RESEARCH ARTICLE https://doi.org/10.1158/2767-9764.CRC-22-0037 OPEN ACCESS Repurposing Itraconazole and Check for updates Hydroxychloroquine to Target Lysosomal Homeostasis in Epithelial Ovarian Cancer Stefano Marastoni1 , Ainhoa Madariaga2,3 , Aleksandra Pesic1 , Sree Narayanan Nair1 , Zhu Juan Li1 , Zvi Shalev1 , Troy Ketela1 , Ilaria Colombo2 , Victoria Mandilaras2 , Michael Cabanero4 , Jeff P. Bruce1 , Xuan Li2 , Swati Garg2 , Lisa Wang2 , Eric X. Chen2 , Sarbjot Gill2 , Neesha C. Dhani2 , Wenjiang Zhang2 , Melania Pintilie5 , Valerie Bowering2 , Marianne Koritzinsky1,6,7,8 , Robert Rottapel1 , Bradly G. Wouters1,7,8 , Amit M. Oza2 , Anthony M. Joshua1,9,10 , and Stephanie Lheureux2 ABSTRACT Drug repurposing is an attractive option for oncology drug develop- Bliss defined synergy in EOC cancer cell lines. Furthermore, there was ment. Itraconazole is an antifungal ergosterol synthesis inhibitor that has an association of cytotoxic synergy with the ability to induce functional pleiotropic actions including cholesterol antagonism, inhibition of Hedge- lysosome dysfunction, by chloroquine. Within the clinical trial, 11 patients hog and mTOR pathways. We tested a panel of 28 epithelial ovarian cancer received at least one cycle of itraconazole and hydroxychloroquine. Treat- (EOC) cell lines with itraconazole to define its spectrum of activity. To iden- ment was safe and feasible with the recommended phase II dose of 300 tify synthetic lethality in combination with itraconazole, a whole-genome and 600 mg twice daily, respectively. No objective responses were detected. drop-out genome-scale clustered regularly interspaced short palindromic Pharmacodynamic measurements on serial biopsies demonstrated limited repeats sensitivity screen in two cell lines (TOV1946 and OVCAR5) was pharmacodynamic impact. In vitro, itraconazole and chloroquine have syn- performed. On this basis, we conducted a phase I dose-escalation study ergistic activity and exert a potent antitumor effect by affecting lysosomal assessing the combination of itraconazole and hydroxychloroquine in pa- function. The drug combination had no clinical antitumor activity in dose tients with platinum refractory EOC (NCT03081702). We identified a wide escalation. spectrum of sensitivity to itraconazole across the EOC cell lines. Pathway Significance: The combination of the antifungal drug itraconazole with analysis showed significant involvement of lysosomal compartments, the antimalarial drug hydroxychloroquine leads to a cytotoxic lysosomal trans-golgi network and late endosomes/lysosomes; similar pathways are dysfunction, supporting the rational for further research on lysosomal phenocopied by the autophagy inhibitor, chloroquine. We then demon- targeting in ovarian cancer. strated that the combination of itraconazole and chloroquine displayed advanced EOC is multimodal; integrating surgery, platinum-based chemother- Introduction apy and maintenance therapy, which are tailored according to histologic Epithelial ovarian cancer (EOC) is the most lethal gynecologic malignancy subtype, stage, and patient characteristics. Contemporary systemic treat- in developed countries (1). It consists of five subtypes—high- and low-grade ments in recurrent EOC include chemotherapy, antiangiogenic agents and serous, endometrioid, clear cell, and mucinous carcinomas (2). Treatment for PARP inhibitors (3). Ultimately, platinum-resistant EOC—defined as disease S. Marastoni and A. Madariaga contributed equally as co-first authors of this article. 1 Princess Margaret Cancer Centre, University Health Network, Toronto, Ontario, Canada. 2 Division of Medical Oncology & Hematology, Princess Margaret Cancer A.M. Joshua and S. Lheureux contributed equally as co-senior authors of this Centre, Toronto, Ontario, Canada. 3 Autonomous University of Barcelona, article. Barcelona, Spain. 4 Department of Pathology, Toronto General Hospital, Toronto, Corresponding Author: Anthony M. Joshua. Kinghorn Cancer Centre, Department Ontario, Canada. 5 Department of Biostatistics, Princess Margaret Cancer Centre, of Medical Oncology, St Vincents Hospital, Sydney, Australia. Phone: University Health Network, Toronto, Ontario, Canada. 6 Institute of Medical Science, 612-9355-5655; E-mail: anthony.joshua@svha.org.au University of Toronto, Toronto, Ontario, Canada. 7 Department of Medical doi: 10.1158/2767-9764.CRC-22-0037 Biophysics, University of Toronto, Toronto, Ontario, Canada. 8 Department of Radiation Oncology, University of Toronto, Toronto, Ontario, Canada. 9 Kinghorn This open access article is distributed under the Creative Commons Attribution 4.0 Cancer Centre, Department of Medical Oncology, St Vincents Hospital, Sydney, International (CC BY 4.0) license. Australia. 10 Garvan Institute of Medical Research, Sydney, Australia. © 2022 The Authors; Published by the American Association for Cancer Research AACRJournals.org Cancer Res Commun; 2(5) May 2022 293 Marastoni et al. progression occurring in <6 months from last dose of platinum—remains an bination of itraconazole and hydroxychloroquine in a phase I clinical trial in aggressive disease with limited effective treatment options, and a response to platinum-resistant EOC (NCT03081702). chemotherapy of approximately 10%–15% (3, 4). An emerging strategy to expand the therapeutic armamentarium against ovar- Materials and Methods ian cancer is drug repurposing. A widely used antifungal drug, itraconazole Cell Lines and Cell Culture has been investigated in several cancer types (5–7). The current understanding Ovarian cancer cells were kindly provided by Dr. Rottapel in 2015 (orig- of the mechanisms of action of itraconazole include: (i) potent antiangio- inally obtained by Ben Neel, Graham Fletcher, Anne-Marie Mes-Massons, genic and antilymphangiogenic activity (8, 9), (ii) modulating Hedgehog and Patricia Tonin, Gordon Millsand James Brenton) and were cultured in ei- Wnt/β-catenin signaling (10, 11), (iii) inhibiting the mitochondrial protein ther OSE (Wisent), RPMI1640 supplemented with 10 mmol/L HEPES (Life voltage-dependent anion channel 1 (VDAC1) (12), and (iv) altering choles- Technologies), DMEM (Life Technologies), or DMEM/F12 (Wisent), with terol trafficking by direct binding and inhibition of the lysosomal protein and 10% FBS (Gibco), depending on the cell type, as reported previously (28). cholesterol transporter Niemann–Pick disease, type C1 (NPC1; ref. 13). These More detailed information is provided in the Supplementary Materials and latter two effects have been demonstrated to result in inhibition of the mTOR Methods. HEK293T cells were obtained in 2013 from ATCC (CRL-3216, pathway (14). A number of preclinical and clinical studies have suggested that RRID:CVCL_0063). All cell lines were cultured at 37°C in a 5% CO2 hu- patients with prostate, lung, and basal cell carcinoma may benefit from treat- midified incubator and were cultured for a maximum of 15 passages. Regular ment with itraconazole monotherapy or in combination with chemotherapy (5– cell-line authentication was done at The Centre for Applied Genomics (TCAG, 7, 15–17). In platinum-resistant EOC, two retrospective studies in patients with http://www.tcag.ca) using the GenePrint10 System (Promega Corporation) ac- recurrent ovarian cancer have suggested the beneficial effects of itraconazole cording to the manufacturer’s instructions. All cell lines were routinely tested to in combination with taxane-based chemotherapy (18, 19). We were stimulated confirm the absence of Mycoplasma using the Mycoalert Detection Kit (Lonza). to understand