Open Forum Infectious Diseases MAJOR ARTICLE Global Emergence of Resistance to Fluconazole and Voriconazole in Candida parapsilosis in Tertiary Hospitals in Spain During the COVID-19 Pandemic Nuria Trevijano-Contador,1 Alba Torres-Cano,1 Cristina Carballo-González,1 Mireia Puig-Asensio,2,3, María Teresa Martín-Gómez,4 Emilio Jiménez-Martínez,2, Daniel Romero,4 Francesc Xavier Nuvials,5 Roberto Olmos-Arenas,6 María Clara Moretó-Castellsagué,6 Lucía Fernández-Delgado,6 Graciela Rodríguez-Sevilla,6 María-Mercedes Aguilar-Sánchez,6 Josefina Ayats-Ardite,6 Carmen Ardanuy-Tisaire,6,7 Isabel Sanchez-Romero,8 María Muñoz-Algarra,8 Paloma Merino-Amador,9,10,11 Fernando González-Romo,9,10,11 Gregoria Megías-Lobón,12 Jose Angel García-Campos,12 María Ángeles Mantecón-Vallejo,12 Eva Alcoceba,13 Pilar Escribano,14,15, Jesús Guinea,15,16 Maria Teresa Durán-Valle,17 Arturo Manuel Fraile-Torres,17 María Pía Roiz-Mesones,18 Isabel Lara-Plaza,18 Ana Pérez de Ayala,19 María Simón-Sacristán,20 Ana Collazos-Blanco,20 Teresa Nebreda-Mayoral,21 Gabriel March-Roselló,21 Laura Alcázar-Fuoli,1,22 and Oscar Zaragoza1,22 1 Mycology Reference Laboratory, National Centre for Microbiology, Instituto de Salud Carlos III. Carretera Majadahonda-Pozuelo, Madrid, Spain, 2Department of Infectious Diseases, Hospital Universitari de Bellvitge-Institut d´Investigació Biomèdica de Bellvitge (IDIBELL), Barcelona, Spain, 3Center for Biomedical Research in Network in Infectious Diseases (CIBERINFEC, CB21/13/00009), Instituto de Salud Carlos III, Madrid, Spain, 4Department of Microbiology, Vall D’Hebron University Hospital, Universitat Autònoma de Barcelona, Barcelona, Spain, 5Intensive Care Unit, Vall D’Hebron University Hospital, Universitat Autònoma de Barcelona, Barcelona, Spain, 6Microbiology Department, Hospital Universitari de Bellvitge, IDIBELL, Barcelona, Spain, 7Center for Biomedical Research Network in Respiratory Diseases (CIBERES-CB06/06/0037), Instituto de Salud Carlos III, Madrid, Spain, 8Microbiology Department, Hospital Universitario Puerta de Hierro, Majadahonda, Madrid, Spain, 9 Microbiology Department, Hospital Universitario Clínico San Carlos, Madrid, Spain, 10Instituto de Investigación Sanitaria Hospital Clínico San Carlos (IdISSC), Madrid, Spain, 11Department of Medicine, Universidad Complutense School of Medicine, Madrid, Spain, 12Department of Clinical Microbiology, Hospital Universitario de Burgos, Burgos, Castilla y León, Spain, 13Clinical Microbiology Department, Hospital Universitari Son Espases, Mallorca, Spain, 14Clinical Microbiology and Infectious Diseases, Hospital General Universitario Gregorio Marañón, Madrid, Spain, 15 Instituto de Investigación Sanitaria Gregorio Marañón, Madrid, Spain, 16Center for Biomedical Research Network in Respiratory Diseases (CIBERES-CB06/06/0058), Madrid, Spain, 17Microbiology and Parasitology Department, Hospital Universitario de Móstoles, Madrid, Spain, 18Microbiology Department, Marqués de Valdecilla Universitary Hospital and Instituto de Investigación Valdecilla (IDIVAL), Santander, Cantabria, Spain, 19Microbiology Unit, Universitary Hospital 12 de Octubre, Madrid, Spain, 20Microbiology and Parasitology Department, Hospital Central de la Defensa Gómez Ulla, Madrid, Spain, 21Microbiology and Immunology Unit, Universitary Clinic Hospital of Valladolid, Valladolid, Spain, and 22Center for Biomedical Research in Network in Infectious Diseases (CIBERINFEC-CB21/13/00105), Instituto de Salud Carlos III, Madrid, Spain Background. Candida parapsilosis is a frequent cause of candidemia worldwide. Its incidence is associated with the use of medical implants, such as central venous catheters or parenteral nutrition. This species has reduced susceptibility to echinocandins, and it is susceptible to polyenes and azoles. Multiple outbreaks caused by fluconazole-nonsusceptible strains have been reported recently. A similar trend has been observed among the C. parapsilosis isolates received in the last 2 years at the Spanish Mycology Reference Laboratory. Methods. Yeast were identified by molecular biology, and antifungal susceptibility testing was performed using the European Committee on Antimicrobial Susceptibility Testing protocol. The ERG11 gene was sequenced to identify resistance mechanisms, and strain typing was carried out by microsatellite analysis. Results. We examined the susceptibility profile of 1315 C. parapsilosis isolates available at our reference laboratory between 2000 and 2021, noticing an increase in the number of isolates with acquired resistance to fluconazole, and voriconazole has increased in at least 8 different Spanish hospitals in 2020–2021. From 121 recorded clones, 3 were identified as the most prevalent in Spain (clone 10 in Catalonia and clone 96 in Castilla-Leon and Madrid, whereas clone 67 was found in 2 geographically unrelated regions, Cantabria and the Balearic Islands). Conclusions. Our data suggest that concurrently with the coronavirus disease 2019 pandemic, a selection of fluconazole- resistant C. parapsilosis isolates has occurred in Spain, and the expansion of specific clones has been noted across Received 03 June 2022; editorial decision 01 November 2022; accepted 03 November 2022; centers. Further research is needed to determine the factors published online 7 November 2022 Correspondence: Oscar Zaragoza, PhD, Mycology Reference Laboratory, National Centre for that underlie the successful expansion of these clones and Microbiology, Instituto de Salud Carlos III, Carretera Majadahonda-Pozuelo, Km2, their potential genetic relatedness. Majadahonda 28220, Madrid, Spain (ozaragoza@isciii.es); Laura Alcázar-Fuoli, PhD, Keywords. Candida parapsilosis; antifungal resistance; Mycology Reference Laboratory, National Centre for Microbiology, Instituto de Salud Carlos III, Carretera Majadahonda-Pozuelo, Km2, Majadahonda 28220, Madrid, Spain (lalcazar@ fluconazole; outbreaks; voriconazole. isciii.es). Open Forum Infectious Diseases® © The Author(s) 2022. Published by Oxford University Press on behalf of Infectious Diseases Candida parapsilosis is an opportunistic pathogenic yeast able to Society of America. This is an Open Access article distributed under the terms of the cause invasive diseases such as candidemia. Worldwide, it is Creative Commons Attribution-NonCommercial-NoDerivs licence (https://creativecommons. the third cause of blood yeast infection after C. albicans and org/licenses/by-nc-nd/4.0/), which permits non-commercial reproduction and distribution of the work, in any medium, provided the original work is not altered or transformed in any C. glabrata, although in some countries its incidence is higher way, and that the work is properly cited. For commercial re-use, please contact journals. permissions@oup.com than C. glabrata [1–4]. Neonates, as well as indwelling parenteral https://doi.org/10.1093/ofid/ofac605 nutrition and central nervous catheters, have been associated FLC Resistance in C. parapsilosis • OFID • 1 with a higher risk of infection [5, 6]. Besides sporadic infections, Table 1. Oligonucleotides Designed to Sequence the Candida C. parapsilosis is well known to cause nosocomial outbreaks parapsilosis ERG11 Gene through direct and indirect contact via the hands of health Oligonucleotide Name Sequence (5´- 3´) care workers and through contaminated patient care equipment. 