Waste Management 161 (2023) 92–103 Contents lists available at ScienceDirect Waste Management journal homepage: www.elsevier.com/locate/wasman Filling in the gaps in biowaste biorefineries: The use of the solid residue after enzymatic hydrolysis for the production of biopesticides through solid-state fermentation Esther Molina-Peñate a, b, María del Carmen Vargas-García c, Adriana Artola a, *, Antoni Sánchez a a GICOM Research Group, Department of Chemical, Biological and Environmental Engineering, School of Engineering, Edifici Q, Universitat Autònoma de Barcelona, 08193 Bellaterra, Barcelona, Spain b Aeris Tecnologías Ambientales S.L, Carrer Santa Rosa, 38, local, 08290 Cerdanyola del Vallès, Barcelona, Spain c Microbiology Unit, Department of Biology and Geology, University of Almeria, International Excellence Campus of the Sea (CEI⋅MAR), Crta. Sacramento s/n, La Cañada de San Urbano, 04120 Almería, Spain A R T I C L E I N F O A B S T R A C T Keywords: Alternative production processes using waste are necessary to preserve non-renewable resources and prevent Biorefinery scarcity of materials for future generations. Biowaste, the organic fraction of municipal solid waste, is abundant Biowaste and easily available. It can be fractionated into building blocks for which fermentative processes can be designed. Biopesticide By using solid-state fermentation, this paper proposes a method of valorizing biowaste’s residual solid fraction Enzymatic hydrolysis after enzymatic hydrolysis. In a 22 L bioreactor, two digestates from anaerobic digestion processes were eval­ Solid-state fermentation uated as cosubstrates to modify the acidic pH of the solid residue after enzymatic hydrolysis and promote the growth of the bacterial biopesticide producer Bacillus thuringiensis. Regardless of the cosubstrate used, the final microbial populations were similar indicating microbial specialization. The final product contained 4 × 108 spores per gram of dry matter and also crystal proteins of Bacillus thuringiensis var israelensis, which have insecticidal activity against pests. This method allows for the sustainable use of all materials liberated during the enzymatic hydrolysis of biowaste, including residual solids. 1. Introduction Enzymes, which have been widely used in second-generation bio­ refineries (based on lignocellulosic materials), can fractionate the The transition from the current linear economic system toward a complex polysaccharides of the OFMSW and the other macromolecules more sustainable scheme that reduces the use of non-renewable re­ into monomeric sugars and other functional units (Pleissner and Pei­ sources can only be accomplished through incentives for waste valori­ nemann, 2020). Recently, fermentative pathways for these enzymatic zation and technological developments. Municipal solid waste (MSW) hydrolysates that result in high-value bioproducts have been investi­ management has emerged as one of the century’s greatest challenges for gated (Molina-Peñate et al., 2022a). These novel pathways can coexist municipalities worldwide and a paradigm shift seems inevitable to offset with the current most implemented treatment technologies for OFMSW, the expense of implementing selective collection systems (Sánchez et al., composting and anaerobic digestion (AD) (Cerda et al., 2018) in a 2015; Tonini et al., 2013). The organic fraction of municipal solid waste biorefinery-like scenario. (OFMSW) could be used in biorefineries through a cascade of biological After the enzymatic hydrolysis, the remaining solid fraction contains processes to obtain a variety of bioproducts (Budzianowski and Postawa, partially hydrolyzed and non-hydrolyzed fibers that can also support 2016). OFMSW comprises food waste from households, retail and res­ microbial growth in solid-state fermentation (SSF) (Molina-Peñate et al., taurants as well as green waste from parks and gardens. Its highly var­ 2022b). SSF is a simple and cost-effective biotechnological process iable composition is rich in carbohydrates and fibers, representing up to based on the culture of microorganisms on moist solid substrates under 85%, and also includes lipids, proteins, lignin and macro/micronutrients aerobic conditions (Soccol et al., 2017). The main bottleneck to its (Campuzano and González-Martínez, 2016). successful establishment as an industrial alternative is the difficulty of * Corresponding author. E-mail address: adriana.artola@uab.cat (A. Artola). https://doi.org/10.1016/j.wasman.2023.02.029 Received 31 October 2022; Received in revised form 31 January 2023; Accepted 23 February 2023 Available online 3 March 2023 0956-053X/© 2023 The Author(s). Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by- nc-nd/4.0/). E. Molina-Peñate et al. Waste Management 161 (2023) 92–103 scaling up the process due to heat and mass transfer limitations. At large safety assessment. Finally, an OFMSW biorefinery scheme based on scales, the accumulation of heat and diffusion problems cause gradients these technologies was proposed, including overall mass balances. in temperature, humidity, and concentration, as well as oxygen and nutrient deficiencies (Soccol et al., 2017). At the time of writing, a 2. Materials and methods Scopus®-based bibliometric analysis on the topic “solid state fermen­ tation” limited to articles in English of the last 20 years (2002–2022) 2.1. Raw materials resulted from 5,667 documents, from which <2% also included the terms “pilot” or “bench” (October 4, 2022). Therefore, more research on The OFMSW was collected upon arrival at the MSW treatment plant representative scales is necessary to make SSF a commercially compet­ of Mancomunitat La Plana (Malla, Barcelona) in February (winter sea­ itive technology. son). This material is obtained by a well-established door-to-door For the use of the solid residue after enzymatic hydrolysis of OFMSW collection system hence ensuring high quality with a low level of im­ as an SSF substrate, the selection of robust microorganisms capable of purities (<1%). After collection, bags were opened manually and thriving in not sterile environments, such as Bacillus thuringiensis (Bt) screened for inert materials (plastic, metal, glass or textile). Also, excess (Ballardo et al., 2016; Cerda et al., 2019), can facilitate the process paper, hard shells, hair and bones were removed. Then, around 12 kg of implementation in urban waste management plants. Bt is a microbial OFMSW were shredded mechanically using a home composting biopesticide producer that benefits from solid cultivation as it leads to shredder (Tecoinsaen SL, Spain), homogenized and stored at − 20◦ C for a increased spore production, viability and infectibility due to reduced maximum period of three months. In previous work, it was demon­ osmotic stress and increased surface for gas exchange (Flores-Tufiño strated that freezing for even longer times does not have a significant et