which pathways can be targeted to increase itraconazole efficacy and pursue more potent combinations. Antibodies, Drugs, and Reagents Recently, genome-scale clustered regularly interspaced short palindromic re- Anti-Cas9 (sc-517386, RRID:AB_2800509) antibody was purchased from peats (CRISPR)-Cas9–based screens have proven to be a valuable and robust Santa Cruz Biotechnology. Anti-beta Tubulin (ab6046, RRID:AB_2210370) approach to uncovering novel understanding of cell biology and drug discovery. antibody, anti-p62 (ab56416, RRID:AB_945626) were purchased from Ab- Chemogenetic profiling using CRISPR-Cas9 screens performed in combination cam. Anti-eIF4E (#610270, RRID:AB_397665) was purchased from BD with small-molecule inhibitors allows the identification of gene abnormalities Biosciences. Anti-LAMP1 (#9091, RRID:AB_2687579), anti-Rab7 (#9367, that enhance or suppress the activity of chemical compounds. This knowledge RRID:AB_1904103) and anti-CC3 (#9661, RRID:AB_2341188) were pur- provides understandings into drug mechanism of action, genetic vulnerabili- chased from Cell Signaling Technology. Anti-VPS antibody (#13327-1-AP, ties, and resistance mechanisms, all of which help stratify patients and improve RRID:AB_2304414) was purchased from Proteintech. Anti-Ki-67 (clone: MIB1, drug efficacy (20). Using this approach, we defined genomic targets associated M7240, RRID:AB_2142367) was purchased from Agilent Dako. with lysosomal function and dynamics as sensitizing ovarian cancer cells to Secondary antibodies used for Western blotting were purchased from Licor. nontoxic concentrations of itraconazole. Secondary antibodies used from immunofluorescence, Hoechst (NucBlue Live Lysosomes are membrane-enclosed intracellular organelles that are fundamen- Ready Probes) and DAPI were purchased from Thermo Fisher Scientific. tal for cellular homeostasis, specifically the degradation of proteins that have Itraconazole and chloroquine were purchased from Sigma-Aldrich. Alamar been internalized by cells through endocytosis and phagocytosis. During en- blue cell viability reagent was purchased from Thermo Fisher Scientific. In- dosomal maturation to lysosomes, hydrolases are produced in the endoplasmic cucyte Caspase-3/7 Green Dye for Apoptosis was purchases from Sartorius reticulum (ER) and transported to the Golgi apparatus, where they receive the (Essen Bioscience, #4440). Puromycin and blasticidin solutions were purchased lysosomal-targeted mannose-6-phosphate (M6P) tag (21, 22). In the maturation from Invivogen. process, the compartmental pH drops, and more than 50 acid hydrolases are ac- tivated, maintained by the action of vacuolar H+ -ATPase, to degrade molecules Filipin III from Streptomyces filipinensis reagent (F4767-5MG) was purchased delivered via endocytic, phagocytic, and autophagic pathways (22, 23). Lyso- from Sigma-Aldrich. Lysosomal Intracellular Activity Assay Kit was purchased some homeostasis is an attractive target for cancer therapy as lysosomes have from Biovision. Polybrene Infection/Transfection reagent was purchased from been reported to be associated with chemoresistance, survival under physio- Milllipore. The QIAamp Blood Maxi Kit used for genomic isolation of CRISPR logic stress, increased invasion and metastasis and cancer progression (22–24). screen samples was purchased from QIAGEN. Interestingly, high expression of the lysosome-associated membrane protein- Genomic DNA (gDNA) isolation kit was purchased from Norgen Biotech Corp. 1 (LAMP1) has been reported as a poor prognostic marker in patients with High-fidelity master mix used for PCR was purchased from New England Bi- EOC (25). olabs. All-Prep DNA/RNA/miRNA universal Co-Isolation kit was purchased Among several drugs that target lysosomes, only hydroxychloroquine is be- from QIAGEN. UltraView Detection Kit was purchased from Vantana. ing currently examined in clinical trials for cancer (23). Chloroquine, and its derivative hydroxychloroquine, accumulate in acidic compartments of the cells, CRISPR Screen increasing the pH leading to hydrolase inhibition and lysosomal dysfunction To produce the whole-genome single-guide RNA (sgRNA) library with TKOV1 (22, 23, 26, 27). We found that nontoxic concentrations of chloroquine increase lentivirus (29), 293T cells were transfected with psPAX2 (lentiviral packaging; the cytotoxic effects of itraconazole in EOC. We thereafter explored the com- Addgene #12260), pMD2.G (VSV-G envelope; Addgene #12259), and TKOV1 294 Cancer Res Commun; 2(5) May 2022 https://doi.org/10.1158/2767-9764.CRC-22-0037 | CANCER RESEARCH COMMUNICATIONS Preclinical to Phase I Testing of Itraconazole and Hydroxychloroquine in EOC (Toronto KnockOut CRISPR Library, version 1; Addgene #1000000069) as immunofluorescence was used to check differences in lysosomal pattern among reported previously (20). the different conditions. Detailed information is included in the Supplementary Materials and Methods. To transduce the OVCAR5 and TOV1946 cells, the TKOV1 virus was added with 8 μg/mL polybrene in 15 cm dishes. Cells were selected with puromycin at Bioinformatic Analysis 48 hours postinfection. After selection cells were grown for 5 days to stabilize Itraconazole activity area was calculated using GraphPad Prism v6. Cell lines and then divided in triplicate. Itraconazole was added to separate replicates at with normalized activity area at least 0.8 SDs above the mean were defined as a final concentration of 1 μmol/L, with one set of replicates receiving no drug sensitive to the compound, whereas those with activity area at least 0.8 SDs be- treatment. Subconfluence cell cultures were trypsinized, counted, and replated, low the mean were defined as resistant. Cell lines with activity area within 0.8 and the excess cell pellets were frozen at − 20 °C as a timepoint. Once at least SDs of the mean were considered to be intermediate (30, 31). The drugZ algo- eight doublings were reached from T0, the screens were terminated, and pellets rithm was used to identify chemogenetic interactions from CRISPR screen as frozen at − 20 °C. Coverage of screens was kept at 400 cells per gRNA. reported previously (20). Venny software (https://bioinfogp.cnb.csic.es/tools/ gDNA was isolated from the frozen cell pellets using the QIAamp Blood Maxi venny/) was used to generate Venn diagrams. Pathway analysis on signifi- Kit (Qiagen), submitted for PCR and next-generation sequencing and analyzed cant CRISPR screen hits (FDR and P < 0.05) was performed using pathDIP as reported previously (20). (http://ophid.utoronto.ca/pathDIP/; ref. 32). Itraconazole inhibitory percent- age activity and heatmaps were generated using SynergyFinder 2.0 (https:// Alamar Blue Assay synergyfinder.fimm.fi/) and Excel. Itraconazole/chloroquine synergy score was Cell viability was determined using the Alamar blue assay according to the calculated on the basis of Bliss reference model. Calculation of synergy scores manufacturer’s protocol. Briefly, cells were plated in 96-well plates (2–4 × 103 were obtained using SynergyFinder 2.0 as reported previously (33). cells/100 μL/well) and let attach overnight. Then they were treated with serial dilutions of itraconazole at a final concentration of 0–40 μmol/L with or with- Study Design HYDRA-1 (ClinicalTrials.gov, out chloroquine 5–10 μmol/L. Cells were tested after 5 days by adding Alamar NCT03081702) blue solution to each well, incubating for 6 hours and measuring absorbance A rolling-six phase I design was used to assess the combination of itraconazole with a microplate reader (FLUOstar Omega, BMG