01_F_CpERG11 CGTCAAATGTCAGCATCGTC Candida parapsilosis exhibits a reduced natural in vitro 02_R_CpERG11 TCATTCGAGGTGAGTCAAC susceptibility to echinocandins [7], so the main therapeutic 03_F_CpERG11 TGGGTTGGTTCAGCCGTATC options for invasive infections due to this species are the tri­ 05_F_CpERG11 ACCATCTTCACTGCATCTAG azoles, mainly fluconazole or, alternatively, polyenes. 07_F_CpERG11 GTTGCATTTGGCTGAGAAGC Acquired resistance to fluconazole in C. parapsilosis is a 09_F_CpERG11 CCAAAGGTGTTAGCTCTTCG 10_R_CpERG11 GACATAGGCAAACTGTTCACC rare phenomenon, <5% of isolates in different epidemiolog­ 08_R_CpERG11 CCACCTTTACCAGATAAGGC ical studies [2, 7–10]. In recent years, however, a steady in­ 06_R_CpERG11 GCATACAATTGAGCAAATGAAGC crease in resistance has been observed worldwide, mostly 04_R_CpERG11 CCAAGTACACCGTCATTACTC in the context of nosocomial outbreaks [11–20]. In many cas­ Abbreviations: F, forward; R, reverse. es, these outbreaks are monoclonal and are associated with mutations in ERG11 (mainly with the Y132F mutation), overexpression of efflux pumps (as Mdr1 and Cdr1), and mu­ confirmed by sequencing the internal transcribed spacer 1 tations in MRR1, which encodes a transcription factor that (ITS1) and ITS2 regions from the ribosomal DNA as previ­ regulates the expression of some efflux pumps [11–13, 16, ously described [23]. 18, 21, 22]. The National Centre for Microbiology from Instituto de Salud Antifungal Susceptibility Carlos III (CNM-ISCIII, Madrid, Spain) acts as a national refer­ Antifungal susceptibility testing was performed following the ence center for clinically isolated fungi, providing services such EUCAST protocol [24] (RPMI 1640 medium; Merck, as genotyping and confirmation of antifungal susceptibility pro­ Sigma-Aldrich). The medium was buffered with MOPS (Merck, files by the European Committee on Antimicrobial Susceptibility Sigma-Aldrich) at pH 7 and supplemented with 2% glucose Testing (EUCAST) standardized methodology. Since 2020, a sig­ (Merck, Sigma-Aldrich). The following antifungals were tested nificant increase in the number of fluconazole-nonsusceptible in the concentration range indicated in brackets: amphotericin (FNS) C. parapsilosis isolates received was noted, most of them B (AmB; Merck, Sigma-Aldrich, 16–0.03 mg/L), flucytosine coming from tertiary hospitals across the country reporting (64–0.125 mg/L), fluconazole (FLC; Merck, Sigma-Aldrich, strong epidemiological suspicion of ongoing outbreaks. 64–0.125 mg/L), itraconazole (ITZ; Janssen Pharmaceutical The aim of this work was to describe the antifungal suscept­ Research and Development, 8–0.016 mg/L), voriconazole (VOR; ibility profile of all the C. parapsilosis isolates received in the Pfizer Pharmaceutical Group, 8–0.016 mg/L), posaconazole Spanish Mycology Reference Laboratory (SMRL) to gain in­ (POS; Merck, Sigma-Aldrich, 8–0.016 mg/L), isavuconazole sights about the susceptibility profile and appearance of resis­ (ISV; Pfizer Pharmaceutical Group, 8–0.016 mg/L), caspofungin tance in this species. Typing analysis confirmed genetic (CSP; Merck, Sigma-Aldrich, 16–0.016 mg/L), micafungin relatedness between isolates and their distribution across cen­ (MICA; Astellas Pharma Inc, 2–0.004 mg/L), and anidulafungin ters not always in the geographical vicinity. (ANID; Pfizer Pharmaceutical Group, 4–0.008 mg/L). The mini­ This nationwide study adds new data to the worrisome phe­ mal inhibitory concentration (MIC) was defined as the concentra­ nomenon of worldwide emerging azole resistance in C. parapsi­ tion that caused 50% of growth inhibition compared with the losis and points toward a temporal relationship between the control well without an antifungal, except for amphotericin B coronavirus disease 2019 (COVID-19) pandemic and the ex­ (90%). Strains were categorized as susceptible (S), resistant (R), pansion of clonal outbreaks in several Spanish tertiary or intermediate or susceptible increased exposure (I) following hospitals. the breakpoints established by EUCAST (see https://www.eucast. org/astoffungi/clinicalbreakpointsforantifungals, document from February 4, 2020) [24]. Control strains C. parapsilosis ATCC 22 METHODS 019 and C. krusei ATCC 6258 were included in all the assays. Media and Strains Identification The isolates were primarily isolated, identified, and screened Sequencing of the ERG11 Gene for fluconazole non-susceptibility at local laboratories fol­ To identify mutations at the ERG11 gene, we designed different lowing the routine methodologies of each center. Isolates primers (Table 1). The whole gene was amplified using oligo­ sent to the CNM-ISCIII from 2000 to 2021 and identified nucleotides 01_F and 02_R using the following polymerase as C. parapsilosis sensu stricto were subcultivated onto chain reaction (PCR) conditions: 94 °C for 2 minutes and 35 Sabouraud solid or liquid medium. Identification was cycles of amplification (94 °C for 30 seconds, 56 °C for 2 • OFID • Trevijano-Contador et al 45 seconds, and 72 °C for 2 minutes) followed by 1 final cycle of RESULTS AND DISCUSSION 5 minutes at 72 °C. We collected all the isolates available at our laboratory (SMRL) The PCR products were purified with the ExoStart kit. Sanger and analyzed the evolution of the antifungal susceptibility pat­ sequencing was performed using all the oligonucleotides de­ tern from 2000 to 2021. A total of 1315 isolates were studied. As scribed in Table 1 and analyzed with Seqman software (DNA shown in Table 1, resistance to fluconazole remained low (3%– Lasergene 12 package). 