al., 2021). However, the acidic pH of the solid residue after enzymatic effect on material properties according to aerobic respiration indices hydrolysis may hinder Bt growth and sporulation because this micro­ (Pognani et al., 2012). organism thrives at pH near neutrality. Moreover, pH tends to acidify at As cosubstrates of the SSF process, two types of digested materials the early stages of fermentative processes due to the release of short- were used: (i) digestate from a source selected OFMSW (DOF) treatment chain fatty acids, which inhibits microbial activity, as reported for the plant (Granollers, Barcelona), which was obtained from a mesophilic OFMSW composting process (Sundberg et al., 2004). The monitoring wet AD process followed by a solid–liquid separation using a screw and control of pH during SSF is another major bottleneck of this tech­ press, and (ii) digested sewage sludge (DSS) from a municipal waste­ nology due to the heterogeneity of the solid matrix, a limited amount of water treatment plant (Sabadell, Barcelona), which was obtained from a free water and a lack of suitable online solid-state pH measurement mesophilic wet AD followed by a solid–liquid separation using a methods (Kumar et al., 2021). Besides, the solid substrate itself can centrifuge. They were stored at − 20◦ C for a maximum period of three present a buffering effect due to its complex chemical composition, as months. Before use, both materials were defrosted and subjected to a for the OFMSW. Therefore, efficient operational strategies are required hygienization step to pasteurize them as specified in the European to prevent sharp pH changes and the overuse of chemicals during the Regulation N◦ 142/2011., Materials were kept at 70◦ C for 1 h using a fermentation course. previously heated oven and covering them to prevent moisture losses. In the AD of food waste, the use of cosubstrates is a common practice They were stored in the fridge (5◦ C) until their use for <24 h. to prevent an inhibitory pH from the rapid hydrolysis step and to Raw materials were characterized upon arrival at our facilities improve process efficiency (Karki et al., 2021). On the contrary, in SSF, (Table 1). Both digestates were similar in the physicochemical proper­ cosubstrates have been researched to a lesser extent, and the use of ties evaluated. However, DOF content in organic matter was higher than nutrient supplementation or chemicals for pH control is more common, that of DSS, which is a relevant parameter when using it as a cosubstrate though rarely reported at larger scales (Soccol et al., 2017). Thus, the of SSF. present work aimed to evaluate the use of high-buffer capacity cosub­ strates as a strategy to control pH in a 22 L SSF bioreactor. Two abundant biomaterials (digested sewage sludge and digested OFMSW) were tested 2.2. Enzymatic hydrolysis as cosubstrates for the production of Bacillus thuringiensis var. israelensis on the solid residue after enzymatic hydrolysis of OFMSW. This strain is OFMSW samples were defrosted overnight at 5◦ C and sterilized by especially attractive as the solid material can be used as biopesticide and autoclaving at 121◦ C for 30 min before use. The enzymatic hydrolysis no excessive downstream is necessary. SSF performance was evaluated step was conducted under sterile conditions in 2 L Erlenmeyer flasks on the basis of oxygen consumption rate, temperature and Bt sporula­ loaded with 0.7 kg of autoclaved OFMSW. n enzymatic cocktail tailor- tion, which is closely related to toxicity (Angelo et al., 2015). Further, made for OFMSW-like materials was supplied by ASA Spezialenzyme the final product was also evaluated in terms of microbial community for GmbH (Wolfenbüttel, Germany). It was made up of a mixture of cellu­ lases and pectinases, but also includes hemicellulase, ß-glucosidase and Table 1 Characterizations of the OFMSW, the digested materials and the enzymatic hydrolysates used in this study. OFMSWa Digested OFMSWa Digested sewage sludgea Hydrolysateb MC (%) 76.4 ± 1.1 77.2 ± 0.4 83.5 ± 0.1 77.4 ± 2.4 DM (%) 23.6 ± 1.1 22.8 ± 0.4 16.5 ± 0.1 22.6 ± 2.4 OM (%*) 89.7 ± 0.7 72.3 ± 6.3 68.8 ± 1.1 86.9 ± 1.7 RS (%*) 16.6 ± 0.9 NM NM 12.6 ± 1.7 pH 5.6 ± 0.1 8.5 ± 0.2 8.3 ± 0.2 5.3 ± 0.1 Conductivity 2.2 ± 0.1 2.6 ± 0.1 1.1 ± 0.1 2.6 ± 0.1 (mS/cm) DRI24h 3.5 ± 0.3 1.4 ± 0.3 1.6 ± 0.2 1.2 ± 0.1 (g O2 kg− 1 DM h− 1) AT4 179 ± 18 91 ± 2 95 ± 4 40 ± 2 (g O2 kg− 1 DM) *dry basis. OFMSW, organic fraction of municipal solid waste. MC, moisture content. DM, dry matter. OM, organic matter. RS, reducing sugars. DRI24h, dynamic respiration index average in the 24 h of maximum activity. AT4, cumulative oxygen consumption during the 4 days after the lag phase. NM, not measured. aData presented as mean values ± standard deviation of the sample analysis. bData presented as mean values ± standard deviation of two independent hydrolysis samples. 93 E. Molina-Peñate et al. Waste Management 161 (2023) 92–103 α-amylase activities. Enzyme dosage was 0.05 mL of enzymatic cocktail sporulation. per g of initial dry matter according to manufacturer’s instructions, the solid-to-liquid ratio was set to 10% (w v− 1), and the initial pH to 4.5 2.4.1. Experimental set-up using 0.05 M sodium citrate buffer. Flasks were incubated at 50 ◦ C and The SSF bioreactor was a packed-bed bioreactor made of stainless 180 rpm for 24 h. Then, hydrolysates were centrifuged at 6000 rpm for steel with a removable inner basket of 22 L and an automatic vertical 15 min at 4◦ C. Samples from both fractions were taken to measure sugar helical ribbon mixer, as showed in Fig. 1 and the supplementary mate­ content and the solid fraction was collected and stored at 5◦ C until its rial (Fig. S1) (Martínez et al., 2018). The working volume was approx­ use in the SSF for a maximum of three days. The mass balance for the imately 85% of the reactor capacity, corresponding to 4.5 kg of solid enzymatic hydrolysis is presented in Section 3.4. materials. The substrate mixture consisted of 1.75 kg of the solid residue after enzymatic hydrolysis, 1.75 kg of cosubstrate (digestate from 2.3. Microbial strain and inoculum preparation OFMSW or digested sewage sludge) and 1 kg of sterile wood chips, corresponding to a 39%, 39% and 22% in wet weight ratio, respectively. Bacillus thuringiensis var israelensis (Bti) CECT 5904 was obtained The addition of wood chips (1:2 volumetric ratio) as bulking agent is from “Colección Española de Cultivos Tipo” (Valencia, Spain) and pre­ essential to provide porosity and ensure proper airflow and oxygen served at − 80◦ C using a seed lot system in cryo-pearls (DeltaLab, Bar­ availability. The mixture was thoroughly mixed and inoculated with 25 celona). Inoculum preparation was carried out according to the mL of Bti inoculum suspension per kg of solid material, to reach an methodology presented by Mejias et al. (2020). Briefly, one cryo-pearl initial concentration