Labtech) at a test wavelength (PrMint-itraconazole, itraconazole capsules, Mint Pharmaceuticals Inc.) and of 550 nm. All the experiments were performed independently three times. hydroxychloroquine, (PrMint-hydroxychloroquine, hydroxychloroquine sul- DNA Sequencing of C18orf8 (RMC1) fate capsules, Mint Pharmaceuticals Inc.), in patients with platinum-resistant or refractory EOC. The study was conducted in accordance with ethical guidelines gDNA from CRISPR and control cells was isolated from 1 million cells pellets and approved by the Institutional Review Board. A written informed consent using the gDNA Isolation Kit from Norgen Biotech Corp. DNA purity and con- was obtained from all patients. Women received itraconazole 300 mg twice daily centration was determined using Nanodrop (Thermo Fisher Scientific). Then, (twice daily) with hydroxychloroquine as per dose-escalation schedule (200 a region in Exon2 (targeted by Corf sgRNA) was amplified using the Q5 mg twice daily in dose level (DL)1; 400 mg twice daily in DL2; 600 mg twice High-Fidelity 2X Master Mix (New England Biolabs) and the following primers: daily in DL3), continuously in a 28-day cycle. The fixed dose of itraconazole forward primer CTTGCTGCTTTTCCCTCTCA, reverse primer ACCTAAAT- was determined in previous phase II trials (6), and because there is no known GAGATGGGATTCCT. Corf-specific PCR band was isolated from agarose interaction based on metabolism and pharmacokinetics or overlapping toxici- gel using the QIAquick Gel Extraction kit (QIAGEN) and eluted in water. Sam- ties, a rapid dose escalation of hydroxychloroquine, through a rolling-six design ples were submitted for sequencing using the above primers to the ACGT Corp was incorporated (34–36). Dose-limiting toxicities (DLT) were defined as grade (http://acgtcorp.com/). ≥4 anemia, neutropenia or thrombocytopenia, febrile neutropenia, grade ≥3 Western Blotting diarrhea or rash and grade ≥2 ocular toxicity, other grade ≥3 related toxic- Proteins were extracted from cell lines by RIPA buffer (NORGEN Biotek Corp) ity or grade 2 adverse events that do not recover within 2 weeks after optimal with protease and phosphatase inhibitors (Roche). After centrifugation at treatment during the initial 28 days of treatment (protocol in Supplementary 10,000 × g supernatants were boiled in Laemmli buffer for 10 minutes and pro- Materials and Methods). The calculated sample size was between 6 and 18. teins were resolved by SDS-PAGE in Bolt 4%–12% Bis-Tris Plus Gels (Thermo Tumor assessment occurred every 8 weeks (± 1 week) by CT scan. Toxicity Fisher Scientific). Proteins were subsequently transferred onto polyvinyli- was assessed by Common Terminology Criteria version 4.0. Pretreatment and dene difluoride membrane (Thermo Fisher scientific) and blocked for 1 hour on-treatment biopsies (on cycle 1, days 8 to 14) were mandatory. with Odyssey Blocking Buffer in TBS (LI-COR), incubated overnight with primary antibodies Anti-Cas9 (sc-517386), Anti-beta Tubulin (ab6046), anti- The primary objective was establishment of MTD; secondary objective was eIF4E (#610270) anti-VPS antibody (#13327-1-AP), and for 1 hour at room objective response rate by RECIST v1.1, and progression-free survival (PFS). temperature in IRDye 680RD and IRDye 800CW conjugated IgG (LI-COR). Patients Western blots were visualized using the Odyssey Infrared Imaging System (LI- COR Biosciences). Anti-beta Tubulin (ab6046) and anti-eIF4E (#610270) were Enrolled patients were ≥ 18 years old with an Eastern Cooperative Oncol- used as loading control. ogy Group performance status of 0–1, and platinum resistant or refractory EOC. Eligible patients had adequate blood and marrow function (hemoglobin Lysosomal Assay and Immunofluorescence ≥90 g/L, absolute neutrophils ≥1.5 × 109 /L, platelets ≥100 × 109 /L, bilirubin Lysosomal function was tested using the Lysosomal Intracellular Activity within normal limits, aspartate aminotransferase ≤2.5 × institutional upper Assay Kit (Biovision) according to the manufacturer’s instructions. LAMP1 limit of normal, alanine transaminase, serum creatinine within normal limits AACRJournals.org Cancer Res Commun; 2(5) May 2022 295 Marastoni et al. or creatinine clearance ≥60 mL/minute). Women on cytochrome P450 3A4 and proportions. PFS analysis was conducted using the Kaplan–Meier method (CYP3A4) inhibitors/inducers or on statins were ineligible. Patients with a for all patients. Median and confidence interval were reported to assess PFS. known glucose-6-phosphate dehydrogenase deficiency or a known retinopathy Treatment-related toxicity was evaluated using frequencies and proportions of were ineligible. Patients with a clinical indication for treatment with itracona- adverse events based on severities and attributions. zole or hydroxychloroquine, and those with intestinal malabsorption or active bowel obstruction were excluded. There was no limitation regarding prior Data Availability Statement number of lines of therapy. The data generated in this study are available upon request from the Clinical Trial Exploratory Objective Methods corresponding author. IHC was performed using the BenchMark XT automated stainer (Ventana Medical System) with antigen retrieval (CC1, Tris/Borate/EDTA pH8.0, #950- 124) for 64 minutes. The Ki-67 (clone: MIB1, M7240, Dako) dilution was 1:100 Results with 60-minute incubation. The anti-CC3 (D175, #9661, Cell Signaling Tech- Evaluation of Therapeutic Potential of Itraconazole nology) dilution was 1:500 with 32-minute incubation. The anti-LAMP1 (#9091, in Ovarian Cancer Cell Signaling Technology) dilution was 1:1,000 with 60-minute incubation. To explore the therapeutic potential of itraconazole in the treatment of EOC, The anti-P62 (2C11, WH000887M1, Sigma) dilution was 1:4,000 with 32-minute we screened a panel of 28 cells lines with 5 days of exposure. Quantitative scor- incubation. The Ventana’’s ultraView Detection Kit (#760-500) was utilized and ing of differential itraconazole sensitivity was calculated using the activity area the slides were counterstained with Gill-modified hematoxylin. method (corresponding to the area over the drug–response curve) as reported The H-score method was used to assess immunoreactivity for cleaved caspase previously (refs. 30, 31; Fig. 1A; Supplementary Fig. S1), and a threshold of 0.8 3 (CC3), p62, and LAMP1. In brief, the H-score is obtained by the formula: 3 × SD on the mean value was employed to identify the spectrum of sensitive and percentage of strong staining + 2 × percentage of moderate staining + percent- resistant cell lines, resulting in seven resistant, 15 intermediate, and 6 sensitive age of weak staining, resulting in a range from 0 to 300. The Ki-67 proliferation cell lines (31). These data suggest that itraconazole has a cytotoxic effect in a index was visually estimated to the nearest 5% increment. subgroup of ovarian cancer cells. IHC slides were scanned at a 20× magnification using the Aperio Scanscope Lysosomal Compartments as Important Regulators AT2 Whole Slide Scanner (Leica) and IHC images were obtained using Aperio of Itraconazole Resistance Identified through a ImageScope software (Leica). CRISPR Screen Tissue Pharmacokinetic Analyses To identify genes and pathways involved in sensitizing cells to itraconazole, we performed a whole genome drop-out CRISPR screen in two cell lines of Tumor itraconazole and hydroxychloroquine concentrations were determined intermediate sensitivity (TOV1946 and OVCAR5). We stably expressed Cas9 with itraconazole-D9 and hydroxychloroquine-D4 as the internal