7%) among the isolates from our collection until 2016. However, a dramatic change in this resistance rate among the Microsatellite Typing isolates received at the Reference Laboratory was noted thereaf­ A panel of 4 short tandem repeat (STR) markers was used for ter, being particularly notable from 2019 onwards. Throughout genotyping the C. parapsilosis isolates. Three trinucleotide re­ the latter period, the percentage of fluconazole resistance signif­ peat markers and 1 hexanucleotide repeat marker described icantly increased (27% in 2019, around 60% in 2020 and 2021) by Diab-Elschahawi [25] were independently amplified by (Table 2) as compared with previous years. This trend was also PCR. Amplification reactions were performed in a final volume observed for voriconazole (Table 3). Before 2019, the voricona­ of 20 µL for markers 3A, 3B, and 6A, containing 1 ng of geno­ zole resistance rate was below 2%, but since 2020, the percentage mic DNA, 0.5 µM of amplification primers, 120 µM of dNTPS, of susceptible increased exposure (I, MIC = 0.25 mg/L) and re­ 1.25 mM of MgCl2, and 1 U of Amplitaq DNA (Applied sistant strains (MIC > 0.25 mg/L) increased up to around 60% Biosystems). The PCR conditions used were initial denatural­ among the strains received at the laboratory. ization for 5 minutes at 95 °C, followed by 30 cycles of 15 sec­ Regarding itraconazole and posaconazole, there was a slight onds of denaturalization at 95 °C, 1 minute of annealing at 62 ° trend toward higher MICs, but they were still categorized as C, and 1 minute of extension at 72 °C. A final incubation of susceptible (Tables 4 and 5). Only 3 isolates were fully resistant 7 minutes at 72 °C was included in the protocol. The PCR con­ to fluconazole: voriconazole, itraconazole, and posaconazole. ditions were optimized for the “3C” marker. In this case, ampli­ For isavuconazole, although there are no breakpoints to define fication reactions were performed in a final volume of 50 µL, resistant strains, an increase in the MICs among the isolates re­ containing 1 ng of DNA, 0.2-µM amplification primers, ceived since 2020 was found. The isavuconazole modal MIC 0.05 mM of dNTPS, 0.3 mM of MgCl2, and 1 U of Amplitaq rose from 0.016 mg/L before 2020 to 0.06 mg/L later on DNA (Applied Biosystems). PCR conditions for the 3C marker (Table 6), similar to what was observed for itraconazole and were as follows: initial denaturalization for 5 minutes at 94 °C, posaconazole. All the isolates were considered wild-type followed by 35 cycles of 30 seconds of denaturalization at to the rest of the antifungals tested (AmB, flucytosine, caspo­ 94 °C, 45 seconds of annealing at 60 °C, and 1 minute of exten­ fungin, micafungin, anidulafungin). sion at 72 °C, followed by 5 minutes at 72 °C. Then, 10 µL of the The presence of ERG11 mutations in fluconazole non-sus­ amplification products was put on a PCR Plate 96 semiskirted ceptible isolates was investigated. The ERG11 gene of 244 (Eppendorf) and purified with AMpure XP (Beckman Coulter) strains from 2019, 2020, and 2021, including S (n = 34), using SPRI bead technology in an Eppendorf ep Motion 5075 I (susceptible, increased exposure, n = 7), and R (n = 203) (Eppendorf). Finally, a 1-µL aliquot of PCR product was added strains to FLC, was sequenced. The ERG11 gene was found to to 9 µL of formamide and to 1 µL of internal size marker be wild-type in all the susceptible strains, and in 4.8% of the GeneScan 500 ROX (Applied Biosystems). After denaturaliza­ FNS isolates. Among the latter (n = 11), 1 strain was also sus­ tion of the samples at 95 °C for 3 minutes and rapid cooling ceptible increased exposure (I), and 6 were resistant to vorico­ to 4 °C, they were run on an AB3730XL DNA analyzer nazole. The remaining fluconazole-resistant isolates (n = 192, (Applied Biosystems). Allele size analysis was performed with 94.6%) harbored the Y132F mutation, which has already been Peak scanner software (Applied Biosystems) according to the associated with FLC resistance in C. parapsilosis (Table 7). In internal size standard GeneScan 500 ROX. addition, we found that 1 of the resistant isolates harbored Similarities between genotypes were visualized by construct­ the K143R mutation in the ERG11 gene, which has been detect­ ing a minimum spanning tree using InfoQuest FP, version 4.5 ed in azole-nonsusceptible strains causing monoclonal out­ (Applied Maths, St.-Martens-Latem, Belgium), treating the breaks in India [26], as well as in combination with the data as categorical information. Y132F mutation [11]. This mutation has also been associated with pan-azole resistance in C. tropicalis [27]. Another strain Data Analysis and Statistics harbored the G458S mutation, which has been related to azole MIC analysis was performed with SPSS software. For each year, resistance in Candida parapsilosis [4, 28]. Finally, many isolates the distribution of MICs was reported. We also calculated the harbored R398I (data not shown), but this mutation was also geometric mean of the MIC values, the median, and the mini­ found in several susceptible isolates, which suggest that it is mal and maximal values of the distributions. not related to FLC resistance. FLC Resistance in C. parapsilosis • OFID • 3 Table 2. Distribution of the Percentage of MICs to Fluconazole of C. parapsilosis Strains Received at the SMRL Since 2000 MIC, mg/L Susceptible Resistant I Year 0.125 0.25 0.5 1 2 4 8 16 32 64 >64 No. %S %I %R 2000 2 33 35 16 12 2 0 0 0 0 0 43 98 2 0 2001 1 30 53 12 1 3 0 0 0 0 0 74 97 3 0 2002 8 36 48 5 3 0 0 0 0 1 0 80 99 0 1 2003 11 40 41 5 1 0 1 1 0 0 0 115 98 0 2 2004 7 35 44 9 5 0 0 0 0 0 0 75 100 0 0 2005 18 41 32 6 1 0 0 0 1 0 0 82 99 0 1 2006 3 27 49 17 3 1 0 0 0 0 0 71 99 1 0 2007 3 24 56 8 6 0 1 0 0 0 1 71 97 0 3 2008 3 27 55 5 3 1 1 0 2 0 1 92 95 1 4 2009 0 12 78 4 0 0 4 1 0 0 0 73 95 0 5 2010 9 11 64 9 2 0 2 4 0 0 0 55 95 0 5 2011 5 14 59 14 0 0 9 0 0 0 0 22 91 0 9 2012 14 14 50 23 0 0 0 0 0 0 0 22 100 0 0 2013 0 14 57 21 0 0 7 0 0 0 0 14 93 0 7 2014 15 12 46 23 0 0 0 0 0 4 0 26 96 0 4 2015 0 2 61 37 0 0 0 0 0 0 0 46 100 0 0 2016 0 17 48 17 9 4 4 0 0 0 0 23 91 4 4 2017 9 22 39 4 4 4 4 9 4 0 0 23 78 4 17 2018 0 15 85 0 0 0 0 0 0 0 0 13 100 0 0 2019 13 7 7 13 7 7 0 26 7 0 13 15 47 7 46 2020 3 5 17 5 0 1 7 30 11 14 7 76 30 1 69 2021 3 13 12 1 4 3 10 36 11 5 1 204 33 3 64 The table includes the number of strains analyzed each year and the % of susceptible, susceptible increased exposure, and resistant isolates. Cells in orange: mode (most frequent value). In yellow: left and right values to the mode. Abbreviations: I, susceptible increased exposure; MIC, minimum inhibitory concentration; R, resistant; S, susceptible; SMRL, Spanish Mycology Reference Laboratory. Interestingly, in up to 35% of FNS strains, the Y132F substi­ strains), and respiratory samples (9.9% among FLC-S