TYPE Original Research PUBLISHED 21 April 2023 DOI 10.3389/fimmu.2023.1130052 G protein-coupled receptor 183 OPEN ACCESS mediates the sensitization of EDITED BY Simone Ferrero, University of Turin, Italy Burkitt lymphoma tumors to REVIEWED BY Maria Teresa Scupoli, CD47 immune checkpoint University of Verona, Italy Ali Roghanian, University of Southampton, blockade by anti-CD20/PI3Kdi United Kingdom *CORRESPONDENCE dual therapy Gael Roué groue@carrerasresearch.org Marcelo Lima Ribeiro 1,2†, Núria Profitós-Pelejà 1†, † These authors have contributed equally to this work and share Juliana Carvalho Santos 1†, Pedro Blecua 3, Diana Reyes-Garau 1, first authorship Marc Armengol 1,4, Miranda Fernández-Serrano 1,4, SPECIALTY SECTION Hari P. Miskin 5, Francesc Bosch 4,6,7, Manel Esteller 3,8,9, This article was submitted to Cancer Immunity Emmanuel Normant 5 and Gael Roué 1,4,6,7* and Immunotherapy, a section of the journal 1 Lymphoma Translational Group, Josep Carreras Leukemia Research Institute, Badalona, Spain, Frontiers in Immunology 2 Laboratory of Immunopharmacology and Molecular Biology, Sao Francisco University Medical School, Braganca Paulista, São Paulo, Brazil, 3 Cancer Epigenetics Group, Josep Carreras Leukemia RECEIVED 22 December 2022 Research Institute, Badalona, Spain, 4 Department of Biochemistry and Molecular Biology, ACCEPTED 10 April 2023 Autonomous University of Barcelona, Barcelona, Spain, 5 TG Therapeutics, New York, NY, United States, PUBLISHED 21 April 2023 6 Department of Hematology, Vall d’Hebron University Hospital, Barcelona, Spain, 7Experimental CITATION Hematology, Vall d’Hebron Institute of Oncology, Barcelona, Spain, 8Centro de Investigación Biomédica Ribeiro ML, Profitós-Pelejà N, Santos JC, en Red de Cáncer (CIBERONC), Instituto de Salud Carlos III, Barcelona, Spain, 9Instituciò Catalana de Blecua P, Reyes-Garau D, Armengol M, Recerca i Estudis Avançats (ICREA), Barcelona, Spain Fernández-Serrano M, Miskin HP, Bosch F, Esteller M, Normant E and Roué G (2023) G protein-coupled receptor 183 mediates the sensitization of Burkitt lymphoma tumors to CD47 immune checkpoint Background: Immunotherapy-based regimens have considerably improved the blockade by anti-CD20/PI3Kdi survival rate of B-cell non-Hodgkin lymphoma (B-NHL) patients in the last dual therapy. Front. Immunol. 14:1130052. decades; however, most disease subtypes remain almost incurable. TG-1801, a doi: 10.3389/fimmu.2023.1130052 bispecific antibody that targets CD47 selectively on CD19+ B-cells, is under COPYRIGHT clinical evaluation in relapsed/refractory (R/R) B-NHL patients either as a single- © 2023 Ribeiro, Profitós-Pelejà, Santos, agent or in combination with ublituximab, a new generation CD20 antibody. Blecua, Reyes-Garau, Armengol, Fernández- Serrano, Miskin, Bosch, Esteller, Normant and Roué. This is an open-access article Methods: A set of eight B-NHL cell lines and primary samples were cultured in distributed under the terms of the Creative vitro in the presence of bone marrow-derived stromal cells, M2-polarized Commons Attribution License (CC BY). The primary macrophages, and primary circulating PBMCs as a source of effector use, distribution or reproduction in other forums is permitted, provided the original cells. Cell response to TG-1801 alone or combined with the U2 regimen author(s) and the copyright owner(s) are associating ublituximab to the PI3Kd inhibitor umbralisib, was analyzed by credited and that the original publication in this journal is cited, in accordance with proliferation assay, western blot, transcriptomic analysis (qPCR array and RNA accepted academic practice. No use, sequencing followed by gene set enrichment analysis) and/or quantification of distribution or reproduction is permitted antibody-dependent cell death (ADCC) and antibody-dependent cell which does not comply with these