standard. (Fig. 1B; Supplementary Fig. S2A) and verified its activity (Supplementary The high-performance liquid chromatography (HPLC) system was interfaced Fig. S2A and S2B). Infected cells were treated with nontoxic concentrations of to a SCIEX TRIPLE QUAD 6500+ mass spectrometer operating in the negative itraconazole (1 μmol/L; Fig. 1B; Supplementary Fig. S2C). Analysis of the syn- electrospray ionization mode. Data collection, peak integration, and calculation thetically lethal hits using DrugZ algorithm (20) with both a FDR and P value were performed using Analyst 1.7 software (Sciex). <0.05, reported 72 genes for TOV1946 and 242 genes for OVCAR5 whose dele- Statistical Analysis tion increased sensitivity to itraconazole (Supplementary Data S1 and S2). A total of 20 genes were common in the two screens. To identify common clini- All dose–response graphs were generated using GraphPad Prism v6. Statisti- cally actionable pathways in the two screens, we carried out a pathway analysis cal analysis on the CRISPR screen results was done as reported previously (20). (32) on overlapping genes and found common pathways related to vesicular Hits with a P value and FDR <0.05 were selected for pathway analysis. Path- trafficking and the dynamics between the trans-golgi network (TGN) and late way analysis on CRISPR screen significant hits using PathDIP software uses endosomal/lysosomal compartments (LE/L; Fig. 1C). To validate our CRISPR Fisher exact test and corrects raw P values for multiple hypothesis testing based screen results, we selected two genes involved in these pathways for further on Bonferroni and FDR (BH method) methods (32). Statistical significance analysis, VSP and Corf, previously reported to have a role in lysosomal of differences among groups (apoptosis, synergy scores in VPS and Corf biology and dynamics. knockout cells and median normalized groups in lysosomal function and size) was assessed using the one-way ANOVA. To utilize all individual measurements Corf, also known as RMC, is a component of the CCZ1-MON1 complex of lysosomal diameter and function, the linear mixed effect modeling was ap- that is required for recruitment of Rab7 at LE/L and lysosomal maturation. plied with lysosomal function and size (diameter) as dependent variable and Knockdown of Corf has been shown to impair lysosomal maturation, induce treatment, the type of the cells (resistant or sensitive) and their interaction as lysosomal enlargement and dysfunction and inhibit autophagy (37). Consistent explanatory variable. The repeats and cell type (COV318, OVCAR5, TOV21G, with the CRISPR screen, stable knockout of Corf (Fig. 2A and B; Supple- TOV1946, TOV3133G) were random variables with repeats nested within the mentary Fig. S3A) strongly sensitized OVCAR5 and TOV1946 to itraconazole cell type. To stabilize the variance, a log transformation was applied to both (Fig. 2C; Supplementary Fig. S3B), dramatically increased lysosomal size (as lysosomal function and size measurements. Histograms and Swimmer plots measured by LAMP1) and decreased maturation as shown by the distinct were generated using R software. Patient clinical features and response details diffuse cytoplasm staining of Rab7 in knockout cells compared to the weak were described using summary statistics, such as medians, ranges, frequencies, punctate pattern in control conditions (Fig. 2D and E; Supplementary Fig. S3C). 296 Cancer Res Commun; 2(5) May 2022 https://doi.org/10.1158/2767-9764.CRC-22-0037 | CANCER RESEARCH COMMUNICATIONS Preclinical to Phase I Testing of Itraconazole and Hydroxychloroquine in EOC FIGURE 1 Vesicular trafficking is an important regulator of itraconazole resistance. A, Activity area analysis showing the activity of itraconazole in panel of 28 ovarian cancer cell lines. Cells were treated for 5 days with 0–40 μmol/L itraconazole (n = 3 biological replicates; see Supplementary Fig. S1). B, Left, schematic representation of itraconazole chemogenetic CRISPR screen. Right, graphs showing DrugZ-calculated normZ score in OVCAR5 and TOV1946 cells. Synergistic/synthetic lethal interactions are reported in red at FDR and P value < 0.05. C, Left-middle, Venn diagram showing overlap between the top hits from OVCAR5 and TOV1946 CRISPR screens and table showing common hits. Right, bioinformatic analysis showing pathways involved in the regulation of itraconazole sensitivity using PathDIP annotated database. Vacuolar protein sorting-associated protein 54 (VPS) is a component of the to cholesterol accumulation in the lysosomes as a reflection of impaired de- Golgi-associated retrograde protein (GARP) complex, which regulates retro- livery to the LE/L of cholesterol transporters and lysosomal enlargement and grade transport from late endosomes to TGN and is particularly important for dysfunction. Knockout of VPS lead to increased sensitivity to itraconazole, recycling of the mannose 6 phosphate receptor (M6PR) required for proper cholesterol accumulation (as measured by FILIPIN staining) and lysosomal en- delivery of lysosomal proteins (38). Knockdown of GARP VPS subunits leads largement (Fig. 2F–I; Supplementary Fig. S3D–S3G). Absence of VPS54 did not AACRJournals.org Cancer Res Commun; 2(5) May 2022 297 Marastoni et al. FIGURE 2 C18orf8 and VPS54 knockout cells are more sensitive to itraconazole (Itra). A, Sequencing results and alignment of PCR amplicons reporting a homozygous deletion in the exon2 of c18orf gene upstream the AGG PAM sequence (reported in green) in the C18orf8 knockout clone H1. B, Protein translation of wild-type (left) versus knockout (right) C18orf8. The knockout protein sequence showed the insertion of a premature stop codon. C, Alamar blue results showing increased sensitivity to itraconazole in C18orf8 knockout cells (red) compared with control (black; n = 3 biological replicates). D and E, LAMP1 and Rab7 staining of wild-type and C18orf8 knockout cells. F, Western blotting analysis showing knockout of VPS54 in three independent clones of OVCAR5. B-tubulin and eIF4E were used as a loading control. G, FILIPIN staining showing intracellular cholesterol accumulation in VPS54 knockout cells compared with controls (#14 was used as a representative clone). H, Alamar blue results showing increased sensitivity to itraconazole in VPS54 knockout cells (red) compared with controls (black; N = 3 biological replicates). I–J, LAMP1 and Rab7 staining of wild-type and VPS54 knockout cells. influence lysosomal maturation as knockout cells showed a Rab7 dotted pat- Synergistic Effects of Itraconazole and the tern in enlarged vesicular structures (Fig. 2J; Supplementary Fig. S3G). Taken Lysosomotropic Drug Chloroquine together, these results indicate that genes involved in lysosomal flux and func- We next postulated that drugs capable of phenocopying the effects of knock- tion can be important regulators of itraconazole resistance and impairment of ing out these two genes would result in an increased sensitivity to itraconazole. these pathways can strongly sensitize ovarian cancer cells to this drug. 298 Cancer Res Commun; 2(5) May 2022 https://doi.org/10.1158/2767-9764.CRC-22-0037 | CANCER RESEARCH COMMUNICATIONS Preclinical to Phase I Testing of Itraconazole and Hydroxychloroquine in EOC FIGURE 3 Itraconazole (Itra) synergizes with chloroquine (CQ) in a panel of ovarian cancer cell lines. A, Heatmaps showing inhibitory effect of itraconazole alone (0–40 μmol/L) or in combination with chloroquine (5–10 μmol/L) in a panel of 28 ovarian cancer cell lines. B, Waterfall plot showing the synergy scores calculated