of around 107 colony-forming units (CFU) per gram was inoculated in 100 mL of sterile Nutrient Broth n◦ 2 (Oxoid of dry matter (DM) (Mejias et al., 2020). To prevent compaction at the CM0067B) and incubated at 130 rpm and 30◦ C for 20 h, until an optical lower part of the reactor where the air inlet is, a 5 cm wood chips layer density of 2.5–3.0 was reached. Then, the culture was centrifuged for 10 was added to the basket before loading the inoculated mixture. The min at 3500 rpm. The obtained pellet was resuspended in 3 mL of the reactor is connected to a mass airflow meter (Bronkhorst, The exhausted media and then, diluted 1:10 (v v.1) to reach approximately a Netherlands) that supplies and controls the specific airflow rate of 730 concentration of 108 CFU mL− 1. This suspension was used as inoculum mL min− 1. The airflow goes first through a humidifier to saturate the air for SSF experiments. No spores were detected at this point. with water and then enters the reactor from the bottom. Experiments were monitored for 96 h and samples were taken each 24 h from the 2.4. Solid-state fermentation process upper part of the reactor. Intermittent mixing (10 min at 12 rpm) was applied each 24 h before sampling. Last day, when the reactor was Two SSF experiments were conducted in a 22L packed-bed biore­ stopped, two additional sampling points from the middle and lower actor to evaluate the effect of each cosubstrate on Bti growth and parts (Fig. 1) were included to evaluate the material homogeneity. Fig. 1. Experimental set-up of the solid-state fermentation 22 L bioreactor. 94 E. Molina-Peñate et al. Waste Management 161 (2023) 92–103 2.4.2. Monitored parameters 2.5.2. Routine parameters Microbial growth was assessed using different parameters related to Raw materials and fermentation samples were characterized in terms microbial activity. Oxygen consumption was online monitored by of moisture content, DM, organic matter (OM), pH and conductivity, measuring oxygen concentration at the outlet port of the reactor by an which were measured following standard procedures (Leege, 1998). O2-A2 oxygen sensor (Alphasense, UK) connected to a custom-built data acquisition system (Arduino® based) as detailed elsewhere (Mejias 2.5.3. Biodegradability et al., 2017; Ponsá et al., 2010). The specific oxygen uptake ratio (sOUR) Biodegradability was assessed through two respiration indices and was calculated according to: compared among the different substrates: the dynamic respiration index ( ) P × 32 × 60 × 1000a (DRI24h), which represents the average oxygen uptake rate during the sOUR = F × 0.209 − yO2 × 24 h of maximum activity observed expressed in g O2 kg− 1 DM h− 1, and R × T × DM × 1000b the cumulative oxygen consumption index (AT4), which is the cumula­ where sOUR is the specific oxygen uptake rate (g O2 kg− 1 DM h− 1); F, tive oxygen consumption of the four days after the lag phase expressed airflow rate into the reactor (mL min− 1); yO2, oxygen molar fraction in in g O2 kg− 1 DM, as described elsewhere (Ponsá et al., 2010). the exhaust air (mol O2 mol− 1); P, the pressure of the system assumed All measurements were conducted in triplicates. constant at 101,325 (Pa); 32.6, oxygen molecular weight (g O2 mol− 1 O2); 60, the conversion factor from minute to hour; 1000a, conversion 2.6. Scanning electron microscopy from ml to L; R, ideal gas constant (8310 Pa L K− 1 mol− 1); T, the tem­ perature at which F is measured (K); DM, dry matter of solids in the Scanning Electron Microscope (SEM) (Zeiss EVO) was used to visu­ reactor (g); 1000b, conversion factor from g to mg. alize Bti cells, spores and crystals produced. Samples of fermented ma­ The cumulative oxygen consumption represented by the area below terial of each SSF were taken after the process was finished, and a the O2 consumption curve was also calculated as another indicator of the solid–liquid extraction was performed with Ringer solution (1:10 w v-1) biological activity in the SSF bioreactor. for 20 min and sonicated (10 rounds of 1 min and 30 s of ice). Samples Temperature is another indicator of microbial activity as a conse­ were fixed on adhesive paper and dried for further sample metallization quence of the metabolic heat produced during microbial growth (Arora with gold (Loutfi et al., 2021). et al., 2018). This parameter was online monitored in the lower half of The dimensions of spores and crystals were determined by measuring the reactor bed employing a temperature probe (Pt-100 sensors, Sen­ 25 spores and 50 crystals in each sample on the screen of the SEM at a sotrans) located in the bioreactor. Also, accurate temperature profiles at magnification of ×20,000. These dimensions were used to identify Bti different heights of the reactor bed were obtained using temperature spores according to the literature (Loutfi et al., 2021). sensors (Maxim Integrated, U.S.). Sensors were placed at both the center of the packed bed (at 18 cm and 30 cm height) and the edges close to the 2.7. Microbial community analysis basket wall (at 12 cm, 24 cm and 36 cm height). Room temperature was also monitored. Sequencing was performed by the Genomic Service of the Universitat Specific Bti growth was monitored by measuring viable cells and Autònoma de Barcelona. Samples from the raw materials, the initial SSF spores. First, solid samples were subjected to a solid–liquid extraction mixtures and the final fermented products of both cosubstrates were using Ringer solution in a 1:10 (w v-1) ratio at 150 rpm for 20 min. Then, processed for DNA extraction using the Soil DNA Isolation Plus Kit the extract was appropriately diluted and 50 µL plated in triplicate onto (Norgen Biotek, Canada). DNA extracts were tested for concentration Petri dishes containing a Nutrient agar medium (Oxoid CM0003B, En­ and quality using a NanoDrop spectrophotometer and used to construct gland). To measure spores, 20 mL of the previous extract were submitted the corresponding genomic libraries by analyzing the variable regions to a thermal shock by incubating them at 80◦ C for 10 min and then V3-V4 of the prokaryotic 16S rRNA gene sequences, which gives 460 bp placing them into ice before plating (Mejias et al., 2020). All plates were amplicons in a two-round PCR protocol. First amplification was done incubated at 30◦ C for 20 h and viable cells or spores were estimated in with the specific primers with overhang adapters attached that flanks terms of CFU and related to the DM of the sample. The sporulation ratio regions of interest, forward (5′ TCGTCGGCAGCGTCAGATGTGTA at a certain time is calculated considering that the viable cell count in­ TAAGAGACAGCCTACGGGNGGCWGCAG) and reverse (5′ GTCTCGTG cludes both vegetative cells and spores according to the following GGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC equation: C). Then, using a limited-cycle PCR, sequencing adapters and dual index barcodes, Nextera® XT DNA Index