terms. phagocytosis (ADCP). CRISPR-Cas9 gene edition was used to selectively abrogate GPR183 gene expression in B-NHL cells. In vivo, drug efficacy was determined in immunodeficient (NSG mice) or immune-competent (chicken embryo chorioallantoic membrane (CAM)) B-NHL xenograft models. Results: Using a panel of B-NHL co-cultures, we show that TG-1801, by disrupting the CD47-SIRPa axis, potentiates anti-CD20-mediated ADCC and Frontiers in Immunology 01 frontiersin.org Ribeiro et al. 10.3389/fimmu.2023.1130052 ADCP. This led to a remarkable and durable antitumor effect of the triplet therapy composed by TG-1801 and U2 regimen, in vitro, as well as in mice and CAM xenograft models of B-NHL. Transcriptomic analysis also uncovered the upregulation of the G protein-coupled and inflammatory receptor, GPR183, as a crucial event associated with the efficacy of the triplet combination. Genetic depletion and pharmacological inhibition of GPR183 impaired ADCP initiation, cytoskeleton remodeling and cell migration in 2D and 3D spheroid B-NHL co- cultures, and disrupted macrophage-mediated control of tumor growth in B- NHL CAM xenografts. Conclusions: Altogether, our results support a crucial role for GPR183 in the recognition and elimination of malignant B cells upon concomitant targeting of CD20, CD47 and PI3Kd, and warrant further clinical evaluation of this triplet regimen in B-NHL. KEYWORDS B-NHL, immune checkpoint blockade, drug combination, ADCP, M1 macrophage, 3D spheroid, CAM assay, inflammatory receptor 1 Introduction neoplasms, in which this factor is both an adverse prognostic indicator and a valid anti-cancer target with several therapeutic Immunotherapy regimens based on checkpoint inhibitors, antibodies currently being tested in clinical trials. In B-cell tumour vaccination, immune cell-based therapy and cytokines, lymphoma, these trials frequently involve a combination with utilize the power and specificity of the host’s immune system anti-CD20 therapy, to ensure a proper engagement of the Fc against cancer and have become one of the most promising receptors at the surface of macrophages and natural killer (NK) therapeutic interventions in oncology (1). This holds particularly effector cells. The anti-CD20 mAb rituximab has been the most true in B-cell lymphoma, with the considerable advances recently common IgG1 antibody tested in this setting, and has demonstrated achieved by PD1/PD-L1, CAR-T cell therapies and CD3/CD20 combinatorial activity in both indolent and aggressive entities (7, 8). bispecific antibodies, in heavily pre-treated patients (2). Prior to However, as CD47 is widely expressed on the surface of a broad these new approaches, combining therapeutic (i.e. anti-CD20) range of cell types, including erythrocytes and platelets, a major antibodies with conventional chemotherapy have marked a limitation of CD47 blocking agents is the target-mediated drug milestone in the treatment of these diseases, although treatment disposition and the potential side effects, which include anaemia toxicity and counteracting effects of the tumor-supportive or thrombocytopenia. microenvironment that affect the efficacy of immunotherapies, TG-1801 (also known as NI-1701) is a fully human IgG1 anti- remained a challenge in a significant proportion of patients (3). CD47xCD19 bispecific antibody with the whole spectrum of Fc- Among the entities that benefited the most from the venue of anti- mediated effector function, and that binds CD47 with sub- CD20 agents, Burkitt lymphoma (BL) is a rare and highly malignant micromolar affinity and CD19 with a sub-nanomolar affinity. type of B-cell lymphoma that accounts for approximately 50% of This thousand-fold difference between its affinity to these non-Hodgkin lymphoma (B-NHL) in children and adolescents (4). antigens allows TG-1801 to bind selectively to CD19-positive B In 85% of