using a Bliss independence model of combinations of itraconazole and chloroquine. Synergy score values are ranked from low to high synergy (n = 3 biological replicates; see Supplementary Fig. S4). The antimalarial drug chloroquine and its derivative, hydroxychloroquine that showed the highest levels of synergy (Fig. 3B; Supplementary Fig. S4). are drugs that have been repurposed in several cancer-related clinical trials Overall, 5 and 10 μmol/L chloroquine concentration were not toxic (Supple- for their anti-inflammatory properties and for targeting autophagy at lyso- mentary Fig. S5A).The itraconazole/chloroquine cytotoxic effect was due to somal level by deacidifying lysosomal compartments (27). Similar to VPS an increase in apoptotic rate in itraconazole/chloroquine-treated cells (Supple- knockdown, chloroquine was shown to impair recycling of M6PR from late mentary Fig. S5B). Moreover, cell lines such as TOV21G which were exquisitely endosomes to TGN and to induce lysosomal enlargement and dysfunction resistant to itraconazole alone (Fig. 1), become very sensitive to the combination (39). We thus tested and quantified the effects of combining itraconazole with itraconazole and chloroquine (Fig. 3B; Supplementary Fig. S4). with chloroquine in the above cell lines using the Bliss synergy calculation (40). Each cell line demonstrated a different spectrum of synergistic activity CRISPR Validation of itraconazole/chloroquine combinations, ranging from low to high synergy As expected, the itraconazole/chloroquine combined effect was observed but (Fig. 3A and B, Supplementary Fig. S4) with TOV1946 and OVCAR5 previ- significantly reduced in Corf and VPS knockout cell lines (OVCAR5 and ously used in itraconazole sensitivity CRISPR screen, being among the cells TOV1946) compared with controls (Supplementary Fig. S6A–S6D). AACRJournals.org Cancer Res Commun; 2(5) May 2022 299 Marastoni et al. To better understand the biological effects of cotreatment with itraconazole No objective responses or CA125 responses according to Gynecological Can- and chloroquine, we compared lysosomal function and pattern in selected cell cer Intergroup criteria, were seen. Median cycles of treatment per patient was lines that displayed high levels of Bliss defined synergy (TOV21G, TOV1946, two (range, 2–4). Median PFS was 1.6 months (95% confidence interval, 1–1.7 OVCAR5) or were resistant to the combination (COV318, TOV31333G; months; Fig. 5B and C), and 1 patient with low-grade serous histology had stable Fig. 3). Lysosomal pattern and morphology was assessed by examining LAMP1, disease for 3.7 months. an abundant lysosomal membrane protein that localizes to lysosomes and late endosomes (21, 23) while lysosomal function was assessed using a lysosomal Pharmacokinetic Tumor Assessment intracellular functional activity assay based on a self-quenching substrate that Pretreatment and on-treatment biopsies (baseline, at cycle 1 day14) were avail- becomes fluorescent once internalized and exposed to the lysosomal enzymatic able for 10 patients. The highest concentrations of both drugs were detected activity (41). in 1 patient, HYDRA-005 that received treatment at DL1, with an intratumoral concentration of 0.745 ng/mg of tissue for itraconazole and 3.5 ng/mg tissue for In all cell lines, we observed a chloroquine-induced lysosomal enlargement hydroxychloroquine (Fig. 5D; Supplementary Fig. S7A). and a trend toward a reduction in lysosome function. However, only in itraconazole/chloroquine-sensitive cells, did we observe a combined effect in Pharmacodynamic Tumor Assessment lysosomal enlargement induction in parallel with a significantly reduced lyso- Pretreatment and on-treatment biopsies were available for IHC analysis in 10 somal function (Fig. 4A–C). In contrast, in the resistant cell lines (COV318, patients. No significant changes were detected in the overall population in terms TOV3133G), we found that despite drug treatment, the cell lines retained of IHC markers (autophagy, apoptosis, and lysosomal markers), morphology, more than 60% of lysosomal function (Fig. 4D and E), with no significant mitosis, and proliferation index (Ki-67). To explore the pharmacodynamic ef- difference of itraconazole/chloroquine combination compared with chloro- fect of the drugs, we stained the tumor sections for LAMP1, as well as p62 (a quine treatment. We further analyzed these observations (Fig. 4F) and applied marker that correlates with impaired autophagy). The expression of LAMP1 mixed-effect modeling (Supplementary Tables S1 and S2) that demonstrated increased in 1 patient (HYDRA-005) in the on-treatment biopsy compared significant changes across all comparisons except for lysosome function with the baseline biopsy. This patient also had an increase in the autophagy- between itraconazole and DMSO control. related protein (p62), previously shown to accumulate in tumors treated with Taken together, these results indicate that there is an association between cy- chloroquine (42), and apoptosis-related protein (CC3; Fig. 6). Interestingly, this totoxicity and degree of lysosomal dysfunction induced by the combination of patient had higher intratumor drug concentrations, and a decrease in size in the itraconazole/chloroquine in vitro. To explore the safety and utility of this drug target lesions (Fig. 5C and D; Supplementary Fig. S7A); however, there was no combination, we undertook a phase I clinical trial. correlation with clinical benefit. In addition, in all patients nonsignificant dif- ferences were observed in Ki-67 staining in tumor tissues (Supplementary Fig. S7B). Phase I Clinical Trial (HYDRA-1, NCT03081702) Discussion Baseline Demographics Despite recent advances, there remains a need for platinum resistant and refrac- Between 2017 and 2019, 13 patients were enrolled and two withdrew consent to tory EOC. In this article, we present a proof-of-concept study of itraconazole participate prior to the initiation of the therapy. Median age was 54 (range, 44– and chloroquine/hydroxychloroquine in the treatment in EOC from in vitro 77). Of the 11 patients, 10 were evaluable for efficacy. Histology was high-grade to phase I clinical trial. Thereby, we identified a novel mechanism to target (91%, N = 10) and low-grade (9%, N = 1) serous ovarian cancer, and median lysosomal homeostasis as a potential target in the treatment of malignancy. prior lines of systemic therapy was seven (range, 3–9). Briefly, based on previous studies showing the beneficial effects of itracona- Dosage, Safety, and Clinical Activity zole in patients with EOC (5, 18, 19), we identified and validated synthetically lethal genes involved in vesicular trafficking and dynamic exchanges be- Five patients were enrolled at DL1, and three at DL2 and DL3, and all were tween TGN and lysosomes such as Corf as well as members of the GARP evaluable for DLTs (Fig. 5A and B; Supplementary Table S3). Median duration complex (VPS, VPS, VPS, and VPS). Extrapolating from similar doc- of therapy was 1.8 months (DL1), 1.5 months (DL2), 1.5 months (DL3). The most umented phenotypes, we hypothesized that the antimalarial lysosomotropic frequent treatment-related toxicity was nausea in 36% of the patients (grade 1), drugs (chloroquine, and its derivative hydroxychloroquine), would be synthet- followed by diarrhea, vomiting, fatigue, and dry skin in 27% of patients (grade ically lethal with itraconazole. We observed a synergistic effect in several cell 1–2; Supplementary Table S4 and S5). Other grade ≥3 adverse events were grade lines, including those with resistance to