Kit, FC-131-1002 (Illumina, San Sporulation ratio(%) = spores g− 1 DM × 100 Diego, CA, USA), were added to the amplicon for sequencing pooled viable cells g− 1 DM together in the MiSeq sequencer with the MiSeq® Reagent Kit v2 (500 The sporulation yield that expresses the spores produced per initial cycles) MS-102-2003. Sequencing analysis was carried out at the Base­ viable cell inoculated is calculated using the viable cell count at time 0 h Space (Illumina, Inc, USA) with the 16S Metagenomic App that performs as follows: taxonomic classification using a taxonomic database. The algorithm used was a high-performance implementation of the Ribosomal Data­ Sporulation yeild = spores g− 1 DM base Project (RDP) Classifier described in Wang et al. (2007). initial viable cells g− 1 DM The alpha diversity indices of the different microbial communities were obtained from the EzBioCloud microbiological research platform 2.5. Analytical methods (https://www.ezbiocloud.net), while the dendrogram and the Principal Component Analysis were performed using the PAST software for sta­ 2.5.1. Sugar content tistical analysis of biological data (PAST 4.05). The phylogenetic tree Reducing sugar content of the enzymatic hydrolysis fractions was showing the evolutionary relationship of the dominant ASVs was quantified using the 3,5-dinitrosalicylic acid colorimetric method (DNS) generated from MEGA version 10.1.6 software, using the Neighbour- (Miller, 1959). The liquid fraction was centrifuged (10,000 rpm, 20 Joining method combined with the Maximum Composite Likelihood min), filtered through a 0.45 μm membrane filter and properly diluted method to compute evolutionary distances. before processing. For the solid fraction, a solid–liquid extraction with distilled water in a 1:10 (w v− 1) ratio was performed at 50◦ C for 30 min. Then, it was centrifuged and processed like the liquid fraction. 95 E. Molina-Peñate et al. Waste Management 161 (2023) 92–103 Fig. 2. Monitored parameters during 22 L SSF to produce Bti spores from OFMSW hydrolysate using cosubstrates and thermal behavior inside the respective packed- bed (a, c) digested sewage sludge and (b, d) digested OFMSW. 3. Results and discussion DOF and coincided with the maximum production of viable Bti cells, whereas for the DSS, Bti continued to grow for 72 h. This indicates less 3.1. Process performance at 22 L microbial competition in the latter scenario, promoting the growth of Bti. Another remarkable difference between both cosubstrates is that The effect of each cosubstrate on the growth and sporulation of Bti, while the sporulation ratio after 24 h of processing was practically zero as well as other operational parameters, was monitored during the SSF for DSS, it was 30% for DOF, which can also be attributed to a more of the solid residue after enzymatic hydrolysis of OFMSW in a packed- competitive environment that promotes faster sporulation. bed bioreactor of 22 L. As shown in Fig. 2, both cosubstrates increased Considering that most crystal proteins associated with toxicity are Bti growth by an order of magnitude when compared to inoculated cells. produced during sporulation and that spores also act as insecticides, Digested sewage sludge (DSS) (Fig. 2a) showed a slower increase in achieving a high sporulation percentage was the ultimate goal (Angelo biological activity (measured as sOUR) than in digested OFMSW (DOF) et al., 2015). The maximum spore production was achieved at 72 h of the (Fig. 2b). They reached maximum activity in 30 h and 17–26 h, fermentation (Fig. 2), as has been previously reported for Bt in SSF respectively. This maximum activity was one sOUR unit higher for the (Cerda et al., 2019; Mejias et al., 2020). This was 3.9 × 108 spores g− 1 Table 2 Performance parameters of the SSF of OFMSW hydrolysate and each cosubstrate to produce Bti spores at 22L-scale. 1 Cosubstrate Lag phase (h) Total oxygen consumption (mg O2 ⋅ g− DM) Sporulation (%) Sporulation yield (spore/initial cell) 72 h 96 ha 72 h 96 ha DSS 18 140.6 91.9 88.7 ± 16 43.5 26.5 ± 15.3 DOF 8 244.8 78.5 99.1 ± 17 8.4 8.5 ± 2.3 Bti, Bacillus thuringiensis var israelensis. DSS, digested sewage sludge. DOF, digested organic fraction of municipal solid waste. The lag phase is calculated as the time it takes to reach 25% of the maximum sOUR. aData presented as mean values ± standard deviation of three different sampling points. 96 E. Molina-Peñate et al. Waste Management 161 (2023) 92–103 DM for DSS and 6.8 × 107 spores g− 1 DM for DOF. This corresponds to a 2019). However, the mixture with non-hydrolyzed biowaste reported sporulation yield per initial viable cell of 43.5 and 8.4 respectively slightly higher spore values (4 × 108 spores g− 1 DM) using a two-step (Table 2). A previous study showed a spore production of 1.6 × 106 aeration strategy (Mejias et al., 2020). spores g− 1 DM at a 0.5 L scale using an OFMSW solid hydrolysate that The pH of the solid residue after enzymatic hydrolysis was 5.3 had been chemically modified with NaOH to adjust the initial pH (Table 1) and therefore, inhibitory for Bti (Foda et al., 1985). The use of (Molina-Peñate et al., 2022b). Therefore, the use of alkaline cosubstrates alkaline cosubstrates increased the pH of the SSF mixtures to 7.5–8 appears as a more suitable strategy at a larger scale (x44 times) to ensure (Fig. 2), which is in the optimal range for Bti growth and sporulation. a pH near neutrality for Bti growth and sporulation, while saving costs of Their high buffering capacity (Karki et al., 2021) prevented the pH from chemical reagents. The use of the solid residue after enzymatic hydro­ reaching acidic inhibitory values (Fig. 2), which are characteristic of lysis of OFMSW appears beneficial for Bt production compared to using OFMSW aerobic treatments (Sundberg et al., 2004). For DSS the pH only non-sterile digested OFMSW, which reported lower spores values dropped to 6.3 after 24 h (Fig. 2a) in contrast to DOF (Fig. 2b), which did (2.8 × 107 spores g− 1 DM) when using Bt var kurstaki (Cerda et al., not present a pH drop. This might be explained by the higher content of Fig. 3. SEM images of Bti pure culture (a) vegetative cells and (b) spores in circles and spherical crystals pointed with arrows; (c, d) 96 h SSF sample of digested sewage sludge as cosubstrate; (e, f) and 96 h SSF sample of digested OFMSW as a cosubstrate. 97 E. Molina-Peñate et al. Waste Management 161 (2023) 92–103 Fig. 4. Prokaryote community structure of the substrates and processes analyzed. a) Distribution by phyla expressed as a function of relative abundances. b) Principal Component Analysis. Biplot graph showing similarity between samples and relationship with dominant species (relative abundance <1 % in at least some of the samples). c) Heat map of the relative abundances for the dominant population (Firmicutes; Synergistetes; Armatimonadota; Ca. Atribacteria; Cop­ rothermobacterota; Chloroflexi; Actinobacteria; Ca. Hydrogenedentes; Proteobacteria; Ca. Saccharibacteria; Ca. Absconditabacteria; Bacteroidetes; Ca. Cloa­ cimonetes; Euryarchaeota). On the left, the evolutionary relationships found between these ASVs (Neighbor-Joining Method, combined with the Maximum Composite Likelihood Method to compute evolutionary distances). The upper part shows the dendrogram grouping the samples. 