in the liver of rainbow Sheng, Y., Hua, Z. Y., Yang, Z., Wei, X. L., Sheng, Y. J., Jia, H. L., et al. (2019). trout. Gen. Comp. Endocrinol. 132, 256–263. doi:10.1016/S0016-6480(03)00092-3 Effects of acute hypoxic stress on biochemical parameters, immune regulation and Wang, M., Wu, F., Xie, S., and Zhang, L. (2021a). Acute hypoxia and metabolic capacity of the blood in genetically improved farmed tilapia (GIFT, reoxygenation: Effect on oxidative stress and hypoxia signal transduction in the Oreochromis niloticus). J. Appl. Ichthyol. 35, 978–986. doi:10.1111/jai.13930 juvenile yellow catfish (Pelteobagrus fulvidraco). Aquaculture 531, 735903. doi:10. Skrzynska, A. K., Maiorano, E., Bastaroli, M., Naderi, F., Míguez, J. M., Martínez- 1016/j.aquaculture.2020.735903 Rodríguez, G., et al. (2018). Impact of air exposure on vasotocinergic and Wang, Q., Li, X., Sha, H., Luo, X., Zou, G., and Liang, H. (2021b). Identification of isotocinergic systems in gilthead sea bream (Sparus aurata): New insights on microRNAs in silver carp (Hypophthalmichthys molitrix) response to hypoxia fish stress response. Front. Physiol. 9, 96. doi:10.3389/fphys.2018.00096 stress. Animals. 11, 2917. doi:10.3390/ani11102917 Soengas, J. L., Strong, E. F., and Andrés, M. D. (1998). Glucose, lactate, and beta- Wang, Y., and Richards, J. G. (2011). Hypoxia | anaerobic metabolism in fish in: hydroxy-butyrate utilization by rainbow trout brain: Changes during food Encyclopedia of fish Physiology. Elsevier, 1757–1763. doi:10.1016/B978-0-12- deprivation. Physiol. Zool. 71, 285–293. doi:10.1086/515925 374553-8.00154-4 Sun, J.-L., Zhao, L.-L., Liao, L., Tang, X.-H., Cui, C., Liu, Q., et al. (2020b). Weendelar-Bonga, S. E. (1997). The stress response in fish. Physiol. Rev. 77, Interactive effect of thermal and hypoxia on largemouth bass (Micropterus 591–625. doi:10.1152/physrev.1997.77.3.591 salmoides) gill and liver: Aggravation of oxidative stress, inhibition of immunity and promotion of cell apoptosis. Fish. Shellfish Immunol. 98, 923–936. doi:10.1016/ Welker, T. L., McNulty, S. T., and Klesius, P. H. (2007). Effect of sublethal hypoxia on j.fsi.2019.11.056 the immune response and susceptibility of channel catfish, Ictalurus punctatus, to enteric septicemia. J. World Aquac. Soc. 38, 12–23. doi:10.1111/j.1749-7345.2006.00069.x Sun, Y., Dong, H., Zhan, A., Wang, W., Duan, Y., Xie, M., et al. (2020a). Protection of teprenone against hypoxia and reoxygenation stress in stomach Xu, Z., Parra, D., Gomez, D., Salinas, I., Zhang, Y-A., von Gersdorff Jørgensen, L., et al. and intestine of Lateolabrax maculatus. Fish. Physiol. Biochem. 46, 575–584. (2013). Teleost skin, an ancient mucosal surface that elicits gut-like immune responses. doi:10.1007/s10695-019-00732-4 Proc. Natl. Acad. Sci. U. S. A. 110, 13097–13102. doi:10.1073/pnas.1304319110 Svendsen, J. C., Steffensen, J. F., Aarestrup, K., Frisk, M., Etzerodt, A., and Jyde, Yoann, T., Jonathan, F., Denis, C., Arturoc, A., Gonçalo, M., and Laure, P. (2019). M. (2012). Excess posthypoxic oxygen consumption in rainbow trout Effects of hypoxia on metabolic functions in marine organisms: Observed patterns (Oncorhynchus mykiss): Recovery in normoxia and hypoxia. Can. J. Zool. 90, and modelling assumptions within the context of dynamic energy budget (DEB) 1–11. doi:10.1139/z11-095 theory. J. Sea Res. 143, 231–242. doi:10.1016/j.seares.2018.05.001 Tiedke, J., Thiel, R., and Burmester, T. (2014). Molecular response of Zhao, L. L., Sun, J. L., Liang, J., Liu, Q., Luo, J., Li, Z. Q., et al. (2020). Enhancing estuarine fish to hypoxia: A comparative study with ruffe and flounder lipid metabolism and inducing antioxidant and immune responses to adapt to acute from field and laboratory. PLoS ONE 9 (3), e90778. doi:10.1371/journal. hypoxic stress in Schizothorax prenanti. Aquaculture 519, 734933. doi:10.1016/j. pone.0090778 aquaculture.2020.734933 Frontiers in Physiology 14 frontiersin.org