the cases, BL is molecularly defined by the overexpression cells in vitro and in vivo, including malignant B cells, but not CD19- of the oncogene MYC caused by the translocation of 8q24 region to negative red blood cells or platelets (9–11). TG-1801 is currently the immunoglobulin heavy chain locus (14q32) (5). Among the being tested clinically as a single agent and in combination with the different immunological targets currently under evaluation on BL, glyco-engineered CD20 antibody, ublituximab, in patients with R/R cluster of differentiation 47 (CD47), also known as integrin- B-cell lymphoma (NCT04806035). associated protein (IAP), is a cell surface receptor that is part of In parallel, pre-clinical and clinical data have provided a rationale the immunoglobulin superfamily, and which interacts with the for the combination of anti-CD20 antibody with PI3Kd antagonists macrophage receptor signal regulatory protein-alpha (SIRPa). in B-cell malignancies, mediated by the capacity of these latter to This interaction sends a “do-not-eat-me” signal to macrophages, potentiate CD20-mediated direct cell death (12). Clinical efficacy and which mediates immune evasion in several types of cancers, from safety of this combinatorial approach has been confirmed in R/RB- both hematological and non-hematological origin (6). High levels of NHL and chronic lymphocytic leukaemia (CLL) patients (13). CD47 have indeed been observed in both lymphoid and myeloid Although the value of associating CD20 mAb therapy to CD47 Frontiers in Immunology 02 frontiersin.org Ribeiro et al. 10.3389/fimmu.2023.1130052 modulating agents has been well established in aggressive B-cell 2.3 Peripheral blood mononuclear cells lymphoma, both preclinically and clinically, two questions isolation and macrophage polarization remained unanswered. First, we still don’t known whether the addition of PI3K-targeting agents to those immunotherapeutic Peripheral blood mononuclear cells (PBMCs) were purified by regimens that contain checkpoint blockers could impact the standard Ficoll-Hypaque (GE Healthcare) gradient centrifugation efficacy of these latter. Second, beside rituximab which mainly from buffy coats of human healthy donors and cultured freshly in depletes B cell by complement fixation, it would be interesting to Advanced-RMPI 1640 medium supplemented with 5% heat- assess in these settings the efficacy of new generation anti-CD20 inactivated FBS, 2 mmol/L glutamine, 50 µg/mL penicillin- antibodies harbouring a glycoengineering Fc region and a higher streptomycin (Thermo Fisher). capacity to elicit ADCC. To investigate these two issues, we studied RosetteSep™ Human Monocyte Enrichment Cocktail (Stemcell the effect of the B-cell specific, CD47/CD19 immune checkpoint Technologies) was used to purify human monocytes from buffy blocker, TG-1801, in association with anti-CD20/PI3Kdi dual therapy coats following manufacturer specifications. For M1 or M2 in different in vitro and in vivo models of BL, as a disease model of macrophage polarization, the selected monocytes were cultured in aggressive B-NHL. complete Advanced-RMPI 1640 supplemented with either 20 ng/ mL human GM-CSF (PeproTech), for M1 differentiation, or 20 ng/ mL human M-CSF (PeproTech), for M2 differentiation, and 2 Materials and methods incubated for 6 days. On day 6 M0 macrophages were activated with 100 ng/mL human IFN-g (PeproTech) and 50 ng/mL LPS, for 2.1 Cell lines M1 macrophage polarization for 24 h. Three BL (Raji, Daudi, Ramos), two diffuse large B cell 2.4 Antibody-dependent cell-mediated lymphoma (DLBCL) (Pfeiffer, and Karpas-422 (Karpas)), one cytotoxicity and phagocytosis assays follicular lymphoma (FL) (RL), and one T-cell acute lymphoblastic leukemia (Jurkat) cell lines were used in this study. ADCC activity was assessed in B-cell lymphoma cell lines co- Cells were grown in