98 E. Molina-Peñate et al. Waste Management 161 (2023) 92–103 Fig. 4. (continued). 99 E. Molina-Peñate et al. Waste Management 161 (2023) 92–103 organic matter (Table 1). However, considering the faster development discussed in the microbial population analysis. of the DOF fermentation process, the pH drop might have occurred during the first 24 h. The use of cosubstrates appears as an effective 3.4. Effect of cosubstrates on the microbial communities alternative to keep pH within safe values for Bti, contrary to the use of chemicals for pH control, which is rather difficult for SSF processes, at The microbiota associated with any type of material is conditioned large scales (Kumar et al., 2021). Additionally, chemical reagents are by the physicochemical properties of the material and by the structural only useful to adjust pH at the beginning of the SSF process as was and nutritional characteristics of the molecules of which it is composed. observed in previous work (Molina-Peñate et al., 2022c). The results obtained in the present study support this, both in terms of the total population and the structure of the dominant community 3.2. Temperature considerations for further scale-up (Relative abundance >1%). In the case of the complete population, the analysis at the phylum level (Fig. 4a) showed both similarities between Heat transfer is one of the major challenges for scaling up SSF pro­ the starting cosubstrates used and the initial times of the fermentation cesses (Kumar et al., 2021; Soccol et al., 2017). Especially for packed- process and divergences between the latter two, while at the end of bed bioreactors because axial and radial temperature and humidity fermentation, the degree of similarity between the bacterial community gradients appear as a consequence of metabolic heat generation and representative of both SSF experiments was considerably high. As heat transfer mechanisms within the bed (Casciatori et al., 2016; fermentation proceeds, the metabolic activity derived from the micro­ Rodrigues et al., 2022). Since more microbial activity and consequent biota promotes changes in the environment, which exert a selective temperature rise can be anticipated when working with non-sterile pressure effect on the starting bacterial community (Shen et al., 2021). substrates, this overheating becomes even more important. Therefore, Thus, despite initial differences, the convergence towards similar con­ the temperature was monitored using button sensors dispersed in ditions brought about by this activity tends to increase the similarity various locations throughout the bioreactor to assess the impact of each between the microbial populations associated with the two processes. cosubstrate on the packed-bed temperature. Specifically, there is a sharp decrease in the abundance of ASVs The temperature profile and the sOUR profile peaked at the same belonging to the phylum Firmicutes, while the presence of representa­ time for both cosubstrates (Fig. 2 c, d), indicating that the temperature tives of the phyla Bacteroidetes and Proteobacteria increases consider­ rise was indeed caused by the metabolic heat generation of microbial ably (Fig. 4b). The percentage increase was higher in the SSF made with growth. DOF reached slightly higher temperature values (42◦ C) DOF as cosubstrate, given that the starting levels were very low, compared to DSS (39◦ C) at this scale. Temperature increase for DOF was although the relative abundance was higher in the one that used DSW. In faster than for DSS, which might have also led to a lower viable cell any case, in both processes, the proteobacteria was the majority group at count. In both scenarios, Bti continued to grow and sporulate (Fig. 2 a, the end of fermentation. Members of the phyla Proteobacteria and b) despite the highest temperature. Even though these temperatures can Bacteroidetes are recognized for their ability to degrade macromolecules be deemed as high, a previous study using soy waste as a solid substrate present in organic substrates (Ventorino et al., 2015). This capacity is for Bt showed that Bt spores can tolerate temperatures as high as 60◦ C also associated with bacteria belonging to the phylum Firmicutes, (Ballardo et al., 2016). Therefore, there is still some room when scaling although the latter prevail in degradative processes where high tem­ up. However, it should also be considered that temperature can affect peratures are reached (Hosseini Koupaie et al., 2021), which is not the secondary metabolites (Odeniyi and Adeola, 2017), such as toxic pro­ case. Precisely, the dominance of the phylum Firmicutes in the solid teins, and thus, the final choice might be influenced by a deep charac­ residue after enzymatic hydrolysis (relative abundance close to 90%) terization of the biopesticide activity. The temperature profiles at the clearly differentiated the microbiota of this substrate from the rest. On different locations inside the reactor’s bed followed the same trend, the other hand, this clear difference shows that the microbial commu­ being around 5◦ C lower in the middle point for both scenarios (Fig. 2d). nity of the starting materials was conditioned to a much greater extent This favors the exploitation of the entire packed bed and a homogeneous by the cosubstrates used than by the solid residue after enzymatic production. The use of digested cosubstrates with low biodegradability hydrolysis. can explain the lower temperature variations observed according to The aforementioned changes in the microbial population structure, Barrena et al. (2011). with a clear dominance of the Proteobacteria and Bacteroidetes phyla at the end of fermentation, were clearly reflected in the α diversity indices 3.3. Visualization of biopesticide crystal proteins (Table 3). The microbiota associated with the final fermentation times showed lower richness and diversity, especially in the case of DOF, for The presence of Bti spores and crystals in the fermented products was which the number of ASVs and the Chao1 index value were reduced by confirmed by scanning electron microscopy (SEM). Identification was almost 44%, while the diversity according to the Shannon index fell by done by visual comparison with a pure culture and by size measure­ 1.4 units. This is a common profile in fermentation processes (Yong ments. Fig. 3 shows SEM images of the pure culture and the fermented et al., 2011; Yu et al., 2009), probably due to the change in conditions products using DSS and DOF. Spores are clearly visible in both SSF generated by the process itself. Such changes lead to a highly selective (Fig. 3d and Fig. 3e), and presented an average size of 1.3 ± 0.2 µm × environment that negatively affects the diversity of the microbial com­ 0.8 ± 0. 