itraconazole alone (Fig. 3; Supplemen- 3 hypokalemia and grade 4 QTc prolongation (in 1 patient, DL3). A DLT, based tary Fig. S4). Although there was no association with synergy with clinical on the protocol definition, was seen in DL2 defined as grade 3 hypertension, characteristics such as platinum sensitivity, we did correlate the cytotoxic activ- which resolved with appropriate oral blood pressure medication. Given that ity of the combination with the extent of relative inactivation of the lysosome the DLT was considered manageable with optimal treatment, it was deemed through a lysosomal functional assay. safe to escalate to DL3. There were no treatment discontinuations due to toxic- ity. Treatment was held in 1 patient due to intolerable grade 2 fatigue and grade To validate our preclinical findings, we conducted a phase I dose-escalation 2 muscle weakness without creatine kinase elevation (DL1). The recommended study assessing the combination of itraconazole and hydroxychloroquine phase II dose was itraconazole 300 mg twice daily and hydroxychloroquine in platinum-resistant or -refractory EOC. This combination was safe at 600 mg twice daily (DL3). the determined dose but did not lead to clinically significant antitumor 300 Cancer Res Commun; 2(5) May 2022 https://doi.org/10.1158/2767-9764.CRC-22-0037 | CANCER RESEARCH COMMUNICATIONS Preclinical to Phase I Testing of Itraconazole and Hydroxychloroquine in EOC FIGURE 4 Itraconazole/chloroquine (Itra/CQ) combination induces lysosomal dysfunction in sensitive cells. A–E, Top, representative pictures showing analysis of lysosomal pattern by LAMP1 immunofluorescence and relative quantification of lysosomal size based on lysosomal diameter of itraconazole/chloroquine–sensitive (TOV21G, OVCAR5, and TOV1946) and -resistant cells (COV318 and TOV3133G) treated with itraconazole 5 μmol/L (I5) ± chloroquine 5 μmol/L (CQ5; red histograms, each dot represents a single experiment). Bottom, representative pictures showing analysis of lysosomal function and relative quantification of treated cells from three independent experiments (green histograms). F, Graph and table showing the change in lysosomal function and lysosomal size of itraconazole/chloroquine–sensitive (blue) and -resistant (red) cells treated with I5 ± CQ5. Each dot represents respectively the median value of lysosomal fluorescence and lysosomal diameter value distribution from independent experiments (n = 3 biological replicates). * , P < 0.05; ** , P < 0.01; *** , P < 0.001; **** , P < 0.0001; ns, not significant. AACRJournals.org Cancer Res Commun; 2(5) May 2022 301 Marastoni et al. FIGURE 5 Itraconazole/hydroxychloroquine (HCQ) combination employed in a phase I clinical trial. A, Phase I rolling-six study design. EOC, epithelial ovarian cancer; BID, twice daily; DL, dose level; DLT, dose-limiting toxicity; PO, orally. B, Swimmer plot showing PFS in patient enrolled in the HYDRA clinical trial. Different dose levels are reported in green (DL1), orange (DL2), and blue (DL3). Different types of tumor are labeled with a triangle (low-grade serous carcinoma) or a square (high-grade serous carcinoma). C, Graph showing change (%) from baseline in tumor size in HYDRA patients according RECIST 1.1. D, Graphs showing intratumor detection and quantification of itraconazole (left) and chloroquine (CQ; right) in HYDRA patients pretreatment and on-treatment. Measurements were done using HPLC/MS-MS method. 302 Cancer Res Commun; 2(5) May 2022 https://doi.org/10.1158/2767-9764.CRC-22-0037 | CANCER RESEARCH COMMUNICATIONS Preclinical to Phase I Testing of Itraconazole and Hydroxychloroquine in EOC FIGURE 6 Itraconazole/chloroquine combined effect on apoptosis induction, p62 and LAMP1 accumulation. A, graphs showing IHC quantification of CC3, p62, and LAMP1 in HYDRA patients slides pretreatment and on-treatment (respectively, blue and orange). B, Representative pictures of IHC staining [hematoxylin–eosin (H&E), CC3, p62, and LAMP1] in patient HYDRA-005 pretreatment and posttreatment. activity, suggesting that further optimization of both pharmacodynamics and spheroids and organoids (43). We were unable to define the crucial enzy- pharmacokinetics may be required to realize the potential of the preclinical matic functions of the lysosome that were impaired by the combination findings. of itraconazole and hydroxychloroquine, and which one of the pleiotropic activities of itraconazole is involved in the synergistic response. Of note, The limitations of both our preclinical and clinical studies are significant. Pre- itraconazole can target lysosomes by binding and inhibiting the cholesterol clinically, we were limited in access to EOC models such as three-dimensional transporter NPC1 (14), suggesting a possible role of itraconazole in contributing AACRJournals.org Cancer Res Commun; 2(5) May 2022 303 Marastoni et al. to lysosomal dysfunction. Moreover, cationic amphiphilic drugs which include MSD, Bayer, and Oasmia outside the submitted work. J.P. Bruce reports other chloroquine/hydroxychloroquine, have been widely reported to impair the ac- from Bowhead Health outside the submitted work. M. Koritzinsky reports tion of lysosomal enzymes, induce a phenomena of aberrant phospholipid other from The Princess Margaret Cancer Foundation during the conduct of accumulation in lysosomes named phospholipidosis, and result in lysosomal the study; in addition, M. Koritzinsky has a Canadian patent number num- enlargement and laminar body inclusions that are associated with lysosomal ber 3,116,081 pending. B.G. Wouters reports grants from Ontario Institute for dysfunction (44). It is thought that subsequent cytotoxicity is related to the re- Cancer Research, Canadian Institutes for Cancer Research, and Princess Mar- lease of lysosomal cathepsins (45). Interestingly, some azoles like itraconazole garet Cancer Foundation during the conduct of the study; other from Northern have also been reported to induce a similar lysosomal effect (46) and it may be Biologics outside the submitted work; in addition, B.G. Wouters has a Cana- the combined effect of both drugs accounts for the synergy in cytotoxicity that dian patent number 3,116,081 issued. A.M. Oza is PI and on clinical trial steer- we observed. Future studies, including gene expression profile of cells treated ing committees for trials with Clovis, GSK, AstraZeneca—all uncompensated. with the two drugs, alone or in combination, will be aimed at better charac- A.M. Oza is uncompensated CEO of Ozmosis Research, a Not For Profit Clin- terizing the exact mechanisms of synergy, cell death and de novo or acquired ical Trials Management company associated with UHN. A.M. Joshua reports resistance. non-financial support from Mayne Pharma during the conduct of the study; other from Pricilium outside the submitted work; in addition, A.M. Joshua has Despite its limitations, our preclinical data demonstrated the utility of a a Canadian patent number 3,116,081 pending. S. Lheureux reports grants from bedside-to-bench approach, by analyzing the potential of clinically identified OICR - TRI Ovarian Cancer during the conduct of the study; grants and per- drug (itraconazole) then revalidating the findings in the laboratory to under- sonal fees from AstraZeneca, GSK; personal fees from Eisai, Merck, Shattuck stand the mechanism of action and redevelop them. Although clinical activity Labs; grants from Roche, and outside the submitted work. No other disclosures was not seen, the women on trial were heavily pretreated with a median of seven were reported. prior lines of