G C A T T A C G G C A T genes Article The Expanding Phenotypical Spectrum of WARS2-Related Disorder: Four Novel Cases with a Common Recurrent Variant Martje G. Pauly 1,2,3 , G. Christoph Korenke 4 , Sokhna Haissatou Diaw 1 , Anne Grözinger 1 , Ana Cazurro-Gutiérrez 5 , Belén Pérez-Dueñas 5,6 , Victoria González 7 , Alfons Macaya 5 , Ana Teresa Serrano Antón 8 , Borut Peterlin 9 , Ivana Babić Božović 9 , Aleš Maver 9 , Alexander Münchau 2 and Katja Lohmann 1, * 1 Institute of Neurogenetics, University of Luebeck, Ratzeburger Allee 160, 23562 Luebeck, Germany; martje.pauly@neuro.uni-luebeck.de (M.G.P.); sokhna-; anne.groezinger@gmx.de (A.G.) 2 Institute of Systems Motor Science, University of Luebeck, 23562 Luebeck, Germany; alexander.muenchau@neuro.uni-luebeck.de 3 Department of Neurology, University Hospital Schleswig Holstein, 23562 Luebeck, Germany 4 Department of Neuropediatrics, University Children’s Hospital, Klinikum Oldenburg, 26133 Oldenburg, Germany; korenke.christoph@klinikum-oldenburg.de 5 Pediatric Neurology Research Group, Autonomous University of Barcelona, Hospital Universitari Vall d’Hebron, 08035 Barcelona, Spain; ana.cazurro@vhir.org (A.C.-G.); belen.perez@vhir.org (B.P.-D.); amacaya@vhebron.net (A.M.) 6 Center for Biomedical Network Research on Rare Diseases (CIBERER), 08035 Barcelona, Spain 7 Department of Neurology, Autonomous University of Barcelona, Hospital Universitari Vall d’Hebron, 08035 Barcelona, Spain; mariavictoria.gonzalez@vallhebron.cat 8 Clinical Genetic Section, Pediatric Service, Hospital Clinico Universitario Virgen de la Arrixaca, 30120 Murcia, Spain; anateserrano@gmail.com 9 Clinical Institute of Genomic Medicine, University Medical Centre Ljubljana, 1000 Ljubljana, Slovenia; borut.peterlin@kclj.si (B.P.); ivana.babic.bozovic@kclj.si (I.B.B.); ales.maver@kclj.si (A.M.) * Correspondence: katja.lohmann@neuro.uni-luebeck.de Citation: Pauly, M.G.; Korenke, G.C.; Abstract: Biallelic variants in the mitochondrial form of the tryptophanyl-tRNA synthetases (WARS2) Diaw, S.H.; Grözinger, A.; can cause a neurodevelopmental disorder with movement disorders including early-onset tremor– Cazurro-Gutiérrez, A.; Pérez-Dueñas, parkinsonism syndrome. Here, we describe four new patients, who all presented at a young age B.; González, V.; Macaya, A.; Serrano with a tremor–parkinsonism syndrome and responded well to levodopa. All patients carry the Antón, A.T.; Peterlin, B.; et al. The same recurrent, hypomorphic missense variant (NM_015836.4: c.37T>G; p.Trp13Gly) either together Expanding Phenotypical Spectrum of with a previously described truncating variant (NM_015836.4: c.797Cdel; p.Pro266ArgfsTer10), a WARS2-Related Disorder: Four novel truncating variant (NM_015836.4: c.346C>T; p.Gln116Ter), a novel canonical splice site variant Novel Cases with a Common (NM_015836.4: c.349-1G>A), or a novel missense variant (NM_015836.4: c.475A>C, p.Thr159Pro). We Recurrent Variant. Genes 2023, 14, 822. investigated the mitochondrial function in patients and found increased levels of mitochondrially https://doi.org/10.3390/ genes14040822 encoded cytochrome C Oxidase II as part of the mitochondrial respiratory chain as well as decreased mitochondrial integrity and branching. Finally, we conducted a literature review and here summarize Academic Editor: Xingguang Luo the broad phenotypical spectrum of reported WARS2-related disorders. In conclusion, WARS2-related Received: 9 March 2023 disorders are diagnostically challenging diseases due to the broad phenotypic spectrum and the Revised: 21 March 2023 disease relevance of a relatively common missense change that is often filtered out in a diagnostic Accepted: 24 March 2023 setting since it occurs in ~0.5% of the general European population. Published: 29 March 2023 Keywords: WARS2; tremor; parkinsonism; levodopa Copyright: © 2023 by the authors. Licensee MDPI, Basel, Switzerland. 1. Introduction This article is an open access article distributed under the terms and The mitochondrial form of the tryptophanyl-tRNA synthetases (WARS2), which cat- conditions of the Creative Commons alyzes the aminoacylation of tRNA(trp) with tryptophan [1], is one of the 14 mitochondrial Attribution (CC BY) license (https:// aminoacyl-tRNA synthetases related to neurological disorders [2]. The first cases with creativecommons.org/licenses/by/ biallelic pathogenic variants in WARS2, described in 2017, had a predominant neurodevel- 4.0/). opmental phenotype with developmental delay and intellectual disability, with only mild Genes 2023, 14, 822. https://doi.org/10.3390/genes14040822 https://www.mdpi.com/journal/genes Genes 2023, 14, 822 2 of 11 movement disorders such as tremor (OMIM: #617710) [3–5]. Later, additional cases [6–14] with prominent movement disorders (OMIM: # 619738) such as tremor and parkinson- ism with a good response to levodopa [6,12–14] were described with only mild or no intellectual disability. Functional studies in different biosamples of patients with biallelic variants showed impaired or normal enzyme activity and protein levels of the mitochon- drial respiratory chain depending on the type of investigated biomaterial and the specific variants [4–8,12]. Here, we describe four new patients with early-onset, levodopa-responsive tremor– parkinsonism syndromes with a common recurrent WARS2 missense variant on one allele and an additional truncating or missense variant on the other allele. 