1 µm (N = 25) for SSW and 1.2 ± 0.2 µm × 0.7 ± 0.1 µm (N = munity present (Yang and Wang, 2019). However, the lowest diversity 25) for DOF, respectively. Both are within the expected size for Bti was detected in the solid residue after enzymatic hydrolysis, for which spores (0.71–1.93 µm long × 0.47–1.14 wide) (Loutfi et al., 2021). They the Shannon index showed a value of 1.656, typical of a poor community also presented the characteristic exosporium of some Bacillus species (in in terms of diversity. Similar bacterial communities have been described detail in Fig. 3d) that contributes to spore survival and virulence (Peng on substrates of this nature, obtained from the enzymatic hydrolysis of et al., 2016). Bti toxic proteins crystallize into a spherical form that is solid matter (Palomo-Briones et al., 2021) so that a loss of diversity of released into the environment during sporulation as can be observed in the solid residue after enzymatic hydrolysis in relation to its source Fig. 3b. In the fermented products, crystals showed a diameter of 0.7 ± material seems to be common. 0.1 (N = 50) for SSW (Fig. 3c) and 0.9 ± 0.1 (N = 50) for SOF (Fig. 3e), In line with the above, the changes produced in the microbiome of with a smooth surface. During SEM analysis of the SSF products, vege­ the process will be fundamentally conditioned by the type of fermen­ tative cells (Fig. 3a) could not be clearly distinguished, probably due to tation promoted, i.e. by the nature of the metabolites generated and the their low abundance considering the high sporulation ratios observed physicochemical conditions they favor. The results revealed by the (Table 2). Other microorganisms with different morphologies could also Principal Component Analysis (PCA) seem to confirm this hypothesis be seen, in this sense, more diversity was observed in the DOF sample, as (Fig. 4b) as it is clear that both processes, regardless of the starting 100 E. Molina-Peñate et al. Waste Management 161 (2023) 92–103 Table 3 α Diversity indices found for the substrates and processes analyzed. Sewage sludge Digestate Hydrolysate DSS DOF 0h 96 h 0h 96 h Number of ASVs 1346 914 230 525 403 1043 587 Good́ s coverage 98.9 99.6 99.8 97.4 99.8 99.6 99.8 Chao1 1528.3 959.0 349.8 661.9 636.1 1135.6 636.1 Shannon 4.91 4.38 1.66 4.03 3.53 4.59 3.17 Simpson 0.972 0.955 0.716 0.919 0.945 0.969 0.873 DSS, digested sewage sludge. DOF, digested organic fraction. ASVs, amplicon sequence variant. material, evolved in a similar way, as far as the taxonomic affiliation of have been located those related to the food sector, as OFMSW, in which the dominant species at the end of fermentation is concerned. This its powerful and diverse arsenal of extracellular enzymes is of special conclusion is also supported by the dendrogram generated according to importance (Kolton et al., 2016). the same criteria (Fig. 4c). The clustering of the samples points to the Concerning the microbial community composition of the solid res­ similarity between the initial process times and the corresponding idue after enzymatic hydrolysis at the species level, as expected, clear starting materials, as well as between the final samples of both pro­ differences were again observed with any of the other microbiomes. In cesses. The study by Shen et al. (2021), in the same direction, postulates this case, only three bacteria belonging to the evolutionarily close that the initially present microbiota, as it develops its metabolic activity, genera Bacillus and Weizmannia accounted for almost 90% of the pop­ generates a selective environment that gives rise to a bacterial com­ ulation. The conditions under which the enzymatic hydrolysis was car­ munity in which the dominant species show a high degree of phyloge­ ried out (50◦ C, 24 h) probably exerted a strong selective effect on the netic closeness. This is the phenomenon conceptually known as bacterial population present, favoring the persistence and dominance of homogeneous selection (Dini-Andreote et al., 2015). thermo-resistant species, as the three mentioned above. In particular, in the present work, it was observed how the domi­ nance of species belonging to the phylum Firmicutes (Sedimentibacter, 3.5. Integration of the proposed strategy in an OFMSW biorefinery Weizmannia and Mageeibacillus), in addition to the species Porphyr­ omonas pogonae and Candidatus Cloacimonas acidominovorans, in the Recycling OFMSW into higher-value products will directly initial samples representative of DOF, and Coprothermobacter proteoly­ contribute to the transition from the current fossil-based economy to a ticus and Levilinea saccharolytica in those from the same DWS material, bioeconomy and more sustainable society (Budzianowski and Postawa, resulted in a common community at the end time of both fermentations, 2016; Sánchez et al., 2015). In this article, the use of the residual solids consisting mainly of Stenotrophomonas, Acinetobacter, and Sphingo­ of enzymatic hydrolysis for biopesticide production through SSF has bacterium. Additionally, at DSW 96 h, Psychrobacter stood out, while been tested successfully at a representative scale. An integration of this Flavobacterium did the same at DOF 96 h. Most of the bacteria belonging system into the current management scenario based on AD is proposed to these genera are characterized by their metabolic activity associated in Fig. 5. Here, each kg of dry OFMSW is converted into around 338 g of with organic matrices, which makes them regular members of the mi­ reducing sugars with potential use in liquid fermentation systems. From crobial community present in fermentative processes of organic sub­ the residual solids, around 108 spores of the microbial biopesticide, Bt strates from different human activities (Jung and Park, 2015; Ryan et al., can be produced. Thus, by redirecting a part of the incoming high- 2009; Sun et al., 2013). The preferential presence of Psychrobacter in quality OFMSW into the treatment plant, two high-value products can DSW 96 h may be due to the thermal sensitivity of the species of this be obtained besides the energy produced in the AD system. This overall genus, whose growth limit is around 37◦ C (Welter et al., 2021), a value mass balance set the basis for future calculations of the environmental close to the maximum reached in this process, but lower than that and economic impact of the process that will ultimately determine the detected in DOF. Flavobacterium, on the other hand, groups species of scalability of the process. Future research should also explore the pos­ cosmopolitan distribution, being among the environments in which they sibility of achieving a more self-sufficient SSF process, for instance by Fig. 5. Scheme and overall mass balance of the proposed OFMSW valorization route. 