strains tution was found in heterozygosis. Thus, we analyzed if the tri­ and 11.64% among FLC-R/I strains). Among the susceptible azole MIC distribution differed among homozygous or isolates, we included strains from the same hospitals that had heterozygous strains. We observed that strains that harbored resistant strains, but also others not related to these outbreaks. the Y132F mutation in homozygosis had higher MICs to flucon­ Microsatellite genotyping identified 121 different genotypes. azole (geometric mean = 26.1 mg/L) compared with strains car­ The relationship between the obtained genotypes is illustrated rying the mutation in heterozygosis (geometric mean = 12.5). in Figures 1 and 2 and Supplementary Table 1. A similar situation was found for voriconazole (GM of heterozy­ As compared with the FNS isolates, genotypic variability was gous strains = 0.39 mg/L vs GM for homozygous strains = greater among fluconazole-susceptible strains, which could be 0.5 mg/L). The Y132F substitution did not have a significant attributed, in part, to the fact that most of the susceptible strains influence on susceptibility to isavuconazole, posaconazole, and were recovered from unrelated cases. itraconazole. Moreover, for these 3 antifungals, the Y132F Remarkably, in the case of contemporary resistant isolates, mutation in homozygosis tended to result in lower GM than there was a markedly well-defined geographical distribution in heterozygous strains (Table 8). of genotypes. Genotype 10 was found to be the dominant clus­ To investigate if there was any genetic correlation between ter among strains of 2 hospitals from the area of Barcelona the FNS strains, we performed a microsatellite-based genotyp­ (Bellvitge Universitary Hospital and Vall d’Hebron ing of 270 C. parapsilosis (from 2019, 2020, and 2021) isolates Universitary Hospital). This cluster was noted for the first from 234 different patients and 8 environmental strains, in­ time in 3 isolates from 1 of these 2 centers by 2019 (Bellvitge cluding 81 susceptible, 6 susceptible increased exposure (I), Universitary Hospital), and was also detected in a third center and 183 resistant isolates (fluconazole categorization). The ma­ of the metropolitan area of Barcelona that contributed with a jority of the strains were isolated from blood (38.3% among single isolate sent to the reference laboratory the same year. FLC-S strains and 44.4% among FLC-R/I strains), skin These 2 former hospitals also shared the closely related geno­ (13.6% among FLC-S strains and 20.1% among FLC-R/I type 12. Neither genotype 10 nor genotype 12 was found in 4 • OFID • Trevijano-Contador et al Table 3. Distribution of the Percentage of MIC to Voriconazole of C. parapsilosis Strains Received at the SMRL Since 2000 MIC, mg/L … … … … … Susceptible Resistant … I … … … … Year 0.016 0.031 0.06 0.125 0.25 0.5 1 2 4 8 >8 No. %S %I %R 2000 79 14 7 0 0 0 0 0 0 0 0 42 100 0 0 2001 73 23 1 3 0 0 0 0 0 0 0 74 100 0 0 2002 85 14 0 0 0 1 0 0 0 0 0 80 99 0 1 2003 88 11 0 1 0 0 0 0 0 0 0 94 100 0 0 2004 96 4 0 0 0 0 0 0 0 0 0 75 100 0 0 2005 93 6 0 0 1 0 0 0 0 0 0 82 99 1 0 2006 94 4 1 0 0 0 0 0 0 0 0 71 100 0 0 2007 89 6 4 0 0 0 0 0 0 0 1 71 99 0 1 2008 90 4 0 2 0 1 1 1 0 0 0 92 97 0 3 2009 89 5 1 3 1 0 0 0 0 0 0 73 99 1 0 2010 85 4 4 5 2 0 0 0 0 0 0 55 98 2 0 2011 86 9 0 5 0 0 0 0 0 0 0 22 100 0 0 2012 77 18 5 0 0 0 0 0 0 0 0 22 100 0 0 2013 79 14 0 7 0 0 0 0 0 0 0 14 100 0 0 2014 69 23 4 0 0 0 4 0 0 0 0 26 96 0 4 2015 89 9 0 2 0 0 0 0 0 0 0 46 100 0 0 2016 70 13 13 4 0 0 0 0 0 0 0 23 100 0 0 2017 57 26 0 9 0 4 4 0 0 0 0 23 91 0 9 2018 87 0 0 0 0 13 0 0 0 0 0 15 87 0 13 2019 27 26 0 0 7 20 7 13 0 0 0 15 53 7 40 2020 24 7 0 1 13 22 32 1 0 0 0 76 32 13 55 2021 28 2 3 5 25 27 7 1 1 0 0 204 38 25 37 The table includes the number of strains analyzed each year and the % of susceptible, susceptible increased exposure, and resistant isolates. Cells in orange: mode (most frequent value). In yellow: left and right values to the mode. Abbreviations: I, susceptible increased exposure; MIC, minimum inhibitory concentration; R, resistant; S, susceptible; SMRL, Spanish Mycology Reference Laboratory. centers from other regions in Spain. Genotype 96 was found to voriconazole received at the SMRL from several Spanish hospi­ be highly prevalent among isolates obtained from centers locat­ tals and arising in a relatively short period. These isolates seem ed in Madrid and Burgos (Castilla León Region). Genotype 67 to be part of outbreaks that have emerged almost simultane­ was found in a hospital in the north of Spain (Hospital Marqués ously in distant cities and that can be attributed to clones that de Valdecilla, Santander, Cantabria), geographically distant are shared almost exclusively among geographically close relat­ from Madrid and Barcelona. Interestingly, genotype 67 was ed centers. From these data, a generalized increment in flucon­ found in outbreaks from 2 distant hospitals, Son Espases azole resistance among Spanish isolates of C. parapsilosis cannot Hospital (Balearic Islands) and Marqués de Valdecilla be inferred as it is not mandatory to report all the infections Hospital (Santander, Cantabria). The outbreak in the Balearic caused by these species. All together, our data are in sharp con­ Islands has been previously described [29]. Additionally, trast to what has being described in several former epidemiolog­ fluconazole-susceptible strains isolated in the context of anoth­ ical studies carried out in Spain [6, 7, 30, 31], suggesting a new er nosocomial outbreak (Universitary Clinic Hospital from and worrisome change in the epidemiological incidence of FNS Valladolid) were received, displaying genotypes clearly differ­ C. parapsilosis strains. Furthermore, our work also suggests that ent from the abovementioned and closely related to each other there has been a dispersion of several genotypes between differ­ (genotypes 45–50). The geographical distribution of the geno­ ent hospitals from the same and different regions. In particular, types of the resistant strains is shown in Figure 1. genotype 10 has disseminated through different hospitals and A minimum spanning tree was built, showing that some ge­ Cataluña, genotype 96 was first found in Madrid and Burgos, notypes have evolved by spontaneous changes in one of the mi­ and genotype 67 was found in the Balearic Islands and crosatellite markers. The microsatellite analysis showed a Cantabria. Similar findings have recently been described from distribution of clades that grouped by geographic origin, with hospitals in Madrid [32]. When