2. Materials and Methods 2.1. Identification of Variants and Additional Patients Our index patient was referred to our center because of an early-onset tremor–parkinsonism syndrome. The trio exome sequencing of P1 and the healthy parents was performed in 2018 (Agilent SureSelect Human All Exon V6 (Illumina, Inc., San Diego, CA, USA) at Centogene (Rostock, Germany)). While biallelic WARS2 variants were identified, they were not considered to be disease-causing due to the pathogenicity classification as a variant of uncertain significance (VUS) of one variant and the poor match of phenotype between our patient and previous descriptions in the literature. The re-evaluation of the exome data and thus also of the biallelic WARS2 variants was performed in 2021 as part of the SolveRD project (https://solve-rd.eu/) [15,16] using the GPAP (Genome-Phenome Analysis Platform; https://platform.rd-connect.eu) [17]. Newly available information from the literature in terms of variant interpretation (based on ACMG recommendations using VarSome [18] and Franklin (https://franklin.genoox.com, last accessed on 1 March 2023) and phenotypic spectrum (via PubMed (https://pubmed.ncbi.nlm.nih.gov, accessed on 01 March 2023) and OMIM (https://omim.org, accessed on 1 March 2023) was considered in this process. Based on the now likely disease-causing role of the two WARS2 variants in P1, we searched for additional patients with two WARS2 variants on GPAP, which contained >10.000 exome and genome datasets of patients with rare neurological, neuromuscular, neurodevelopmental, and cancer syndromes as well as their healthy relatives [15]. Of the 10 patients identified to have two WARS2 variants (date: 8 April 2021), submitters of patients with the p.Trp13Gly (NM_015836.4, c.37T>G) variant and a second variant at least classified as VUS were contacted, leading to the inclusion of Patient P2 and Patient P3 in this study. There were no patients with two variants classified as (likely) pathogenic. One additional patient (P4) was included in the study (by A.T.S.A.) based on the identification of biallelic WARS2 variants in a diagnostic setting. The pathogenicity of these additional variants was evaluated following ACMG recom- mendations including the calculation of the CADD scores [19] and the prediction of the software tool MutationTaster [20]. 2.2. Collection of Biosamples Blood samples for Sanger sequencing were available for all four patients and their parents. Additional biosamples for further functional studies were available in three families, as follows: in Family 1, fresh blood for RNA extraction and fibroblasts cultured from skin biopsy from P1 as well as from both parents (M1 and F1); in Family 2, fresh blood for RNA extraction and fibroblasts cultured from a skin biopsy for P2; in Family 3, fresh blood samples for RNA extraction from the patient (P3) and the parents (M3 and F3). The fibroblast cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Thermo Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (Life Technologies) and 1% penicillin/streptomycin (Life Technologies) at 37 ◦ C and 5% CO2 in a humidified atmosphere. RNA was extracted from the blood samples (PAX tube system) and fibroblasts using a QIAmp RNA Extraction Kit (QIAGEN, Germantown, MD, USA) Genes 2023, 14, 822 3 of 11 in Family 1 and Patient 2, while in Family 3, Tempus™ tubes and a Tempus™ Spin RNA Isolation Kit (Invitrogen™/Thermo Fisher Scientific, Waltham, MA, USA) was used. 2.3. Sanger Sequencing and Sequencing of cDNA Sanger sequencing was performed to validate variants as well as compound hetero- genicity in all four patients and parents at the referring centers (P1: Lübeck, Germany; P2: Barcelona, Spain; P3: Ljubljana, Slovenia; P4: Murcia, Spain). To evaluate the consequences of the splice site variant in Family 3, the complementary DNA (cDNA) was synthesized by reverse transcriptase using Oligo-dT-Nucleotides of the Maxima First Strand cDNA Synthesis Kit (ThermoFisher, Waltham, MA, USA) as primers. PCR was conducted (WARS2_c.349-1G>A_F: CGGGCACTTCATAAGGGAT; WARS2_c.349- 1G>A_R: TTACCTTCTTCATGGATGTGAG) and the product Sanger sequenced. 2.4. Staining of the Mitochondrial Network The mitochondrial network was investigated as previously described [21,22]. Cells were either stained under basal conditions or after treatment with paraquat (2 mM) for 5 h. Subse- quently, the mitochondrial network in the fibroblasts was stained with an anti-GRP75 antibody (1:1000, Abcam, Cambridge, MA, USA) in combination with the Zenon immunolabelling kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. 2.5. Western Blotting of MT-CO2 Cell pellets were extracted using RIPA extraction buffer (25 mM Tris–HCl pH 7.6, 150 mM NaCl, 1% DOC, 1% NP-40, 0.1% SDS and proteinase inhibitor cocktail with completeTM Mini and phosStopTM (both Roche), 1 tablet each for 10 mL). Gels were blotted onto nitrocellulose membranes. The antibodies anti-MT-CO2 (1:5000; abcam; ab79393), Anti-WARS2 (1:1000; Sigma, St. Louis, MO, USA; SAB1408661 and 1:500, 1:1000; Invitrogen; PA5-43808), and anti-β-actin (1:2000; Sigma; A5316) for immunoblotting were used. For quantification of the Western blots, Image Lab 6.1 (Bio-Rad) was used to analyze the intensity and volume of the bands. 