101 E. Molina-Peñate et al. Waste Management 161 (2023) 92–103 implementing a sequential batch operation that eliminates the inoculum Casciatori, F.P., Bück, A., Thoméo, J.C., Tsotsas, E., 2016. Two-phase and two- dimensional model describing heat and water transfer during solid-state preparation step and maximizes the use of the solid materials. This fermentation within a packed-bed bioreactor. Chem. Eng. J. 287, 103–116. https:// strategy has proved to be successful in other SSF processes such as the doi.org/10.1016/j.cej.2015.10.108. production of fungal biopesticides or aromas (Sala et al., 2021; Martínez Cerda, A., Artola, A., Font, X., Barrena, R., Gea, T., Sánchez, A., 2018. Composting of et al., 2018). food wastes: status and challenges. Bioresour. Technol. 248, 57–67. https://doi.org/ 10.1016/j.biortech.2017.06.133. Cerda, A., Mejias, L., Rodríguez, P., Rodríguez, A., Artola, A., Font, X., Gea, T., 4. Conclusions Sánchez, A., 2019. Valorisation of digestate from biowaste through solid-state fermentation to obtain value added bioproducts: a first approach. Bioresour. Technol. 271, 409–416. https://doi.org/10.1016/j.biortech.2018.09.131. Bacillus thuringiensis var israelensis has been successfully grown on the Dini-Andreote, F., Stegen, J.C., Van Elsas, J.D., Salles, J.F., 2015. Disentangling solid residue after enzymatic hydrolysis of OFMSW at a representative mechanisms that mediate the balance between stochastic and deterministic processes in microbial succession. Proc. Natl. Acad. Sci. U.S.A. 112, E1326–E1332. solid-state fermentation scale. A strategy based on the use of digested https://doi.org/10.1073/pnas.1414261112. cosubstrates maintained pH from reaching acidic inhibitory values and Flores-Tufiño, B., Figueroa-Martínez, F., Viniegra-González, G., Loera, O., 2021. prevented temperature increase to thermophilic conditions (<45 ◦ C). Polyurethane foam as an inert support using concentrated media improves quality and spore production from Bacillus thuringiensis. World J. Microbiol. Biotechnol. 37, Thus, two significant challenges of SSF: scale-up and pH control, were 1–9. https://doi.org/10.1007/s11274-021-03122-2. overcome. A maximum of 4 × 108 spores per g of DM was obtained when Foda, M.S., Salama, H.S., Selim, M., 1985. Factors affecting growth physiology of Bacillus using digested sewage sludge, the presence of crystal proteins was thuringiensis. Appl. Microbiol. Biotechnol. 22, 50–52. https://doi.org/10.1007/ confirmed and the microbial community was systematically analyzed. BF00252156. Hosseini Koupaie, E., Lin, L., Bazyar Lakeh, A.A., Azizi, A., Dhar, B.R., Hafez, H., Elbeshbishy, E., 2021. Performance evaluation and microbial community analysis of mesophilic and thermophilic sludge fermentation processes coupled with thermal Declaration of Competing Interest hydrolysis. Renew. Sustain. Energy Rev. 141, 110832 https://doi.org/10.1016/j. rser.2021.110832. Jung, J., Park, W., 2015. Acinetobacter species as model microorganisms in The authors declare that they have no known competing financial environmental microbiology: current state and perspectives. Appl. Microbiol. interests or personal relationships that could have appeared to influence Biotechnol. https://doi.org/10.1007/s00253-015-6439-y. the work reported in this paper. Karki, R., Chuenchart, W., Surendra, K.C., Shrestha, S., Raskin, L., Sung, S., Hashimoto, A., Kumar Khanal, S., 2021. Anaerobic co-digestion: current status and perspectives. Bioresour. Technol. https://doi.org/10.1016/j.biortech.2021.125001. Data availability Kolton, M., Erlacher, A., Berg, G., Cytryn, E., 2016. The Flavobacterium genus in the plant holobiont: ecological, physiological, and applicative insights. In: Microbial Models: Data will be made available on request. From Environmental to Industrial Sustainability. Springer, Singapore, pp. 189–207. https://doi.org/10.1007/978-981-10-2555-6_9. Kumar, V., Ahluwalia, V., Saran, S., Kumar, J., Patel, A.K., Singhania, R.R., 2021. Recent Acknowledgments developments on solid-state fermentation for production of microbial secondary metabolites: challenges and solutions. Bioresour. Technol. 323, 124566 https://doi. org/10.1016/j.biortech.2020.124566. The authors thank ASA Spezialenzyme GmbH, for providing the Leege, P.B., 1998. Introduction of test methods for the examination of composting and enzymatic cocktail; Mancomunitat de la Plana, for the OFMSW; Consorci compost, in: Beneficial co-utilization of agricultural, municipal and industrial by- products. Springer, Dordrecht, pp. 269–282. . and EDAR Riu Sec de Sabadell; for the digested sewage sludge. Esther Loutfi, H., Fayad, N., Pellen, F., Jeune, B.L., Chakroun, M., Benfarhat, D., Lteif, R., Molina thanks Generalitat de Catalunya for her industrial doctorate Kallassy, M., Brun, G.L., Abboud, M., 2021. Morphological study of Bacillus grant (DI 7, 2019). This work was supported by the Horizon 2020 Pro­ thuringiensis crystals and spores. Appl. Sci. 11, 1–15. https://doi.org/10.3390/ app11010155. gram within the SCALIBUR project [grant agreement No 817788] and Martínez, O., Sánchez, A., Font, X., Barrena, R., 2018. Enhancing the bioproduction of the Spanish Ministerio de Ciencia e Innovación in the call Proyectos de value-added aroma compounds via solid-state fermentation of sugarcane bagasse I+D+i en líneas estratégicas 2022, Project FertiLab, reference PLEC2022- and sugar beet molasses: operational strategies and scaling-up of the process. Bioresour. Technol. 263, 136–144. https://doi.org/10.1016/j.biortech.2018.04.106. 009252. Mejias, L., Komilis, D., Gea, T., Sánchez, A., 2017. The effect of airflow rates and aeration mode on the respiration activity of four organic wastes: implications on the composting process. Waste Manag. 65, 22–28. https://doi.org/10.1016/j. Appendix A. Supplementary material wasman.2017.04.008. Mejias, L., Estrada, M., Barrena, R., Gea, T., 2020. A novel two-stage aeration strategy for Supplementary data to this article can be found online at https://doi. Bacillus thuringiensis biopesticide production from biowaste digestate through solid- org/10.1016/j.wasman.2023.02.029. state fermentation. Biochem. Eng. J. 161, 107644 https://doi.org/10.1016/j. bej.2020.107644. Molina-Peñate, E., Artola, A., Sánchez, A., 2022a. Organic municipal waste as feedstock References for biorefineries: bioconversion technologies integration and challenges. Rev. Environ. Sci. Biotechnol. 21, 247–267. https://doi.org/10.1007/s11157-021-09605- w. Angelo, E.A., Vilas-Bôas, G.T., Castro-Gómez, R.J.H., Lopes, J., 2015. Utilisation of Molina-Peñate, E., Sánchez, A., Artola, A., 2022b. Enzymatic hydrolysis of the organic response surface methodology to optimise the culture medium for Bacillus fraction of municipal solid waste: Optimization and valorization of the solid fraction thuringiensis subsp. israelensis. Biocontrol Sci. Technol. 