analyzing the sample isolation resistant strains clustering together (Figure 2). dates, our data suggest that the major clone that circulated in Our work shows a significant increase in the number of hospitals in Madrid disseminated to Burgos Hospital. Of inter­ C. parapsilosis samples resistant to fluconazole and est is the case of the hospitals in the Balearic Islands and FLC Resistance in C. parapsilosis • OFID • 5 Table 4. Distribution of the Percentage of MIC to Itraconazole of C. parapsilosis Strains Received at the SMRL Since 2000 MIC, mg/L Susceptible Resistant Year 0.016 0.031 0.06 0.125 0.25 0.5 1 2 4 8 >8 No. %S %R 2000 58 30 9 2 0 0 0 0 0 0 0 43 100 0 2001 30 55 11 4 0 0 0 0 0 0 0 74 100 0 2002 25 56 18 0 1 0 0 0 0 0 0 80 99 1 2003 50 36 12 1 0 1 0 0 0 0 0 115 99 1 2004 61 31 7 1 0 0 0 0 0 0 0 75 100 0 2005 52 41 6 0 0 0 0 0 0 0 0 82 100 0 2006 73 20 6 1 0 0 0 0 0 0 0 71 100 0 2007 63 25 8 1 0 0 0 0 0 0 1 71 99 1 2008 52 40 4 0 2 1 0 0 0 0 0 92 97 3 2009 78 21 0 1 0 0 0 0 0 0 0 73 100 0 2010 95 0 2 2 2 0 0 0 0 0 0 55 98 2 2011 86 9 5 0 0 0 0 0 0 0 0 22 100 0 2012 95 5 0 0 0 0 0 0 0 0 0 22 100 0 2013 71 29 0 0 0 0 0 0 0 0 0 14 100 0 2014 65 23 4 0 4 4 0 0 0 0 0 26 92 8 2015 72 28 0 0 0 0 0 0 0 0 0 46 100 0 2016 35 22 30 13 0 0 0 0 0 0 0 23 100 0 2017 26 35 22 9 9 0 0 0 0 0 0 23 91 9 2018 7 20 67 7 0 0 0 0 0 0 0 15 100 0 2019 7 13 33 40 7 0 0 0 0 0 0 15 93 7 2020 15 20 40 23 2 0 0 0 0 0 0 66 98 2 2021 23 28 22 20 6 1 1 0 0 0 0 204 89 11 Cells in orange: mode (most frequent value). In yellow: left and right values to the mode. Abbreviations: MIC, minimum inhibitory concentration; SMRL, Spanish Mycology Reference Laboratory. Santander (Cantabria), which are more distant than the rest of large numbers of health care professionals that were not prop­ the hospitals described in this work. In this case, since the out­ erly trained in infection control measures. Moreover, during break in Son Espases Hospital occurred in 2015 [29], we hypoth­ the pandemic, there were changes in personal protective equip­ esized that this clone was disseminated to Cantabria. ment protocols, and the same gloves could have been used be­ Recent emergence of FNS isolates in C. parapsilosis has been tween patients [33, 34]. This might have increased the risk of described in other countries in the literature [11–20], so our cross-transmission between patients and caused hospital out­ data support that the increase of azole resistance in C. parapsi­ breaks. Furthermore, during the pandemic, there has been a losis might be a global problem. In this study, the majority of significant transfer of patients and health care professionals be­ resistant isolates harbored the Y132F mutation, which has tween different hospitals, which might have contributed to the been largely associated in the literature with the appearance dispersion of resistant clones between clinical tertiary centers. of clonal outbreaks. However, we also detected a few isolates A similar situation has been described in multicenter studies that did not have this mutation. For this reason, further studies in India [26], which highlights the ability of FNS isolates to should be performed to describe all the resistance mechanisms spread and colonize hospital environments. Interestingly, circulating among Spanish hospitals. some of the analyzed strains in this work in 1 of the hospitals At the moment, the reasons for the increase in the incidence (Bellvitge Universitary Hospital) were isolated from an envi­ of azole-resistant C. parapsilosis strains in Spain are unknown, ronmental origin in the hospital, and we found that the most but we hypothesized that this phenomenon may be related to prevalent genotype obtained from patients in this hospital the negative impact that the COVID-19 pandemic has had in (genotype 10) was also present in different hospital locations. Spanish hospitals for several reasons. There seems to be a clear This correlation suggests that C. parapsilosis clones mighospi­ temporal correlation between the increase in the number of re­ tal surfaces, which increases the risk of recirculating among pa­ sistant isolates received at the reference laboratory and the clin­ tients and, in parallel, increases the risk of invasive infections ical impact of the pandemic. The COVID-19 pandemic has among the most fragile individuals. Previous studies, in fact, resulted in a severe overcrowding of hospitals and, in particu­ have shown not only an increased incidence of C. parapsilosis lar, of intensive care units, along with the necessity of recruiting infections in COVID-19 patients [35], but also other fungal 6 • OFID • Trevijano-Contador et al Table 5. Distribution of the Percentage of MIC to Posaconazole of C. parapsilosis Strains Received at the SMRL Since 2000 MIC, mg/L Susceptible Resistant Year 0.016 0.031 0.06 0.125 0.25 0.5 1 2 4 8 >8 No. %S %R 2001 55 45 0 0 0 0 0 0 0 0 0 11 100 0 2002 65 31 4 0 0 0 0 0 0 0 0 80 100 0 2003 80 19 1 0 0 0 0 0 0 0 0 94 100 0 2004 83 17 0 0 0 0 0 0 0 0 0 75 100 0 2005 65 33 2 0 0 0 0 0 0 0 0 82 100 0 2006 87 13 0 0 0 0 0 0 0 0 0 70 100 0 2007 87 11 0 0 0 0 0 0 1 0 0 71 99 1 2008 70 26 1 1 1 1 0 0 0 0 0 92 97 3 2009 81 19 0 0 0 0 0 0 0 0 0 73 100 0 2010 74 20 2 2 2 0 0 0 0 0 0 54 96 4 2011 95 5 0 0 0 0 0 0 0 0 0 22 100 0 2012 91 9 0 0 0 0 0 0 0 0 0 22 100 0 2013 93 7 0 0 0 0 0 0 0 0 0 14 100 0 2014 92 4 4 0 0 0 0 0 0 0 0 26 100 0 2015 78 20 2 0 0 0 0 0 0 0 0 46 100 0 2016 22 52 22 4 0 0 0 0 0 0 0 23 96 4 2017 26 57 13 4 0 0 0 0 0 0 0 23 96 4 2018 13 47 33 7 0 0 0 0 0 0 0 15 93 7 2019 13 41 33 13 0 0 0 0 0 0 0 15 87 13 2020 33 45 20 2 0 0 0 0 0 0 0 76 98 2 2021 23 38 20 12 4 2 1 0 0 0 0 204 81 19 Cells in orange: mode (most frequent value). In yellow: left and right values to the mode. Abbreviations: MIC, minimum inhibitory concentration; SMRL, Spanish Mycology Reference Laboratory. Table 6. Distribution of the Percentage of MIC to Isavuconazole of C. parapsilosis Strains Received at the SMRL Since 2016 MIC, mg/L … … Year 0.016 0.031 0.06 0.125 0.25 0.5 1 2 4 8 >8 No. 2016 86 14 0 0 0 0 0 0 0 0 0 7 2017 75 15 5 0 5 0 0 0 0 0 0 20 2018 87 7 7 0 0 0 0 0 0 0 0 15 2019 53 13 7 13 7 7 0 0 0 0 0 15 2020 39 14 39 8 0 0 0 0 0 0 0 72 2021 38 23 29 7 2 1 1 0 0 0 0 196 Cells in orange: mode (most frequent value). In yellow: left and right values to the mode. Abbreviations: MIC, minimum inhibitory concentration; SMRL, Spanish Mycology Reference Laboratory. Table 7. Mutations in the ERG11 Gene Found in Susceptible, Susceptible Increased Exposure, and Resistant Strains to Fluconazole FLC Susceptible Increased