treatment, materially limiting the possibility they may respond to the novel, nontoxic combination. In addition, (excluding patient 005), generally the tissue concentration of itraconazole/hydroxychloroquine was insufficient to Authors’ Contributions achieve an antitumor effect at all dose levels, albeit assayed early at day 14 given S. Marastoni: Conceptualization, resources, data curation, software, formal that itraconazole is thought to accumulate in tissue (47). Moreover, bioavailabil- analysis, validation, investigation, visualization, methodology, writing-original ity studies have shown that hydroxychloroquine steady-state levels are reached draft, project administration, writing-review and editing. A. Madariaga: Re- after 6 months of therapy (48). At the time of study design, the early timepoint sources, formal analysis, writing-original draft, writing-review and editing. was thought to reflect the need to ensure that most women remained on study A. Pesic: Resources, data curation, methodology. S.N. Nair: Resources, data at the time of biopsy. curation, methodology. Z.J. Li: Conceptualization, resources, data curation, Importantly, the drug combination was well tolerated, with the most com- methodology. Z. Shalev: Resources, data curation. T. Ketela: Resources, data mon adverse events being predicted from the mechanisms of action of both curation, software, formal analysis, methodology. I .Colombo: Resources, itraconazole and hydroxychloroquine. For example, the inhibition of 11β- methodology, writing-review and editing. V. Mandilaras: Resources, method- hydroxysteroid dehydrogenase 2 leading to hypertension is a well-known ology, writing-review and editing. M. Cabanero: Resources, writing-review dose-related toxicity of itraconazole (49). Other common toxicities such as diar- and editing. J.P. Bruce: Resources, writing-review and editing. X. Li: Re- rhea and liver function abnormalities were generally of low grade and reversible sources, writing-review and editing. S. Garg: Resources, writing-review and (5). There remains the need to develop pharmacologic formulation and develop editing. L. Wang: Resources, writing-review and editing. E.X. Chen: Re- predictive biomarkers of activity to thoroughly evaluate the potential of this sources, writing-review and editing. S. Gill: Resources, writing-review and drug combination to offer women a nonchemotherapeutic avenue to treat EOC. editing. N.C. Dhani: Resources, writing-review and editing. W. Zhang: Given the absence of clinical activity detected in this population in the phase I Resources, data curation, methodology. M. Pintilie: Resources, data cura- trial, a phase II trial was not conducted. tion, software, formal analysis. V. Bowering: Resources, writing-review and editing. M. Koritzinsky: Conceptualization, resources, methodology, writing- In conclusion, using drug repurposing, we identified a combination of FDA- review and editing. R. Rottapel: Conceptualization, resources, methodology, approved drugs that have a preclinical therapeutic potential in EOC, likely by writing-review and editing. B.G. Wouters: Conceptualization, resources, su- targeting lysosomal function and affecting pathways associated with chemore- pervision, funding acquisition, project administration, writing-review and sistance. Lysosomal targeting for cancer has been considered for nearly 40 years editing. A.M. Oza: Resources, writing-review and editing. A.M. Joshua: Con- (50), although was thought to have limited therapeutic ratio until recently (51). ceptualization, resources, data curation, formal analysis, supervision, funding Our work highlights the difficulties in drug repurposing and offers a template acquisition, investigation, methodology, writing-original draft, project ad- for future research into lysosomal targeting in EOC to validate this as tractable ministration, writing-review and editing. S. Lheureux: Conceptualization, target for cancer therapy. resources, supervision, writing-review and editing. Authors’ Disclosures S. Marastoni reports a Canadian patent number 3,116,081 pending. A. Acknowledgments Madariaga reports personal fees from Clovis and AstraZeneca outside the sub- This study was conducted with the support of the Ontario Institute for Cancer mitted work. Z.J. Li reports a Canadian patent number to CA3,116,081 pending. Research, Ovarian Cancer Translational Research Initiative through funding I. Colombo reports personal fees from MSD; other from GSK, AstraZeneca, provided by the Government of Ontario (Principal Award Recipients: Amit 304 Cancer Res Commun; 2(5) May 2022 https://doi.org/10.1158/2767-9764.CRC-22-0037 | CANCER RESEARCH COMMUNICATIONS Preclinical to Phase I Testing of Itraconazole and Hydroxychloroquine in EOC Oza and Robert Rottapel). Funding is also gratefully acknowledged from the Note Stanley Tessis fund via the Princess Margaret Cancer Foundation. The au- thors would like to thank Katherine Karakasis and Julia Burnier for their Supplementary data for this article are available at Cancer Research Comm- assistance in the phase I study protocol development, Dr. Benjamin Haibe unications Online (https://aacrjournals.org/cancerrescommun/). Kains, Ali Madani, Petr Smirnov, and Mark Freeman for their guidance in the Received January 20, 2022; revised March 13, 2022; accepted April 22, 2022; synergy score calculation, and Molly Udaskin for helping with one of the published first April 25, 2022. CRISPR screens. References 1. Noone AM, Krapcho M, Miller D, Brest A, Yu M, Ruhl J, et al. SEER Cancer 18. Tsubamoto H, Sonoda T, Yamasaki M, Inoue K. Impact of combination Statistics Review, 1975–2015, NCI, Bethesda, MD, https//seer.cancer.gov/csr/ chemotherapy with itraconazole on survival of patients with refractory ovarian 1975_2015/, based Novemb 2017 SEER data submission, posted to SEER web cancer. Anticancer Res 2014;34: 2481-7. site, April; 2018. 19. Tsubamoto H, Sonoda T, Yamasaki M, Inoue K. Impact of combination 2. Ramalingam P. Morphologic, immunophenotypic, and molecular features of chemotherapy with itraconazole on survival for patients with recurrent or epithelial ovarian cancer. Oncology 2016;30: 166-76. persistent ovarian clear cell carcinoma. Anticancer Res 2014;34: 2007-14. 3. Lheureux S, Braunstein M, Oza AM. Epithelial ovarian cancer: Evolution of 20. Colic M, Wang G, Zimmermann M, Mascall K, Mclaughlin M, Bertolet L, et al. Iden- management in the era of precision medicine. CA Cancer J Clin 2019;69: tifying chemogenetic interactions from CRISPR screens with drugZ. Genome 280-304. Med 2019;11: 52. 4. Mcmullen M, Madariaga A, Lheureux S. New approaches for targeting platinum- 21. Luzio JP, Hackmann Y, Dieckmann NMG, Griffiths GM. The biogenesis of lyso- resistant ovarian cancer. Semin Cancer Biol 2021;77: 167-81. somes and lysosome-related organelles. Cold Spring Harb Perspect Biol 2014;6: 5. Pantziarka P, Sukhatme V, Bouche G, Meheus L, Sukhatme VP. Repur- a016840. posing Drugs in Oncology (ReDO)-itraconazole as an anti-cancer agent. 22. Fennelly C, Amaravadi RK. Lysosomal biology in cancer. Methods Mol Biol Ecancermedicalscience 2015;9: 521. 2017;1594: 293-308. 6. Antonarakis ES, Heath EI, Smith DC, Rathkopf D, Blackford AL, Danila DC, 23. Piao S, Amaravadi RK. Targeting the lysosome in cancer. Ann N Y Acad Sci et al. Repurposing itraconazole as a treatment for advanced prostate can- 2016;1371: 45-54. cer: a noncomparative randomized phase II trial in men with metastatic 24. Ballabio A, Bonifacino JS. Lysosomes as dynamic regulators of cell and castration-resistant prostate cancer. Oncologist 2013;18: 163-73. organismal homeostasis. Nat Rev Mol Cell Biol 2020;21: 101-18. 