3. Results 3.1. Case Reports 3.1.1. Patient 1 The now 20-year-old male patient (P1) was born after an unremarkable pregnancy without complications as the first and only child of healthy, non-consanguineous German parents. Due to bilateral hip dysplasia, the patient underwent a 6-week straddle pant treatment. There were initial feeding problems due to uncoordinated tongue movements; further bottle feeding was problem-free. A mild tonus dysregulation was described at the age of 4 months. At this time, a fine-beat head tremor developed. An EEG examination was performed under suspicion of epilepsy and was normal. In the fourth year of life, an increased left-sided cramping during voluntary movements was observed. There was slight intellectual disability. From the age of 6 years, tremor of both hands appeared, which was slowly progressive in the course. Propranolol therapy showed no effect. The tremor was progressive, slight at rest, and clearly increasing as intention tremor. Over the next years, though, the tremor considerably deteriorated and the patient also developed gait instability with small steps and dystonia. The cognitive function showed mild intelligence impairment. He suffered from anxiety, which affected his daily life at around the age of 13 years. Later, the anxiety became less prominent, with an uneasy feeling in larger open spaces. At the age of 19 years, he presented with marked Holmes Tremor, generalized dystonia, and leg spasticity with increased reflexes. A video of the examination can be found in the Supplementary Materials (Supplementary Video S1). Treatment with levodopa was established at the age of 15 years, improving tremor and gait difficulties. Later, biperiden Genes 2023, 14, 822 4 of 11 was added to the medication, which led to further improvement of the tremor and the ability to move. Brain MRI was unremarkable. Cerebrospinal fluid examination showed normal lactate, reduced homovanillic acid, and slightly reduced tetrahydrobiopterin and alanine (Table 1). Table 1. Clinical description of the newly described patients and patients in the literature. Category P1 P2 P3 P4 Literature (n = 24) 1 [3–14] Sex Male Male Male Male Male 11/24 (45.8%) Age of onset 0.5 y 9y 13 y 1y Mean 2.0 y [range 0–12 y] Age at last 20 y 20 y 38 y 2y Mean 16.4 y [range 0–52 y] examination Tremor, Hyperkinetic MD 8/22 First signs and Tremor, intellectual symptoms Tremor disability Tremor developmental delay Developmental delay 8/22 Others 2 6/22 Tremor yes yes yes yes 9/9 Parkinsonism yes yes yes yes 5/5 Dystonia yes yes yes no 12/12 Other hyperkinetic no Myoclonic jerks Myoclonic jerks no 6/6 MD 3 Ataxia no no no yes 8/8 Increased muscle yes yes yes yes 10/10 tone (Axial) hypotonia no no no yes 8/8 Muscular weakness no no no no 4/4 Seizures no no no no 7/10 Developmental delay no no no yes 7/7 Intellectual disorder 16/20 Mild to moderate mild mild mild (mild to moderate) 4 6/15 severe 9/15 Lactate acidosis no no no no 3/4 L-Dopa response good good good good 6/8 Pallidal T2 MRI abnormal no hypointensity no no 5/10 5 DaTScan abnormal n. a. Yes yes n. a. 3/3 1 Not all symptoms were reported in all patients. Number of patients with information on specific symptoms is indicted behind the slash. 2 Lactate acidosis, muscular hypotonia, dystonia, seizures. 3 myoclonus/myoclonic jerks, chorea/choreatic movements, ballism. 4 Difficult to evaluate due to young age of patient. 5 Cerebellar atrophy, leukoencephalopathy, thin corpus callosum. MD: movement disorder. The family history for neurological disorders was unremarkable. Candidate gene genetic testing including ATP13A2, C19orf12, COASY, CP, DCAF17, FA2H, FTL, GTPBP2, IBA57, PANK2, PLA2G6, and WDR45 did not reveal a disease-causing variant in 2017. A parent–patient trio exome sequencing in early 2018 with re-analysis in 2021 revealed compound heterozygous variants in WARS2 with a maternally inherited truncating variant (NM_015836.4: c.797Cdel; p.Pro266ArgfsTer10) and a paternally inherited missense variant (NM_015836.4: c.37T>G; p.Trp13Gly) (Figure 1A). 3.1.2. Patient 2 The now 20-year-old male patient (P2) was born after an unremarkable pregnancy without complications as the only child of healthy, non-consanguineous Spanish parents. He walked independently at 22 months and was noted to be clumsy from early on. Lan- guage was also delayed and with morphosyntactic deficit. He needed special support from primary school. He was referred at age 9 years, when he displayed mild intellectual disability, clumsiness, and some parkinsonian features, including bradykinesia, cogwheel rigidity, and resting and postural tremor. The tremor worsened during emotional upset up to the point of making him fall to the ground. Over the years, some additional features appreciated during follow-up were slow and hypometric saccadic ocular movements, cer- vical and upper limb dystonia, lower limb spasticity, and occasional action myoclonic jerks. Treatment with levodopa improved both tremor and bradykinesia, with functional benefit in gait and manipulative skills, and prevented further episodes of falling. Genes14, Genes 2023, 2023, 82214, x FOR PEER REVIEW 5 of 12 5 of 11 Figure 1. Pedigree of the family of Patient 1 (A), Patient 2 (B), Patient 3 (C), and Patient 4 (D). WT: Figure 1. Pedigree of the family of Patient 1 (A), Patient 2 (B), Patient 3 (C), and Patient 4 (D). WT: wildtype, n.t.: not tested; square: male, circle: female, white: unaffected, black: affected, striped: wildtype, n.t.: not tested; square: male, circle: female, white: unaffected, black: affected, striped: iso- isolated tremor. lated tremor. A DaTScan 3.1.2. Patient 2 showed the marked loss of tracer uptake bilaterally over the putamina and moderateThedecrease on the right now 