Exposure FLC Resistant ERG11 Mutation FLC Susceptible … VOR_S VOR_S VOR_I VOR_R VOR_S VOR_I VOR_R WT 34 1 1 0 5 1 6 Y132F_HET 0 3 1 0 1 17 38 Y132F_HOMO 0 0 0 1 5 39 88 For each category, we also include the susceptibility profile (S/I/R) for voriconazole. Abbreviations: HET, heterozygous; HOMO, homozygous; I, susceptible increased exposure; MIC, minimum inhibitory concentration; R, resistant; S, susceptible; SMRL, Spanish Mycology Reference Laboratory. FLC Resistance in C. parapsilosis • OFID • 7 Table 8. Susceptibility Profile of WT or Mutant Strains Harboring the Y132F in Homozygosity or Heterozygosity Antifungal Susceptibility, mg/L … … … Antifungal ERG11 Mutation No. Median Geometric Mean Minimal Maximal Fluconazole WT 43 0.5 0.78 0.125 >64 Y132F_HET 60 16 12.7 4 32 Y132F_HOM 120 16 25 8 >64 Voriconazole WT 43 0.031 0.032 0.016 4 Y132F_HET 60 0.5 0.4 0.125 1 Y132F_HOM 120 0.5 0.5 0.06 2 Itraconazole WT 43 0.03 0.033 0.016 1 Y132F_HET 60 0.125 0.10 0.031 0.25 Y132F_HOM 120 0.06 0.05 0.016 0.25 Posaconazole WT 43 0.03 0.029 0.016 0.25 Y132F_HET 60 0.06 0.065 0.016 0.5 Y132F_HOM 120 0.031 0.035 0.016 0.25 Isavuconazole WT 43 0.016 0.021 0.016 1 Y132F_HET 60 0.06 0.07 0.031 0.125 Y132F_HOM 120 0.031 0.037 0.016 0.5 Abbreviation: WT, wild-type. Figure 1. Geographical distribution of the different genotypes of FLC-resistant isolates. The pie charts denote the distribution of the different genotypes in different tertiary hospitals from different metropolitan areas in Spain. Abbreviation: FLC, fluconazole. Template of the map of Spain was obtained from a free repository (https://es.m.wiki­ pedia.org/wiki/Archivo:Provinces_of_Spain_%28Blank_map%29.png) and its use and modification is allowed according to the GNU Free Documentation License, version 1.2. 8 • OFID • Trevijano-Contador et al Figure 2. Minimal spanning tree showing the genetic proximity of susceptible and FLC-resistant isolates from Candida parapsilosis. The numbers denote the genotype identified in each group. Straight bold lines denote groups that only differentiate in 1 marker. These groups are highlighted with the color shadows in the background. Orange: resistant strains; green: susceptible strains; blue: susceptible increased exposure (I ) strains. For the origin and a description of the strains in each genotype, see Supplementary Table 1. Abbreviation: FLC, fluconazole. Table 9. General Fluconazole and Voriconazole Use (Expressed and simultaneously in distant places across Spain. An increase in Defined Daily Doses per 100 Patients Days) in Several Hospitals From the use of antimicrobials has been reported since the appear­ Different Geographical Regions From 2018 to 2021 ance of the COVID-19 pandemic in some geographical regions [46]. Among azoles, an increase in the use of echinocandins and … … 2018 2019 2020 2021 voriconazole has been reported [46], which might have favored Vall d’Hebron University Fluconazole 3.94 2.68 1.98 2.43 Hospitala the selection of fluconazole and voriconazole-resistant C. para­ Voriconazole 0.96 0.56 0.76 1.08 psilosis. To validate this hypothesis, we were able to obtain 12 de Octubre Hospital Fluconazole 2.21 2.31 3.05 2.56 data on fluconazole and voriconazole use from some of the hos­ Voriconazole 0.26 0.4 0.34 0.32 pitals, and, as shown in Table 9, there was not a significant in­ Marqués de Valdecilla Fluconazole 2.16 2.11 2.24 1.94 crease in the use of fluconazole. A similar trend was found for University Hospital voriconazole use, although 2 hospitals (Burgos Universitary Voriconazole 1.12 1.29 1.99 1.63 Hospital and Bellvitge Universitary Hospital) reported an in­ Burgos University Hospital Fluconazole 3.73 3.98 4.26 2.74 crease of around 2-fold in the use of this last antifungal. Voriconazole 0.39 0.13 0.22 0.55 These data suggest that the increase in the incidence of FNS Móstoles University Hospital Fluconazole 2.41 2.24 3.30 3.37 Voriconazole 0.75 0.73 0.69 0.64 strains from C. parapsilosis has not been mainly driven by the Puerta de Hierro University Fluconazole 3.75 2.83 4.5 4.12 selective pressure of the antifungal use. In agreement, no corre­ Hospital lation between previous azole treatment and infection by FNS Voriconazole 0.48 0.53 0.47 0.47 C. parapsilosis strains has been found in the outbreaks from Bellvitge University Hospital Fluconazole 1.61 1.46 1.89 1.53 Son Espases Universitary Hospital (Balearic Islands) and Voriconazole 0.38 0.3 0.55 0.71 a Data from use in the intensive care unit. Puerta de Hierro Universitary Hospital (Madrid) [29, 47]. Another possibility is that resistance to azoles affects viru­ lence traits. In this sense, it has been described that C. parapsi­ diseases, such as COVID-associated pulmonary aspergillosis losis strains harboring the Y132F mutation in ERG11 have (CAPA) [36–38], mucormycosis [39–41], and Candida infec­ reduced ability to form biofilms [11], which raises the hypoth­ tions [42, 43] (see reviews in [44, 45]). esis that these strains have a greater ability to spread and dis­ The impact of the COVID-19 pandemic and clinical man­ seminate. Furthermore, several studies have associated the agement of COVID patients does not fully explain why there incidence of resistant strains with higher mortality of the pa­ has been a selection of azole-resistant strains and why these ge­ tients [11, 28], which warrants further studies on the virulence netically different resistant strains have emerged almost of FLC-nonsusceptible C. parapsilosis strains. In our case, the FLC Resistance in C. parapsilosis • OFID • 9 clinical management of the patients might have contributed to CIBERES-CB06/06/0037 (C.A.-T.), and CIBERES-CB06/06/0058 (J.G). L.A.