7. Tsubamoto H, Ueda T, Inoue K, Sakata K, Shibahara H, Sonoda T. Repurposing 25. Xu Y, Cao X, Zhang S, Zhang Y, Shen Z. High expression of LAMP1 as a prog- itraconazole as an anticancer agent. Oncol Lett 2017;14: 1240-6. nostic marker in patients with epithelial ovarian cancer. Int J Clin Exp Pathol 8. Aftab BT, Dobromilskaya I, Liu JO, Rudin CM. Itraconazole inhibits angiogenesis 2017;10: 9104-11. and tumor growth in non-small cell lung cancer. Cancer Res 2011;71: 6764-72. 26. Bonam SR, Wang F, Muller S. Lysosomes as a therapeutic target. Nat Rev Drug 9. Wang Y, Yao Y, Liu H, Ma X, Lv T, Yuan D, et al. Itraconazole can inhibit malignant Discov 2019;18: 923-48. pleural effusion by suppressing lymphangiogenesis in mice. Transl Lung Cancer 27. Verbaanderd C, Maes H, Schaaf MB, Sukhatme VP, Pantziarka P, Sukhatme V, Res 2015;4: 27-35. et al. Repurposing Drugs in Oncology (ReDO)-chloroquine and hydroxychloro- 10. Liang G, Liu M, Wang Q, Shen Y, Mei H, Li D, et al. Itraconazole exerts its anti- quine as anti-cancer agents. Ecancermedicalscience 2017;11: 781. melanoma effect by suppressing Hedgehog, Wnt, and PI3K/mTOR signaling 28. Medrano M, Communal L, Brown KR, Iwanicki M, Normand J, Paterson J, et al. pathways. Oncotarget 2017;8: 28510-25. Interrogation of functional cell-surface markers identifies CD151 dependency in 11. Kim J, Aftab BT, Tang JY, Kim D, Lee AH, Rezaee M, et al. Itraconazole and high-grade serous ovarian cancer. Cell Rep 2017;18: 2343-58. arsenic trioxide inhibit Hedgehog pathway activation and tumor growth associ- 29. Hart T, Chandrashekhar M, Aregger M, Steinhart Z, Brown KR, Macleod G, et al. ated with acquired resistance to smoothened antagonists. Cancer Cell 2013;23: High-resolution CRISPR screens reveal fitness genes and genotype-specific 23-34. cancer liabilities. Cell 2015;163: 1515-26. 12. Head SA, Shi W, Zhao L, Gorshkov K, Pasunooti K, Chen Y, et al. Antifungal 30. Staunton JE, Slonim DK, Coller HA, Tamayo P, Angelo MJ, Park J, et al. drug itraconazole targets VDAC1 to modulate the AMPK/mTOR signaling axis Chemosensitivity prediction by transcriptional profiling. Proc Natl Acad Sci U S in endothelial cells. Proc Natl Acad Sci U S A 2015;112: E7276-85. A 2001;98: 10787-92. 13. Xu J, Dang Y, Ren YR, Liu JO. Cholesterol trafficking is required for mTOR 31. Dong Z, Zhang N, Li C, Wang H, Fang Y, Wang J, et al. Anticancer drug sensi- activation in endothelial cells. Proc Natl Acad Sci U S A 2010;107: 4764-9. tivity prediction in cell lines from baseline gene expression through recursive 14. Head SA, Shi WQ, Yang EJ, Nacev BA, Hong SY, Pasunooti KK, et al. Simultane- feature selection. BMC Cancer 2015;15: 489. ous targeting of NPC1 and VDAC1 by itraconazole leads to synergistic inhibition 32. Rahmati S, Abovsky M, Pastrello C, Jurisica I. pathDIP: an annotated resource of mTOR signaling and angiogenesis. ACS Chem Biol 2017;12: 174-82. for known and predicted human gene-pathway associations and pathway 15. Kim DJ, Kim J, Spaunhurst K, Montoya J, Khodosh R, Chandra K, et al. Open- enrichment analysis. Nucleic Acids Res 2017;45: D419-26. label, exploratory phase II trial of oral itraconazole for the treatment of basal 33. Ianevski A, Giri AK, Aittokallio T. SynergyFinder 2.0: visual analytics of multi- cell carcinoma. J Clin Oncol 2014;32: 745-51. drug combination synergies. Nucleic Acids Res 2020;48: W488-93. 16. Rudin CM, Brahmer JR, Juergens RA, Hann CL, Ettinger DS, Sebree R, et al. 34. Haria M, Bryson HM, Goa KL. Itraconazole. A reappraisal of its pharmacolog- Phase 2 study of pemetrexed and itraconazole as second-line therapy for ical properties and therapeutic use in the management of superficial fungal metastatic nonsquamous non-small-cell lung cancer. J Thorac Oncol 2013;8: infections. Drugs 1996;51: 585-620. 619-23. 35. Lee JY, Vinayagamoorthy N, Han K, Kwok SK, Ju JH, Park KS, et al. Association 17. Nussbaum N, George DJ, Abernethy AP, Dolan CM, Oestreicher N, Flanders of polymorphisms of cytochrome P450 2D6 with blood hydroxychloroquine S, et al. Patient experience in the treatment of metastatic castration-resistant levels in patients with systemic lupus erythematosus. Arthritis Rheumatol prostate cancer: state of the science. Prostate Cancer Prostatic Dis 2016;19: 2016;68: 184-90. 111-21. AACRJournals.org Cancer Res Commun; 2(5) May 2022 305 Marastoni et al. 36. Tett S, McLachlan A, Day R, Cutler D. Insights from pharmacokinetic and phar- 44. Breiden B, Sandhoff K. Emerging mechanisms of drug-induced phospholipido- macodynamic studies of hydroxychloroquine. Agents Actions Suppl 1993;44: sis. Biol Chem 2019;401: 31-46. 145-90. 45. Petersen NHT, Olsen OD, Groth-Pedersen L, Ellegaard A-M, Bilgin M, Redmer S, 37. Vaites LP, Paulo JA, Huttlin EL, Harper JW. Systematic analysis of human cells et al. Transformation-associated changes in sphingolipid metabolism sensitize lacking ATG8 proteins uncovers roles for GABARAPs and the CCZ1/MON1 regu- cells to lysosomal cell death induced by inhibitors of acid sphingomyelinase. lator C18orf8/RMC1 in macroautophagic and selective autophagic flux. Mol Cell Cancer Cell 2013;24: 379-93. Biol 2017;38: e00392-17. 46. Cartwright ME, Petruska J, Arezzo J, Frank D, Litwak M, Morrissey RE, et al. 38. Wei J, Zhang Y-Y, Luo J, Wang J-Q, Zhou Y-X, Miao H-H, et al. The GARP Phospholipidosis in neurons caused by posaconazole, without evidence for complex is involved in intracellular cholesterol transport via targeting NPC2 to functional neurologic effects. Toxicol Pathol 2009;37: 902-10. lysosomes. Cell Rep 2017;19: 2823-35. 47. Willems L, Van Der Geest R, De Beule K. Itraconazole oral solution and intra- 39. Brown WJ, Goodhouse J, Farquhar MG. Mannose-6-phosphate receptors for venous formulations: a review of pharmacokinetics and pharmacodynamics. J lysosomal enzymes cycle between the Golgi complex and endosomes. J Cell Clin Pharm Ther 2001;26: 159-69. Biol 1986;103: 1235-47. 48. Al-Rawi H, Meggitt SJ, Williams FM, Wahie S. Steady-state pharmacokinetics 40. Foucquier J, Guedj M. Analysis of drug combinations: current methodological of hydroxychloroquine in patients with cutaneous lupus erythematosus. Lupus landscape. Pharmacol Res Perspect 2015;3: e00149. 2018;27: 847-52. 41. Humphries WH 4th, Payne CK. Imaging lysosomal enzyme activity in live cells 49. Beck KR, Bächler M, Vuorinen A, Wagner S, Akram M, Griesser U, et al. Inhibi- using self-quenched substrates. Anal Biochem 2012;424: 178-83. tion of 11β-hydroxysteroid dehydrogenase 2 by the fungicides itraconazole and 42. Cook KL, Wärri A, Soto-Pantoja DR, Clarke PA, Cruz MI, Zwart A, et al. Hydrox- posaconazole. Biochem Pharmacol 2017;130: 93-103. ychloroquine inhibits autophagy to potentiate antiestrogen responsiveness in 50. Firestone RA, Pisano JM, Bonney RJ. Lysosomotropic agents. 1. Synthesis ER+ breast cancer. Clin cancer Res 2014;20: 3222-32. and cytotoxic action of lysosomotropic detergents. J Med Chem 1979;22: 43. Brodeur MN, Simeone K, Leclerc-Deslauniers K, Fleury H, Carmona E, 1130-3. Provencher DM, et al. Carboplatin response in preclinical models for ovarian 51. Fehrenbacher N, Gyrd-Hansen M, Poulsen B, Felbor U, Kallunki T, Boes M, et al. cancer: comparison of 2D monolayers, spheroids, ex vivo tumors and in vivo Sensitization to the lysosomal cell death pathway upon immortalization and models. Sci Rep 2021;11: 18183. transformation. Cancer Res 2004;64: 5301-10. 306 Cancer Res Commun; 2(5) May 2022 https://doi.org/10.1158/2767-9764.CRC-22-0037 | CANCER RESEARCH COMMUNICATIONS