20-year-old male caudate nucleus. patient (P2) There was born was after an also a suggestion unremarkable of increased pregnancy extrastriatal cortical activity. without complications as the only child of healthy, non-consanguineous Spanish parents. HeSerial walked brain MRI showed independently at 22 the mildand months prominence was noted toofbethe cerebellar clumsy foliaon. from early plus pallidal Lan- T2WI hypointensity guage at theand was also delayed lastwith examination. The patient–parent morphosyntactic trio exome deficit. He needed special sequencing support in 2018, fromand re-analysis primary school.in He2021, revealed was referred at compound heterozygous age 9 years, when variants he displayed in WARS2 with mild intellectual disability, clumsiness, a maternally inheritedand some parkinsonian truncating features, including variant (NM_015836.4: bradykinesia, c.346C>T; cogwheel and a p.Gln116Ter) rigidity, and resting and postural tremor. The tremor worsened during paternally inherited missense variant (NM_015836.4: c.37T>G; p.Trp13Gly) (Figure emotional upset 1B). up to the point of making him fall to the ground. Over the years, some additional features appreciated 3.1.3. Patient 3during follow-up were slow and hypometric saccadic ocular movements, cer- vical and upper limb dystonia, lower limb spasticity, and occasional action myoclonic The now 38-year-old male patient (P3) was born as the second child to non-consanguineous jerks. Treatment with levodopa improved both tremor and bradykinesia, with functional Slovenian parents. Around the age of 13 years, the patient presented with tremor in the benefit in gait and manipulative skills, and prevented further episodes of falling. upper extremities along with A DaTScan showed occasional the marked lossmyoclonic jerks. bilaterally of tracer uptake The tremor first over thepresented putamina on the leftand body moderate decrease on the right caudate nucleus. There was also a suggestion ofgradually side, but slowly progressed to bilateral resting tremor. His symptoms in- progressed until, at the creased extrastriatal age of cortical 25 years, he first visited a neurologist and was diagnosed activity. with early-onset Serial brainParkinson’s MRI showeddisease. the mildBesides prominent prominence hand tremor, of the cerebellar folia he presented plus pallidal with hypomimia, bradykinesia, T2WI hypointensity mild at the last dysarthria, examination. stiffness, The and mild patient–parent trio dystonic posturing exome sequencing in of the left2018, and re-analysis leg during in 2021, walking. The revealed laboratorycompound findings heterozygous variants in were unrevealing andWARS2 brainwith MRI was a maternally normal, inherited but DaTScan truncating imaging variant showed (NM_015836.4: reduced c.346C>T; tracer uptake p.Gln116Ter) bilaterally and over the a putamina. paternally inherited missense variant (NM_015836.4: c.37T>G; p.Trp13Gly) Neuropsychological testing at the age of 33 years revealed mild cognitive impairment (Figure 1B). as well as an introverted, unsociable character with a lack of trust. The patient and his parents also reported mood changes, anxiety, and occasional irritability. Treatment with rasagiline, levodopa, and entacapone was established and the tremor, bradykinesia, and rigidity improved. The 5-year older sister was reported to have tremor since childhood; however, no examination was performed. A patient–parent trio exome sequencing in 2022 revealed compound heterozygous variants in WARS2 with a paternally inherited splice site variant (NM_015836.4: c.349- Genes 2023, 14, 822 6 of 11 1G>A) and a maternally inherited missense variant (NM_015836.4: c.37T>G; p.Trp13Gly) (Figure 1C). 3.1.4. Patient 4 The now 2-year-old male patient (P4) was born at 34 weeks after an uneventful pregnancy as the third child of healthy, non-consanguineous parents of Moroccan origin. His developmental milestones, predominantly gross and fine motor skills, were delayed from the early stages. At 15 months of age, he developed generalized gross resting tremor that started in the lower limbs and then progressed to the upper limbs and head. This tremor is intensified by voluntary actions. He does not have myoclonus or dystonia. He also has developed lower limb hypertonia and Babinski sign. EEG, brain MRI, abdominal ultrasound, and ophthalmological examination were normal. Screening for metabolic disorders and ArrayCGH were also normal. The patient’s motor skills and tremor improved with levodopa treatment. A patient–parent trio exome sequencing in 2022 revealed compound heterozygous variants in WARS2 with a maternally inherited missense variant (NM_015836.4: c.475A>C, p.Thr159Pro) and a paternally inherited missense variant (NM_015836.4: c.37T>G; p.Trp13Gly) (Figure 1D). 