25, 414–428. https://doi.org/ for Bacillus thuringiensis biopesticide production through solid-state fermentation. 10.1080/09583157.2014.983457. Waste Manag. 137, 304–311. https://doi.org/10.1016/j.wasman.2021.11.014. Arora, S., Singh, P., Rani, R., Ghosh, S., 2018. Oxygen uptake rate as a tool for on-line Miller, G.L., 1959. Use of dinitrosalicylic acid reagent for determination of reducing estimation of cell biomass and bed temperature in a novel solid-state fermentation sugar. Anal. Chem. 31, 426–428. https://doi.org/10.1021/ac60147a030. bioreactor. Bioprocess Biosyst. Eng. 41, 917–929. https://doi.org/10.1007/s00449- Molina-Peñate, E., Arenòs, N., Sánchez, A., Artola, A., 2022c. Bacillus thuringiensis 018-1923-2. production through solid-state fermentation using organic fraction of municipal Ballardo, C., Abraham, J., Barrena, R., Artola, A., Gea, T., Sánchez, A., 2016. Valorization solid waste (OFMSW) enzymatic hydrolysate. Waste Biomass Valor. https://doi.org/ of soy waste through SSF for the production of compost enriched with Bacillus 10.1007/s12649-022-01978-5. thuringiensis with biopesticide properties. J. Environ. Manage. 169, 126–131. Odeniyi, O.A., Adeola, O.J., 2017. Production and characterization of https://doi.org/10.1016/j.jenvman.2015.12.029. polyhydroxyalkanoic acid from Bacillus thuringiensis using different carbon Barrena, R., Gea, T., Ponsá, S., Ruggieri, L., Artola, A., Font, X., Sánchez, A., 2011. substrates. Int. J. Biol. Macromol. 104, 407–413. https://doi.org/10.1016/j. Categorizing raw organic material biodegradability via respiration activity ijbiomac.2017.06.041. measurement: a review. Compost Sci. Util. 19, 105–113. https://doi.org/10.1080/ Palomo-Briones, R., de Montoya-Rosales, J., Razo-Flores, E., 2021. Advances towards the 1065657X.2011.10736985. understanding of microbial communities in dark fermentation of enzymatic Budzianowski, W.M., Postawa, K., 2016. Total chain integration of sustainable hydrolysates: diversity, structure and hydrogen production performance. Int. J. biorefinery systems. Appl. Energy 184, 1432–1446. https://doi.org/10.1016/j. Hydrogen Energy 46, 27459–27472. https://doi.org/10.1016/j. apenergy.2016.06.050. ijhydene.2021.06.016. Campuzano, R., González-Martínez, S., 2016. Characteristics of the organic fraction of municipal solid waste and methane production: a review. Waste Manag. 54, 3–12. https://doi.org/10.1016/j.wasman.2016.05.016. 102 E. Molina-Peñate et al. Waste Management 161 (2023) 92–103 Peng, Q., Kao, G., Qu, N., Zhang, J., Li, J., Song, F., 2016. The regulation of exosporium- Sun, L.N., Zhang, J., Chen, Q., He, J., Li, S.P., 2013. Sphingobacterium caeni sp. nov., related genes in Bacillus thuringiensis. Sci. Rep. 6, 1–12. https://doi.org/10.1038/ isolated from activated sludge. Int. J. Syst. Evol. Microbiol. 63, 2260–2264. https:// srep19005. doi.org/10.1099/ijs.0.046987-0. Pleissner, D., Peinemann, J.C., 2020. The challenges of using organic municipal solid Sundberg, C., Smårs, S., Jönsson, H., 2004. Low pH as an inhibiting factor in the waste as source of secondary raw materials. Waste Biomass Valoriz. 11, 435–446. transition from mesophilic to thermophilic phase in composting. Bioresour. Technol. https://doi.org/10.1007/s12649-018-0497-1. 95, 145–150. https://doi.org/10.1016/j.biortech.2004.01.016. Pognani, M., Barrena, R., Font, X., Sánchez, A., 2012. Effect of freezing on the Tonini, D., Martinez-Sanchez, V., Astrup, T.F., 2013. Material resources, energy, and conservation of the biological activity of organic solid wastes. Bioresour. Technol. nutrient recovery from waste: Are waste refineries the solution for the future? 104, 832–836. https://doi.org/10.1016/j.biortech.2011.11.097. Environ. Sci. Technol. 47, 8962–8969. https://doi.org/10.1021/es400998y. Ponsá, S., Gea, T., Sánchez, A., 2010. Different indices to express biodegradability in Ventorino, V., Aliberti, A., Faraco, V., Robertiello, A., Giacobbe, S., Ercolini, D., Amore, organic solid wastes. J. Environ. Qual. 39, 706–712. https://doi.org/10.2134/ A., Fagnano, M., Pepe, O., 2015. Exploring the microbiota dynamics related to jeq2009.0294. vegetable biomasses degradation and study of lignocellulose-degrading bacteria for Rodrigues, N.A., Katayama, E.T., Casciatori, F.P., 2022. Alternative strategies to perform industrial biotechnological application. Sci. Reports 2015 51 5, 1–13. . operations. Chem. Eng. J. 448, 137726 https://doi.org/10.1016/j.cej.2022.137726. Wang, Q., Garrity, G.M., Tiedje, J.M., Cole, J.R., 2007. Naïve Bayesian classifier for rapid Ryan, R.P., Monchy, S., Cardinale, M., Taghavi, S., Crossman, L., Avison, M.B., Berg, G., assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. van der Lelie, D., Dow, J.M., 2009. The versatility and adaptation of bacteria from Microbiol. 73, 5261–5267. https://doi.org/10.1128/AEM.00062-07. the genus Stenotrophomonas. Nat. Rev. Microbiol. 2009 77 7, 514–525. . Michaux, J., Gormezano, L., Waters, J.L., Youngblut, N.D., Ley, R.E., 2021. Free- Sala, A., Barrena, R., Sánchez, A., Artola, A., 2021. Fungal biopesticide production: Living, psychrotrophic bacteria of the genus Psychrobacter are descendants of Process scale-up and sequential batch mode operation with Trichoderma harzianum pathobionts. mSystems 6. . using agro-industrial solid wastes of different biodegradability. Chem. Eng. J. 425, Yang, G., Wang, J., 2019. Changes in microbial community structure during dark 131620 https://doi.org/10.1016/j.cej.2021.131620. fermentative hydrogen production. Int. J. Hydrogen Energy 44, 25542–25550. Sánchez, A., Artola, A., Gea, T., Barrena, R., Font, X., 2015. A new paradigm for waste https://doi.org/10.1016/j.ijhydene.2019.08.039. management of organic materials. Waste Manag. 42, 1–2. https://doi.org/10.1016/j. Yong, X., Cui, Y., Chen, L., Ran, W., Shen, Q., Yang, X., 2011. Dynamics of bacterial wasman.2015.05.002. communities during solid-state fermentation using agro-industrial wastes to produce Shen, D., Shen, H., Yang, Q., Chen, S., Dun, Y., Liang, Y., Zheng, J., Zhao, S., 2021. poly-γ-glutamic acid, revealed by real-time PCR and denaturing gradient gel Deciphering succession and assembly patterns of microbial communities in a two- electrophoresis (DGGE). Appl. Microbiol. Biotechnol. 92, 717–725. https://doi.org/ stage solid-state fermentation system. Microbiol. Spectr. 9 https://doi.org/10.1128/ 10.1007/s00253-011-3375-3. spectrum.00718-21. Yu, Z., Dong, B., Lu, W., 2009. Dynamics of bacterial community in solid-state fermented Soccol, C.R., da Costa, E.S.F., Letti, L.A.J., Karp, S.G., Woiciechowski, A.L., de feed revealed by 16S rRNA. Lett. Appl. Microbiol. 49, 166–172. https://doi.org/ Vandenberghe, L.P., S.,, 2017. Recent developments and innovations in solid state 10.1111/j.1472-765X.2009.02636.x. fermentation. Biotechnol. Res. Innov. 1, 52–71. https://doi.org/10.1016/j. biori.2017.01.002. 103