-F. was supported by Fondo de Investigación Sanitaria (MPY 117/18 the selection of preexisting resistant clones circulating in the and MPY 305/20). We thank Dr. David Campany Herrero (Vall hospitals before the COVID-19 pandemic [47]. In our case, d’Hebron Hospital), Noelia Garrido Peño (Móstoles Hospital), David this idea is supported by the fact that we identified that some Gómez Gómez y Aitziber Illaro Uranga (Marqués de Valdecilla of the resistant clones were already detected in samples from Hospital), María Ángeles Machín Morón (Burgos Hospital), Jose Manuel Caro Teller (Doce de Octubre Hospital), Marina Calvo (Puerta de Hierro 2019 (ie, Bellvitge Hospital) and also in some strains present Hospital), and Ariadna Padulles (Bellvitge Hospital) for providing the in our collection from 2019 from the same geographical region. data on antifungal consumption from their hospitals. We also thank For this reason, future research to investigate the genetic prox­ Ángel Zaballos and Pilar Jiménez from the Genomics Core Facility from Instituto de Salud Carlos III for their technical help with the microsatellite imity of the resistant isolates is needed, and to compare them analysis technique. not only between different hospitals but also with isolates de­ Potential conflicts of interest. All authors report no potential conflicts. scribed in different countries. All authors have submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest. Conflicts that the editors consider relevant to the con­ Despite the epidemiological limitations and interpretations tent of the manuscript have been disclosed. of our work, we believe that the data presented herein are an Patient consent. This study does not include factors necessitating patient indicator of an emerging clinical problem, that is, the selection consent. of azole resistance in C. parapsilosis during the COVID-19 pan­ demic. In particular, we report the appearance of a significant References 1. Toth R, Nosek J, Mora-Montes HM, et al. Candida parapsilosis: from genes to the increase in the resistance rate to fluconazole and voriconazole bedside. Clin Microbiol Rev 2019; 32:e00111–18. simultaneously in multiple hospitals in Spain. This increase 2. Pfaller MA, Diekema DJ, Turnidge JD, Castanheira M, Jones RN. Twenty years of has a temporal correlation with the COVID-19 pandemic, sug­ the SENTRY antifungal surveillance program: results for Candida species from 1997–2016. Open Forum Infect Dis 2019; 6:S79–94. gesting that the increased incidence of FNS C. parapsilosis 3. Lamoth F, Lockhart SR, Berkow EL, Calandra T. Changes in the epidemiological strains is a consequence of the impact of the pandemic. We landscape of invasive candidiasis. J Antimicrob Chemother 2018; 73:i4–13. 4. Arastehfar A, Lass-Florl C, Garcia-Rubio R, et al. The quiet and underappreciated also present data that indicate that there has been a dissemina­ rise of drug-resistant invasive fungal pathogens. J Fungi (Basel) 2020; 6:138. tion of some genotypes between hospitals, not only from the 5. Yamin DH, Husin A, Harun A. Risk factors of Candida parapsilosis catheter- related bloodstream infection. Front Public Health 2021; 9:631865. same cities but from different geographical regions, and despite 6. Puig-Asensio M, Padilla B, Garnacho-Montero J, et al. Epidemiology and predic­ the clonal diversity documented, only a few of them dominated tive factors for early and late mortality in Candida bloodstream infections: a population-based surveillance in Spain. Clin Microbiol Infect 2014; 20:O245–54. across centers. We would like to note that the increase in 7. Guinea J, Zaragoza O, Escribano P, et al. Molecular identification and antifungal FLC-resistant isolates in tertiary hospitals in Spain is agreement susceptibility of yeast isolates causing fungemia collected in a population-based with the worldwide context, where an increasing number of study in Spain in 2010 and 2011. Antimicrob Agents Chemother 2014; 58: 1529–37. outbreaks caused by FNS C. parapsilosis strains are being re­ 8. Iatta R, Caggiano G, Cuna T, Montagna MT. Antifungal susceptibility testing of a ported. Our work highlights the importance of national surveil­ 10-year collection of Candida spp. isolated from patients with candidemia. J Chemother 2011; 23:92–6. lance programs carried out by reference laboratories to detect 9. Ziccardi M, Souza LO, Gandra RM, et al. Candida parapsilosis (sensu lato) isolat­ epidemiological changes and to characterize outbreaks, espe­ ed from hospitals located in the southeast of Brazil: species distribution, antifun­ gal susceptibility and virulence attributes. Int J Med Microbiol 2015; 305:848–59. cially those that involve the selection of microbial-resistant iso­ 10. Battistolo J, Glampedakis E, Damonti L, et al. Increasing morbidity and mortality lates. We encourage the clinical community to investigate the of candidemia over one decade in a Swiss university hospital. Mycoses 2021; 64: 1512–20. presence of these clones in the hospital environment, to make 11. Arastehfar A, Daneshnia F, Hilmioglu-Polat S, et al. First report of candidemia an effort to perform susceptibility testing in strains of noninva­ clonal outbreak caused by emerging fluconazole-resistant Candida parapsilosis sive origins (colonization, isolated from hospital surfaces, etc.), isolates harboring Y132F and/or Y132F + K143R in Turkey. Antimicrob Agents Chemother 2020; 64:e01001–20. and to design specific measures to prevent the expansion of the 12. Choi YJ, Kim YJ, Yong D, et al. Fluconazole-resistant Candida parapsilosis blood­ associated resistance mechanisms. stream isolates with Y132F mutation in ERG11 gene, South Korea. Emerg Infect Dis 2018; 24:1768–70. 13. Corzo-Leon DE, Peacock M, Rodriguez-Zulueta P, Salazar-Tamayo GJ, MacCallum Supplementary Data DM. General hospital outbreak of invasive candidiasis due to azole-resistant Supplementary materials are available at Open Forum Infectious Diseases Candida parapsilosis associated with an Erg11 Y132F mutation. Med Mycol 2021; online. Consisting of data provided by the authors to benefit the reader, the 59:664–71. posted materials are not copyedited and are the sole responsibility of the 14. Fekkar A, Blaize M, Bougle A, et al. Hospital outbreak of fluconazole-resistant Candida parapsilosis: arguments for clonal transmission and long-term persis­ authors, so questions or comments should be addressed to the correspond­ tence. Antimicrob Agents Chemother 2021; 65:e02036–20. ing author. 15. Govender NP, Patel J, Magobo RE, et al. Emergence of azole-resistant Candida parapsilosis causing bloodstream infection: results from laboratory-based sentinel Acknowledgments surveillance in South Africa. J Antimicrob Chemother 2016; 71:1994–2004. Financial support. O.Z. was funded by grants SAF2017–86912-R and 16. Martini C, Torelli R, de Groot T, et al. Prevalence and clonal distribution of azole-resistant Candida parapsilosis isolates causing bloodstream infections in a PID2020–114546RB-I00 from the Spanish Ministry for Science and large Italian hospital. Front Cell Infect Microbiol 2020; 10:232. Innovation. This work was also funded by the National Centre for 17. Mesini A, Mikulska M, Giacobbe DR, et al. Changing epidemiology of candidae­ Microbiology (Instituto de Salud Carlos III) through the Surveillance mia: increase in fluconazole-resistant Candida parapsilosis. Mycoses 2020; 63: Program of Antifungal Resistance and the Center for Biomedical 361–8. Research in Network of Infectious Diseases CIBERINFECTCB21/13/ 18. Demirci-Duarte S, Arikan-Akdagli S, Gulmez D. Species distribution, azole resis­ 00105 (O.Z. and L.A.F.), CIBERINFEC-CB21/13/00009 (M.P.