3.2. Characterization of WARS2 Variants In all four patients, the same missense variant (NM_001378227.1: c.37T>G; p.Trp13Gly) was found. According to the ACMG recommendations, this variant is classified as pathogenic due to the criteria PM3, PP5, and PS3, it has an allele frequency on gnomAD of 0.33% overall (and 0.46% in non-Finnish Europeans), and has conflicting interpretation of pathogenicity on ClinVar (however with 4/5, classifying the variant as pathogenic or likely pathogenic). The CADD score for the variant is 22.7, and half of all previously published cases (12/24; Table 2) of WARS2-related disorders carry this variant (with the four new cases, it is 16/28, 57.1%; Table 2). Functional studies showed protein mislocalization due to the variant [3]. Table 2. WARS2 variants of the newly described patients and patients in the literature. Mutation Patients Families c.622G>T p.Glu208Ter 1 3.6% 1 4.3% c.1054G>A p.Glu352Lys 1 3.6% 1 4.3% c.134G>T p.Gly45Val 1 3.6% 1 4.3% c.231C>G p.His77Gln 1 3.6% 1 4.3% c.487C>T p.Leu163Phe 1 3.6% 1 4.3% c.679A>G p.Met227Val 1 3.6% 1 4.3% c.683C>G p.Ser228Trp 1 3.6% 1 4.3% c.532G>C p.Val178Leu 1# 3.6% 1 4.3% c.1045G>A p.Val349Leu 1 3.6% 1 4.3% c.346C>T p.Gln116Ter 1 3.6% 1 4.3% c.349-1G>A Splice alteration 1 3.6% 1 4.3% c.475A>C p.Thr159Pro 1 3.6% 1 4.3% c.149G>A p.Gly50Asp 2 7.1% 2 8.7% c.325delA p.Ser109Alafs*159 2 7.1% 1 4.3% c.298_300delCTT p.Leu100del 3 10.7% 2 8.7% c.91-8725_348+27116del36099 p.Lys31_Gln116del 3 10.7% 2 8.7% c.833T>G p.Val278Gly 3 10.7% 2 8.7% c.797delC p.Pro266Argfs*10 5 17.9% 3 13.0% c.938A>T p.Lys313Met 9 32.1% 7 30.4% c.37T>G p.Trp13Gly 16 57.1% 9 39.1% Variants in bold are carried by patients reported in this paper. # Patient is homozygous for this variant. c.938A>T p.Lys313Met 9 32.1% 7 c.37T>G p.Trp13Gly 16 57.1% 9 Variants in bold are carried by patients reported in this paper. #Patient is homozygous for ant. Genes 2023, 14, 822 7 of 11 P1 and P2 carry an additional truncating variant. The c.797delC variant of P ing in a change of Proline to Arginine at position 266 with termination of the am P1 and P2 carry an additional truncating variant. The c.797delC variant of P1, resulting sequence at position 276, is classified as pathogenic according to ACMG and w in a change of Proline to Arginine at position 266 with termination of the amino acid ously published sequence in four at position 276, patients. is classified The c.346C>T as pathogenic according variant to ACMG ofand P2 was is classified previouslyas likel genic and published waspatients. in four not previously The c.346C>Tdescribed. variant ofThis P2 is variant classifiedresults as likelyin the terminatio pathogenic and was not previously described. amino acid sequence at position 116. This variant results in the termination of the amino acid sequence at position 116. The novel splice site variant c.349-1G>A in P3 is classified as likely pathog The novel splice site variant c.349-1G>A in P3 is classified as likely pathogenic and thesequencing the sequencing of cDNA of cDNA showed showed the skipping the skipping of exon of exon 3 and 3 and 4 in half 4 transcripts of the in half of the tra (Figure (Figure 2). 2). Figure 2. cDNA sequencing of P3 (A) and M3 ((B); does not carry the c.349-1G>A variant) with skip- ping of exon 3 and 4 in P3 and skipping of exon 4 only in M3 (alternative transcript, NM_001378231.1). In P4, the novel second missense variant c.475A>C is classified as VUS, but with a CADD score of 24, is not listed in gnomAD and is predicted to be disease causing by MutationTaster. Based on the compound heterozygous state of the detected variants and the clinical presentation in line with the previously described phenotypes (Table 1), a diagnosis of WARS2-releated disorder was made in all four patients. 3.3. Mitochondrial Integrity After staining the mitochondrial network in the cultured fibroblasts of controls as well as of P1 and P2 with anti-GRP75, the dissolvement of mitochondrial integrity and mitochondrial branching after paraquat treatment was more pronounced in the patients’ fibroblasts (Figure 3). 3.4. Respiratory Chain and WARS2 Level A Western blot of the mitochondrially encoded Cytochrome C Oxidase II (MT-CO2) as part of the complex IV of the reparatory chain showed an increased expression of MT- CO2 in P1 and P2 compared to the controls, as well as a less pronounced increase in M1 with the truncating variant and normal values in F1 with the missense change (Figure 4). Western blots with the anti-WARS2 antibodies only showed unspecific bands without a clear band at the expected level of 24.8 kD (see Supplementary Figure S1) and thus could not be analyzed. presentation in line with the previously described phenotypes (Table 1), a diagnosis of WARS2-releated disorder was made in all four patients. 3.3. Mitochondrial Integrity After staining the mitochondrial network in the cultured fibroblasts of controls as well as of P1 and P2 with anti-GRP75, the dissolvement of mitochondrial integrity and Genes 2023, 14, 822 8 of 11 mitochondrial branching after paraquat treatment was more pronounced in the patients’ fibroblasts (Figure 3). Genes 2023, 14, x FOR PEER REVIEW 9 of 12 with the truncating variant and normal values in F1 with the missense change (Figure 4). Western blots with the anti-WARS2 antibodies only showed unspecific bands without a Figure 3. Representative clear band at the expectedpictures levelof immunostaining of 24.8 kD (see of cultured fibroblasts Supplementary with1)GRP75 Figure of a control and thus could (A,D), beP1analyzed. not Figure (B,E), and P2 (C,F) 3. Representative before pictures (A–C) and after of immunostaining paraquat of cultured treatment fibroblasts (D–F). with GRP75 of a control (A,D), P1 (B,E), and P2 (C,F) before (A–C) and after paraquat treatment (D–F). 