Advanced-RMPI 1640 medium supplemented cultured for 4 hours with freshly obtained PBMCs (1:10, target: with 5% heat-inactivated FBS, 2 mmol/L glutamine, and 50 µg/mL effector), in the presence of 10 ng/mL TG-1801 +/- U2 dual assets penicillin-streptomycin (Thermo Fisher). All cultures were (10 µg/mL ublituximab + 1 µM umbralisib), using and a lactate routinely tested for mycoplasma infection by PCR and the deshydrogenease (LDH) release assay (Roche). Relative ADCC was identity of all cell lines was verified by using AmpFISTR identifier calculated using the following formula: ADCC percentage = kit (Thermo Fisher). [(sample release – spontaneous release)/(maximal release – spontaneous release)]*100. Spontaneous release, corresponding to target cells incubated 2.2 Occupancy assay with effector cells without antibody, was defined as 0% cytotoxicity, with maximal release (target cells lysed with 1% Triton X-100) Cytofluorimetric quantification of CD47 and CD19 membrane defined as 100% cytotoxicity. The average percentage of ADCC and levels was carried out in a panel of 10 B-NHL cell lines. Cells were standard deviations of the triplicates of each experiment stained with phycoerythrin (PE)-labelled anti-CD47 or anti-CD19 were calculated. antibodies (Becton Dickinson) and the absolute number of ADCP activity was assessed in B-cell lymphoma cell lines co- membrane-bound molecules of CD47 or CD19 was estimated cultured for 4 hours with M1-polarized macrophages (1:5, target: using QuantiBRITE PE beads (BD Biosciences) on a FACSCanto effector), in the presence of 10 ng/mL TG-1801 +/- U2 dual assets II (Becton Dickinson). Data were analysed using FlowJo software (10 µg/mL ublituximab + 1 µM umbralisib), using and the pHrodo- package (TreeStar, USA). stained B cells (IncuCyte® pHrodo® Red Cell Labelling Kit for For the detection of unbound surface CD47, Raji (CD19+), or Phagocytosis, Sartorius). Following phagocytosis assay, the non- Jurkat (CD19-) cells were stained with a PE-labelled anti-CD47 phagocytosed cells were removed by washing with PBS 2–3 times (B6H12 clone) or isotype control antibody (BD Biosciences). Cells and phagocytosis was analysed by fluorescent microscopy on an were pre-treated for 1 h with TG-1801 or an anti-human CD47 EVOS M5000 Cell Imaging Systems (Thermo Fisher). (B6H12 clone) control antibody. For quantification, a total of 10.000 events were acquired on a FACSCanto II (Becton Dickinson). Relative median fluorescence intensity (RMFI) was calculated using 2.5 Xenograft mouse model and tumor FlowJo software package as the ratio between CD47 and control immunophenotyping signal intensity. Shown are the percentages of occupancy, defined as the decreases in CD47 RMFI ratios evoked by anti-CD47-treatment, Eight-week-old NOD/SCID IL2Rg-null (NSG) male and female using untreated cells as a calibrator. B6H12 clone was used as a mice (Janvier Labs) were subcutaneously injected with Raji cells and CD19-independent positive control of CD47 occupancy. after two weeks tumor-bearing mice were randomized using Frontiers in Immunology 03 frontiersin.org Ribeiro et al. 10.3389/fimmu.2023.1130052 GraphPad Prism 9.0 software (GraphPad Software, Inc) and Positive Selection Kit II (StemCell Technologies) and the assigned to one of the following treatment arms (8-6 mice per biotinylated anti-CD20 antibody (BioLegend). Purified CD20+ group): TG-1801 (5 mg/kg, qw), ublituximab (5 mg/kg, qw) + cells, together with representative bulk Raji xenografts with > 95% umbralisib (U2) (150 mg/kg, bid), or the triplet (TG-1801 + U2), or tumor B cells were subjected to RNA-seq analysis according to an equal volume of vehicle for 17 days. Tumour volumes were previous procedures (14). Volcano plot showing the most relevant measured each 2-3 days with external callipers. The number of significantly differentially expressed genes between triplet and TG- animals used in each of the experimental groups is based on the 1801 treatments, with |Log2 fold change| > 1.5 and p-adj value < literature and previous results from the group (14). 