-A.), tance and related molecular mechanisms in invasive Candida parapsilosis 10 • OFID • Trevijano-Contador et al complex isolates: increase in fluconazole resistance in 21 years. Mycoses 2021; 64: harboring the Y132F ERG11p substitution. Antimicrob Agents Chemother 823–30. 2022; 66:e0071022. 19. Thomaz DY, de Almeida JN Jr, Lima GME, et al. An azole-resistant Candida para­ 33. Sturdy A, Basarab M, Cotter M, et al. Severe COVID-19 and healthcare-associated psilosis outbreak: clonal persistence in the intensive care unit of a Brazilian teach­ infections on the ICU: time to remember the basics? J Hosp Infect 2020; 105: ing hospital. Front Microbiol 2018; 9:2997. 593–5. 20. Thomaz DY, Del Negro GMB, Ribeiro LB, et al. A Brazilian inter-hospital candi­ 34. Abelenda-Alonso G, Puig-Asensio M, Jimenez-Martinez E, et al. Impact of the demia outbreak caused by fluconazole-resistant Candida parapsilosis in the COVID-19 pandemic on infection control practices in a university hospital. COVID-19 era. J Fungi (Basel) 2022; 8:100. Infect Control Hosp Epidemiol 2022; 20:1–3. 21. Grossman NT, Pham CD, Cleveland AA, Lockhart SR. Molecular mechanisms of 35. Cultrera R, Barozzi A, Libanore M, et al. Co-infections in critically ill patients with fluconazole resistance in Candida parapsilosis isolates from a U. S. surveillance or without COVID-19: a comparison of clinical microbial culture findings. Int J system. Antimicrob Agents Chemother 2015; 59:1030–7. Environ Res Public Health 2021; 18:4358. 22. Thomaz DY, de Almeida JN Jr, Sejas ONE, et al. Environmental clonal spread of 36. Chong WH, Neu KP. Incidence, diagnosis and outcomes of COVID-19- azole-resistant Candida parapsilosis with Erg11-Y132F mutation causing a large associated pulmonary aspergillosis (CAPA): a systematic review. J Hosp Infect candidemia outbreak in a Brazilian cancer referral center. J Fungi (Basel) 2021; 2021; 113:115–29. 7:259. 37. Thompson Iii GR, Cornely OA, Pappas PG, et al. Invasive aspergillosis as an 23. White T, Bruns T, Lee S, Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA Gefland DH Sninsky JJ, and under-recognized superinfection in COVID-19. Open Forum Infect Dis 2020; White TJ, eds. PCR Protocols: A Guide to Methods and Applications. Academic 7:ofaa242. Press; 1990:315–322. 38. Bartoletti M, Pascale R, Cricca M, et al. Epidemiology of invasive pulmonary as­ 24. Arendrup MC, Meletiadis J, Mouton JW, et al. EUCAST technical note on isavu­ pergillosis among COVID-19 intubated patients: a prospective study. Clin Infect conazole breakpoints for Aspergillus, itraconazole breakpoints for Candida and Dis 2021; 73:e3606–14. updates for the antifungal susceptibility testing method documents. Clin 39. Singh K, Kumar S, Shastri S, Sudershan A, Mansotra V. Black fungus immuno­ Microbiol Infect 2016; 22:571 e1–4. suppressive epidemic with COVID-19 associated mucormycosis (zygomycosis): 25. Diab-Elschahawi M, Forstner C, Hagen F, et al. Microsatellite genotyping clarified a clinical and diagnostic perspective from India. Immunogenetics 2022; 74: conspicuous accumulation of Candida parapsilosis at a cardiothoracic surgery in­ 197–206. tensive care unit. J Clin Microbiol 2012; 50:3422–6. 40. Ravindra K, Ahlawat A. Five probable factors responsible for COVID-associated 26. Singh A, Singh PK, de Groot T, et al. Emergence of clonal fluconazole-resistant mucormycosis outbreak in India. Int J Infect Dis 2021; 112:278–80. Candida parapsilosis clinical isolates in a multicentre laboratory-based surveil­ 41. Sahu RK, Salem-Bekhit MM, Bhattacharjee B, et al. Mucormycosis in Indian lance study in India. J Antimicrob Chemother 2019; 74:1260–8. COVID-19 patients: insight into its patho-genesis. Clinical manifestation, and 27. Xisto MI, Caramalho RD, Rocha DA, et al. Pan-azole-resistant Candida tropicalis management strategies. Antibiotics (Basel) 2021; 10:1079. carrying homozygous erg11 mutations at position K143R: a new emerging super­ 42. Segrelles-Calvo G, de S Araújo GR, Llopis-Pastor E, et al. Candida spp. co- bug? J Antimicrob Chemother 2017; 72:988–92. infection in COVID-19 patients with severe pneumonia: prevalence study and as­ 28. Arastehfar A, Hilmioglu-Polat S, Daneshnia F, et al. Clonal candidemia outbreak sociated risk factors. Respir Med 2021; 188:106619. by Candida parapsilosis carrying Y132F in Turkey: evolution of a persisting chal­ 43. Arastehfar A, Carvalho A, Nguyen MH, et al. COVID-19-associated candidiasis lenge. Front Cell Infect Microbiol 2021; 11:676177. (CAC): an underestimated complication in the absence of immunological predis­ 29. Alcoceba E, Gomez A, Lara-Esbri P, et al. Fluconazole-resistant Candida parapsi­ positions? J Fungi (Basel) 2020; 6:211. losis clonally related genotypes: first report proving the presence of endemic iso­ 44. Roudbary M, Kumar S, Kumar A, Cernakova L, Nikoomanesh F, Rodrigues CF. lates harbouring the Y132F ERG11 gene substitution in Spain. Clin Microbiol Overview on the prevalence of fungal infections, immune response, and micro­ Infect 2022; 28:1113–9. 30. Peman J, Canton E, Quindos G, et al. Epidemiology, species distribution and in biome role in COVID-19 patients. J Fungi (Basel) 2021; 7:720. vitro antifungal susceptibility of fungaemia in a Spanish multicentre prospective 45. Abdoli A, Falahi S, Kenarkoohi A. COVID-19-associated opportunistic infec­ survey. J Antimicrob Chemother 2012; 67:1181–7. tions: a snapshot on the current reports. Clin Exp Med 2022; 22:327–46. 31. Canton E, Peman J, Quindos G, et al. Prospective multicenter study of the epide­ 46. Grau S, Hernandez S, Echeverria-Esnal D, et al. Antimicrobial consumption miology, molecular identification, and antifungal susceptibility of Candida para­ among 66 acute care hospitals in Catalonia: impact of the COVID-19 pandemic. psilosis, Candida orthopsilosis, and Candida metapsilosis isolated from patients Antibiotics (Basel) 2021; 10:943. with candidemia. Antimicrob Agents Chemother 2011; 55:5590–6. 47. Ramos-Martinez A, Pintos-Pascual I, Guinea J, et al. Impact of the COVID-19 32. Diaz-Garcia J, Gomez A, Alcala L, et al. Evidence of fluconazole-resistant Candida pandemic on the clinical profile of candidemia and the incidence of fungemia parapsilosis genotypes spreading across hospitals located in Madrid, Spain and due to fluconazole-resistant Candida parapsilosis. J Fungi (Basel) 2022; 8:451. FLC Resistance in C. parapsilosis • OFID • 11