3.4. Respiratory Chain and WARS2 Level A Western blot of the mitochondrially encoded Cytochrome C Oxidase II (MT-CO2) as part of the complex IV of the reparatory chain showed an increased expression of MT- CO2 in P1 and P2 compared to the controls, as well as a less pronounced increase in M1 Figure 4. Analysis of the mitochondrially encoded Cytochrome C Oxidase II protein. (A) Repre- Figure 4. Analysis of the mitochondrially encoded Cytochrome C Oxidase II protein. (A) Representa- sentative Western blot for three controls (C1–C3), two biallelic patients (P1, P2), and two heterozy- tive Western blot for three controls (C1–C3), two biallelic patients (P1, P2), and two heterozygous gous unaffected relatives (M1, F1) showing protein levels of MT-CO2, which is increased in the pa- unaffected tients and inrelatives M1 when (M1, F1) showing compared to theprotein levels controls. of MT-CO2, Beta-actin which as was stained is increased in the a control for equalpatients load- and ing. (B) Quantification of the signals from three Western blots was performed by analyzingloading. in M1 when compared to the controls. Beta-actin was stained as a control for equal the in- (B) Quantification tensity and volume of of thethe signals bandsfrom three using Western Image Lab 6.1blots was performed (Bio-Rad). Ratio of by analyzing MT-CO2 andthe intensity β-actin was calculated first, followed by the mean value of all controls, which was standardized and volume of the bands using Image Lab 6.1 (Bio-Rad). Ratio of MT-CO2 and β-actin was calculated as 1. Mean val- ues of patients (P1 and P2) and relatives (M1 and F1) are given as ratio to controls. Error first, followed by the mean value of all controls, which was standardized as 1. Mean values of patientsbars: stand- ardand (P1 deviation. P2) andLight gray:(M1 relatives wildand type; F1)dark gray: heterozygous are given carriers as ratio to controls. (parents); Error black: biallelic bars: standard car- deviation. riers (patients). Light gray: wild type; dark gray: heterozygous carriers (parents); black: biallelic carriers (patients). 4. Discussion In this study, we present four new patients with an early-onset tremor–parkinsonism syndrome, who were identified to have a WARS2-related disorder. All patients carried a recurrent, quite common missense variant and responded well to levodopa. Furthermore, Genes 2023, 14, 822 9 of 11 4. Discussion In this study, we present four new patients with an early-onset tremor–parkinsonism syndrome, who were identified to have a WARS2-related disorder. All patients carried a recurrent, quite common missense variant and responded well to levodopa. Furthermore, we show an effect on splicing of the first reported intronic splice site WARS2 variant. We also demonstrate impaired mitochondrial integrity and alterations of the protein levels of components of the mitochondrial respiratory chain. Previous studies showed divergent results when investigating the enzyme activity and protein levels of the different subunits of the mitochondrial chain. Complex II was normal in all biosamples (fibroblast, liver biopsy, muscle biopsy, neuroepithelial-like stem cells) in all 10 investigated patients, most likely due to the fact that complex II is entirely nuclear-encoded [4–8,12]. Complex I and III were reported to be reduced in one case in patient-derived fibroblasts [4], while in the liver biopsy of another patient, only complex I was reduced [8]. In all other biosamples of patients, both complex I and III were unim- paired [5,6,12]. Complex IV was the complex most often reported as reduced in the form of the reduction of the subunit MTCO2 in fibroblasts [4,5], liver biopsy [7] and neuroepithelial- like stem cells [8], but there were also reports of normal levels [5,6,12]. In our tested patients (P1 and P2), we found an increase in MTCO2 protein levels of about 50% compared to the controls, with the heterozygous parents having either normal MTCO2 levels or slightly elevated levels. This increase is most likely a compensating mechanism of the impaired mitochondrial respiratory chain. Previous studies of the enzyme activity of the respira- tory chain showed a similar diversity, with normal results in fibroblasts [5,8] and muscle biopsies [6] as well as pathological results in fibroblasts [12], liver biopsies [5,7], muscle biopsies [5], and neuroepithelial-like stem cells [8]. We also investigated the mitochondrial integrity of the patient-derived fibroblasts and found an altered mitochondrial network with reduced mitochondrial branching as a sign of impaired mitochondrial integrity caused by pathogenic WARS2 variants. Overall, further functional studies in WARS2 are needed to determine the exact mechanism of mitochondrial impairment and the effects on mitochon- drial function. For this, the generation of specific WARS2 antibodies to detect the protein on the endogenous level is warranted. Since the original reports of the first WARS2 patients in 2017 with predominant cogni- tive impairment [3–5], an increasing number of patients with a predominant movement disorder phenotype have been added to the literature [6,12–14], resulting in a broad phe- notypical spectrum, typical for mitochondrial disorders. While cognitive impairment is still the most commonly reported feature (in 67% of all patients), dystonia (at least 50%), tremor (at least 38%), and parkinsonism (at least 21%) are often present in patients with WARS2-related disorder. However, the clinical data available are still scarce. Our four patients all had a predominant movement disorder phenotype including tremor (4/4), parkinsonism (4/4), and dystonia (3/4), which might also be linked to the recruitment strategy (all patients were evaluated within an ERN-RND (European Reference Network for Rare Neurological Diseases) initiative with a focus on