0.01 (red dots). Grey, green and blue dots identified genes with Immunohistochemical staining of representative tumor specimens insignificant transcriptional and/or statistical variation. Briefly, the (n=3 per group) was performed using anti-CD20 (Sigma), anti- raw fastq RNAseq files of each condition were quality checked and GPR183 (Santa Cruz), anti-F4/80 (Abcam), anti-Histone H3- gene expression was estimated using Salmon software (https:// pSer10 (Abcam) and anti-CD56/NCAM-1 (Abcam) primary combine-lab.github.io/salmon/). Differential expression analysis antibodies, as previously described (14). Preparations were was then carried out using the negative binomial distribution evaluated using an Olympus BX53 microscope and (DESeq2 software, https://bioconductor.org/packages/release/bioc/ MicroManager software (Fiji, Plugin). html/DESeq2.html), accounting for and filtering the effects of the Immunohistochemical signal intensity was quantified in at least respective controls. Sequencing data have been deposited at the 5 pictures of two representative tumor specimens from the Raji Gene Expression Omnibus (GEO) of the National Center for xenograft model, using QuPath v.0.2.3 software developed at Biotechnology Information and are accessible through GEO Series Queen’s University (Belfast, Northern Ireland) (15). Cell detection accession GSE199413 at (https://www.ncbi.nlm.nih.gov/geo/query/ was conducted using QuPath’s built-in “Positive cell detection” by acc.cgi?acc=GSE199413). calculating the percent of positively stained cells in each field. Purified CD20+ cells, together with representative Raji xenografts were subjected to RNA extraction and qPCR validation. Briefly, total RNA was extracted using TRIZOL 2.6 Chicken embryo chorioallantoic (Thermo Fisher) following manufacturer’s instructions. One membrane model microgram of RNA was retrotranscribed to complementary DNA using Moloney murine leukemia virus reverse transcriptase Fertilized white Leghorn chicken eggs were purchased from (Thermo Fisher) and random hexamer primers (Roche). mRNA Granja Santa Isabel, S. L. (Có rdoba, Spain) and incubated for 9 days expression was analyzed in triplicate by quantitative real-time PCR at 37°C with 55% humidity. At day 9 of their embryonic and the relative expression of each gene was quantified by the development, eggs were cleaned with ethanol 70° and a window comparative cycle threshold method (DDCt) b-actin (Fw: GACGA of an approximate 2 cm-diameter was drilled on top of the air CATGGAGAAAATCTG, Rv: ATGATCTGGGTCATCTTCTC) chamber of the eggshell. Then, one million Raji-GPR183WT (n=10) were used as an endogenous control. The sequences used for the or Raji-GPR183KO (n=10) Raji cells per egg were resuspended in 25 primers are the following GPR183 (Fw: GACTG µL RPMI medium containing 10% FBS and 100 U/mL penicillin GAGAATCGGAGATGC, Rv: CAGCAATGAAGCGGTCAATA), and streptomycin (Thermo Fisher) and 25 µL Matrigel (BD CCL20 (Fw: CCAATGAAGGCTGTGACATCA, Rv: AGTCTGTTT Biosciences). The mix was incubated for 15 min at 37°C and TGGATTTGCGCA), IL8 (Fw: AAGGAAAACTGGGTGCAGAG, subsequently implanted into the CAM. The window was then Rv: GCTTGAAGTTTCACTGGCATC), CD68 (Fw: covered with a sterile tape and the eggs were placed back in the CCTCCAGCAGAAGGTTGTCT, Rv: CGAAGGGATGCATTCT incubator. At days 12 and 14 of their embryonic development, 10 GAGC), CCL4 (Fw: TTCCTCGCAATTTGTGGTA, Rv: ng/mL TG-1801 +/- U2 dual assets (10 µg/mL ublituximab + 1 µM GCTTGCTTCTTTTGGTTTGG), CCL7 (Fw: TGG AGA GCTA umbralisib) or vehicle diluted in RPMI medium were administered CAGAAGGACCA, Rv: GGGTCAGCACAGATCTCCTT), CXCL1 topically on the tumor-bearing CAMs. On the 15th day of (Fw: CATCCAAAGTGTGAACGTGAA, Rv: CTATGGGGGATG development (6 days post-implantation), chick embryos were CAGGATT), CXCL3, (Fw: CAAAGTGTGAATGTAAGGTCCCC, sacrificed by decapitation. Tumors were excised and carefully Rv: CGGGGTTGAGACAAGCTTTC) and CXCL10 (Fw: CCTGCA weighed to determine their mass. Immunohistochemical detection AGCCAATTTTGTCCA, Rv: TGGCCTTCGATTCTGGATTCA). and quantification of CD20 and GPR183 were carried out as above, in representative tumor specimens (n=3 per group). 