movement disorders). Notably, all patients improved with levodopa therapy. This makes WARS2-related disorder an important differential diagnosis in patients with early-onset dystonia, tremor, and/or parkinsonism with a good treatment option. The recent increase in reported WARS2-related disorder cases suggests it to be an underdiagnosed and underreported disorder. One factor contributing to the suspected underdiagnosis of WARS2-related disorder is the recurrent variant NM_015836.4: c.37T>G; p.Trp13Gly, which all four of our patients carried as well as half of the previously reported patients. The p.Trp13Gly variant is re- ported in six homozygous carriers in gnomAD [23], which might lead to discarding this variant as a disease-causing variant if one is oblivious to its role in WASR2-releated disorder in the compound heterozygous state. The variant has been classified as a hypomorphic variant [13,14], a variant that is only disease causing in the case of compound heterogenicity when coupled with another disease-causing variant and not harmful in the case of homozy- gosity. Patients carrying this hypomorphic variant in combination with a missense variant Genes 2023, 14, 822 10 of 11 seem to have a milder form [13] with a later onset (mean 4 years compared to <1 year) in most cases, with patient P4 being one, but not the only exception [12,14]. Awareness of this specific variant therefore is important to diagnose patients with WARS2-related disease. 5. Conclusions In summary, we report four patients with an early-onset tremor–parkinsonism syn- drome due to biallelic WARS2 variants. All patients carried the same missense variant on one allele and responded well to levodopa. Supplementary Materials: The following supporting information can be downloaded at: https: //www.mdpi.com/article/10.3390/genes14040822/s1, Video S1: Examination of P1 Deskription: Examination of P1 at the age of 19 years showing voice tremor, rest tremor, postural tremor and action tremor as well as generalized dystonia. Figure S1: Representative Western blot for three controls (C1–C3), two biallelic patients (P1, P2), and two heterozygous unaffected relatives (M1, F1) showing unspecific bands without a clear band at the expected level of 24.8 kD. Beta-actin was stained as a control for equal loading. Author Contributions: Conceptualization, M.G.P. and K.L.; investigation, M.G.P., G.C.K., S.H.D., A.G., A.C.-G., B.P.-D., V.G., A.M. (Alfons Macaya), A.T.S.A., B.P., I.B.B., A.M. (Aleš Maver), A.M. (Alexander Münchau), and K.L.; writing—original draft preparation, M.G.P.; writing—review and editing, G.C.K., S.H.D., A.G., A.C.-G., B.P-D., V.G., A.M. (Alfons Macaya), A.T.S.A., B.P., I.B.B., A.M. (Aleš Maver), A.M. (Alexander Münchau), and K.L.; visualization, M.G.P. and A.G. All authors have read and agreed to the published version of the manuscript. Funding: M.G.P. was supported by the German Research Foundation (DFG) via the Clinician Scientist Program of the Clinical Scientist School Lübeck (CSSL) (DFG-GEPRIS 413535489). A.M. and K.L. were supported by the Damp Stiftung. The exome sequencing of P1 and family members was supported by the “Gutes tun” foundation of the University Hospital Schleswig Holstein. The exome sequencing of P2 and family members was supported by Instituto de Salud Carlos III, grant No. PI21/00248. The SolveRD project received funding from the European Union’s Horizon 2020 research and innovation program under grant agreement No. 779257. This study makes use of data shared/provided through RD-Connect, which received funding from the European Union Seventh Framework Programme (FP7/2007-2013) under grant agreement No. 305444. Institutional Review Board Statement: The study was approved by the ethics committee of the University of Luebeck (04-155 and 05-030) and was conducted in accordance with the Declaration of Helsinki. Informed Consent Statement: Informed consent was obtained from all subjects involved in the study. Written informed consent was obtained from the patients for publication. Data Availability Statement: The raw data supporting the conclusions of this article will be made available by the authors upon reasonable request. Acknowledgments: We would like to thank the patients and their families for participating in this study. We would also like to thank Frauke Hinrichs and Kirstin Plötze-Martin for their technical assistance. Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results. References 1. Martinez-Dominguez, M.T.; Justesen, J.; Kruse, T.A.; Hansen, L.L. Assignment of the Human Mitochondrial Tryptophanyl-TRNA Synthetase (WARS2) to 1p13.3–>p13.1 by Radiation Hybrid Mapping. Cytogenet. Cell Genet. 1998, 83, 249–250. [CrossRef] [PubMed] 2. Ognjenović, J.; Simonović, M. Human Aminoacyl-TRNA Synthetases in Diseases of the Nervous System. RNA Biol. 2018, 15, 623–634. [CrossRef] [PubMed] 3. Musante, L.; Püttmann, L.; Kahrizi, K.; Garshasbi, M.; Hu, H.; Stehr, H.; Lipkowitz, B.; Otto, S.; Jensen, L.R.; Tzschach, A.; et al. Mutations of the Aminoacyl-TRNA-Synthetases SARS and WARS2 Are Implicated in the Etiology of Autosomal Recessive Intellectual Disability: MUSANTE ET AL. Hum. Mutat. 2017, 38, 621–636. [CrossRef] [PubMed] Genes 2023, 14, 822 11 of 11 4. Theisen, B.E.; Rumyantseva, A.; Cohen, J.S.; Alcaraz, W.A.; Shinde, D.N.; Tang, S.; Srivastava, S.; Pevsner, J.; Trifunovic, A.; Fatemi, A. Deficiency of WARS2, Encoding Mitochondrial Tryptophanyl TRNA Synthetase, Causes Severe Infantile Onset Leukoencephalopathy. Am. J. Med. Genet. Part A 2017, 173, 2505–2510. [CrossRef] 5. Wortmann, S.B.; Timal, S.; Venselaar, H.; Wintjes, L.T.; Kopajtich, R.; Feichtinger, R.G.; Onnekink, C.; Mühlmeister, M.; Brandt, U.; Smeitink, J.A.; et al. Biallelic Variants in WARS2 Encoding Mitochondrial Tryptophanyl-TRNA Synthase in Six Individuals with Mitochondrial Encephalopathy. Hum. Mutat. 2017, 38, 1786–1795. [CrossRef] [PubMed] 6. Burke, E.A.; Frucht, S.J.; Thompson, K.; Wolfe, L.A.; Yokoyama, T.; Bertoni, M.; Huang, Y.; Sincan, M.; Adams, D.R.; Taylor, R.W.; et al. Biallelic Mutations in Mitochondrial Tryptophanyl-TRNA Synthetase Cause Levodopa-Responsive Infantile-Onset Parkinsonism. Clin. Genet. 2018, 93, 712–718. [CrossRef] 7. Vantroys, E.; Smet, J.; Vanlander, A.V.; Vergult, S.; De Bruyne, R.; Roels, F.; Stepman, H.; Roeyers, H.; Menten, B.; Van Coster, R. Severe Hepatopathy and Neurological Deterioration after Start of Valproate Treatment in a 6-Year-Old Child with Mitochondrial Tryptophanyl-TRNA Synthetase Deficiency. Orphanet. J. Rare Dis. 2018, 13, 80. [CrossRef] 8. Maffezzini, C.; Laine, I.; Dallabona, C.; Clemente, P.; Calvo-Garrido, J.; Wibom, R.; Naess, K.; Barbaro, M.; Falk, A.; Don- nini, C.; et al. Mutations in the Mitochondrial Tryptophanyl-tRNA Synthetase Cause Growth Retardation and Progressive Leukoencephalopathy. Mol. Genet. Genomic. Med. 2019, 7, e654. [CrossRef] 9. Nogueira, C.; Silva, L.; Pereira, C.; Vieira, L.; Leão Teles, E.; Rodrigues, E.; Campos, T.; Janeiro, P.; Gaspar, A.; Dupont, J.; et al. Targeted next Generation Sequencing Identifies Novel Pathogenic Variants and Provides Molecular Diagnoses in a Cohort of Pediatric and Adult Patients with Unexplained Mitochondrial Dysfunction. Mitochondrion 2019, 47, 309–317. [CrossRef] 10. Virdee, M.; Swarnalingam, E.; Kozenko, M.; Tarnopolsky, M.; Jones, K. Expanding the Phenotype: Neurodevelopmental Disorder, Mitochondrial, With Abnormal Movements and Lactic Acidosis, With or Without Seizures (NEMMLAS) Due to WARS2 Biallelic Variants, Encoding Mitochondrial Tryptophanyl-TRNA Synthase. J. Child Neurol. 2019, 34, 778–781. [CrossRef] 11. Hübers, A.; Huppertz, H.; Wortmann, S.B.; Kassubek, J. Mutation of the WARS2 Gene as the Cause of a Severe Hyperkinetic Movement Disorder. Mov. Disord. Clin. Pract. 2020, 7, 88–90. [CrossRef] 12. Martinelli, S.; Cordeddu, V.; Galosi, S.; Lanzo, A.; Palma, E.; Pannone, L.; Ciolfi, A.; Di Nottia, M.; Rizza, T.; Bocchinfuso, G.; et al. Co-Occurring WARS2 and CHRNA6 Mutations in a Child with a Severe Form of Infantile Parkinsonism. Park. Relat. Disord. 2020, 72, 75–79. [CrossRef] 13. Ilinca, A.; Kafantari, E.; Puschmann, A. A Relatively Common Hypomorphic Variant in WARS2 Causes Monogenic Disease. Park. Relat. Disord. 2022, 94, 129–131. [CrossRef] 14. Skorvanek, M.; Rektorova, I.; Mandemakers, W.; Wagner, M.; Steinfeld, R.; Orec, L.; Han, V.; Pavelekova, P.; Lackova, A.; Kulcsarova, K.; et al. WARS2 Mutations Cause Dopa-Responsive Early-Onset Parkinsonism and Progressive Myoclonus Ataxia. Park. Relat. Disord. 2022, 94, 54–61. [CrossRef] [PubMed] 15. Zurek, B.; Ellwanger, K.; Vissers, L.E.L.M.; Schüle, R.; Synofzik, M.; Töpf, A.; de Voer, R.M.; Laurie, S.; Matalonga, L.; Gilissen, C.; et al. Solve-RD: Systematic Pan-European Data Sharing and Collaborative Analysis to Solve Rare Diseases. Eur. J. Hum. Genet. 2021, 29, 1325–1331. [CrossRef] [PubMed] 16. Matalonga, L.; Hernández-Ferrer, C.; Piscia, D.; Cohen, E.; Solve-RD SNV-indel Working Group; Cuesta, I.; Danis, D.; Denommé- Pichon, A.-S.; Duffourd, Y.; Gilissen, C.; et al. Solving Patients with Rare Diseases through Programmatic Reanalysis of Genome-Phenome Data. Eur. J. Hum. Genet. 2021, 29, 1337–1347. [CrossRef] [PubMed] 17. Lochmüller, H.; Badowska, D.M.; Thompson, R.; Knoers, N.V.; Aartsma-Rus, A.; Gut, I.; Wood, L.; Harmuth, T.; Durudas, A.; Graessner, H.; et al. RD-Connect, NeurOmics and EURenOmics: Collaborative European Initiative for Rare Diseases. Eur. J. Hum. Genet. 2018, 26, 778–785. [CrossRef] 18. Kopanos, C.; Tsiolkas, V.; Kouris, A.; Chapple, C.E.; Albarca Aguilera, M.; Meyer, R.; Massouras, A. VarSome: The Human Genomic Variant Search Engine. Bioinformatics 2019, 35, 1978–1980. [CrossRef] 19. Kircher, M.; Witten, D.M.; Jain, P.; O’Roak, B.J.; Cooper, G.M.; Shendure, J. A General Framework for Estimating the Relative Pathogenicity of Human Genetic Variants. Nat. Genet. 2014, 46, 310–315. [CrossRef] 20. Steinhaus, R.; Proft, S.; Schuelke, M.; Cooper, D.N.; Schwarz, J.M.; Seelow, D. MutationTaster2021. Nucleic Acids Res. 2021, 49, W446–W451. [CrossRef] 21. Diaw, S.H.; Ganos, C.; Zittel, S.; Plötze-Martin, K.; Kulikovskaja, L.; Vos, M.; Westenberger, A.; Rakovic, A.; Lohmann, K.; Dulovic-Mahlow, M. Mutant WDR45 Leads to Altered Ferritinophagy and Ferroptosis in β-Propeller Protein-Associated Neu- rodegeneration. IJMS 2022, 23, 9524. [CrossRef] [PubMed] 22. Grünewald, A.; Voges, L.; Rakovic, A.; Kasten, M.; Vandebona, H.; Hemmelmann, C.; Lohmann, K.; Orolicki, S.; Ramirez, A.; Schapira, A.H.V.; et al. Mutant Parkin Impairs Mitochondrial Function and Morphology in Human Fibroblasts. PLoS ONE 2010, 5, e12962. [CrossRef] [PubMed] 23. Karczewski, K.J.; Francioli, L.C.; Tiao, G.; Cummings, B.B.; Alföldi, J.; Wang, Q.; Collins, R.L.; Laricchia, K.M.; Ganna, A.; Birnbaum, D.P.; et al. The Mutational Constraint Spectrum Quantified from Variation in 141,456 Humans. Nature 2020, 581, 434–443. [CrossRef] [PubMed] Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.