2.8 Generation of Raji-GPR183KO cells 2.7 RNA sequencing analysis The generation of a CRISPR-Cas9 gene-editing tool was employed to edit the Raji parental cells line to create GPR183 Two BL cell lines (Daudi and Raji) and two BL primary samples knockout. 0.5 x 106 cells were electroporated on a Nucleofector II were co-cultured with the bone marrow stromal (BMSC) cell line, device (program A032, Lonza) with 36 pmol SpCas9 Nuclease V3, StromaNKterts, M2-polarized macrophages and PBMCs (4:1:1:1) in 44 pmol CRISPR-Cas9 tracRNA ATTO 550, 44 pmol Alt-R the presence of 10 ng/mL TG-1801 +/- U2. After a 24h incubation, CRISPR-Cas9 crRNA Hs.Cas9.GPR183.1.AA (GPR183 KO 5´- CD20+ target cells were isolated using the EasySep Human Biotin CAATGAAGCGGTCAATACTC AGG -3`) (IDT-Integrated Frontiers in Immunology 04 frontiersin.org Ribeiro et al. 10.3389/fimmu.2023.1130052 DNA Technologies). GPR183KO cells were resuspended in 96-well obtained prior to study initiation. Study procedures were conducted plates with a limiting dilution of 0.3 cells per well. Two GPR183KO in accordance with the Declaration of Helsinki. Buffy coats were biallelic clones were confirmed by Sanger Sequencing and western provided by the Blood and Tissue Bank of Catalonia (agreement blot. Raji-GPR183KO clones are available upon request. NE-A1-IJC). 2.9 Western blot analysis 2.13 Statistical analysis Total protein extracts were obtained from cell lines and tumor Presented data are the mean ± SD or SEM of 3 independent specimens using RIPA (Sigma-Aldrich) buffer and subjected to experiments. All statistical analyses were done by using GraphPad SDS-PAGE. Membrane-transferred proteins were revealed by Prism 9.0 software (GraphPad Software). Comparison between two incubating with primary and secondary antibodies followed by groups of samples was evaluated by nonparametric Mann–Whitney chemiluminescence detection using the ECL system (Pierce) and test to determine how the response is affected by 2 factors. Pearson a Fusion FX imaging system (Vilber Lourmat). Band intensity was test was used to assess the statistical significance of correlation. quantified using Image J software and normalized to housekeeping Results were considered statistically significant when p-value < 0.05. protein (GAPDH). Values were referred to the indicated control and added below the corresponding band. If not otherwise specified, representative data from n=2 experiments are shown. 3 Results 3.1 Anti-CD20/PI3Kdi dual asset cooperates 2.10 3D multicellular spheroid generation with CD47 blockade therapy in CD19+ B- cell tumors One hundred thousand Raji-GPR183WT or Raji-GPR183KO (clone#1) cells were then stained with Hoechst 33342 blue dye The CD47/CD19 bispecific antibody TG-1801 has recently been (Invitrogen) and cultivated in a conditional medium with 25.000 shown to trigger in vitro response against CD19+ tumors; however StromaNKtert-GFP cells for 2 days to generate the BL 3D spheroids. these studies did not determine the lowest effective concentrations Then, 25,000 M1-macrophages were stained with PKH26 red‐ of this antibody, which may be further used in combination fluorescent dye and added to 3D spheroid in the presence or approaches (11). To determine the best working concentrations of absence of 10 ng/mL TG-1801 +/- U2 (10 µg/mL ublituximab + 1 TG-1801 in vitro, we developed a CD47 occupancy assay using the µM umbralisib) for one more day. The M1-macrophages BL cell line Raji. In this assay, the bispecific CD47/CD19 antibody infiltration was evaluated by live-cell red fluorescence on the reached a similar CD47 occupancy compared with the first-in-class EVOS M5000 Cell Imaging Systems. CD47 blocking mAb, B6H12 (17) (Figure 1A, right panel and Supplemental Figure S1A). This difference may potentially be explained by the lower level of expression of CD19 compared to 2.11 Transwell migration assay and F-actin CD47 in the BL cell line (data not shown). As expected, TG-1801, staining but not B6H12-mediated target occupancy, was highly dependent on CD19 expression, as shown when using the T-ALL-derived, Briefly, Raji-GPR183WT, Raji-GPR183KO (clone#1) and Raji CD19-negative, Jurkat cells, in which no significant CD47 blockade parental cells exposed to the GPR183 inhibitor NIBR189 (Sigma- was detected with TG-1801 at doses as high as 2 µg/mL, contrasting Aldrich) were cultured for 1 h in culture medium w/o FBS but with the sustained binding of B6H12 at the same concentration supplemented with 0.5% bovine serum albumin (Sigma-Aldrich), in (Figure 1A, right and left panels). To evaluate the rationale for the presence or absence of 10 ng/mL TG-1801 +/- U2 combination, combining TG-1801 with ublituximab, a type 1 chimeric anti-CD20 and analyzed for CXCL12-dependent chemotaxis, as previously IgG1k mAb and the PI3Kd inhibitor umbralisib (U2 dual asset), described (16). Values were referred to cells cultured without Raji cells were exposed to these agents either alone or in CXCL12. F-actin levels were assessed after exposure to TG-1801 combination, and cultured in the presence of M1-polarized +/- U2, followed by staining with a TRITC-labelled phalloidin and macrophages or primary circulating PBMCs from healthy donors direct red fluorescence recording. as a source of effector cells, to assess ADCP or ADCC induction, respectively. As shown in Supplemental Figure S1B, the U2 combination triggered the highest levels of ADCC and ADCP, 2.12 Ethics displaying a 3-fold increase over the control and a significant increase in antibody-dependent cell death compared to both Animals were handled following protocols approved by the umbralisib and ublituximab alone. Subsequently, U2 combo was Animal Ethics Committee of the University of Barcelona (registry directly tested in association with TG-1801 at the previously num. 38/18). Institutional Review Board approvals for the study determined dose, and ADCP and ADCC levels were evaluated as protocol (ref PI-20-040), amendments, and written informed above in a panel of n=6 human B-cell lymphoma cell lines from consent documents from BL patients and healthy donors were either BL (Raji, Daudi and Ramos; Figure 1B), DLBCL (Pfeiffer and Frontiers in Immunology 05 frontiersin.org Ribeiro et al. 10.3389/fimmu.2023.1130052 A B C D E FIGURE 1 U2 regimen cooperates with CD47 blockade in in vitro and in vivo models of B-cell lymphoma. (A) FACS-mediated CD47 occupancy assay in the CD19+ Burkitt lymphoma cell line Raji, and in the CD19- T-ALL cells Jurkat, treated for 1h with different doses of TG-1801 or B6H12. Results are expressed in Relative median fluorescence intensity (RMFI) of the PE-labelled anti-CD47 antibody. Left panel is a dose-occupancy curve of Raji and Jurkat cell lines with different doses of TG-1801. Right panel is a comparison between TG-1801 and B6H12 at 2µg/ml (n=3). (B) ADCP (left panel) and ADCC (right panel) activities were assessed in three representative BL cell lines (N=3). Values are expressed as mean ± SD. (C) NOD/SCID IL2Rg- null (NSG) mice were inoculated subcutaneously with 107 Raji cells and after 14 days, tumour-bearing animals (n=6-8 mice per group) were orally dosed for 17 days with TG-1801 (5 mg/kg, qw), ublituximab (5 mg/kg, qw) + umbralisib (U2) (150 mg/kg, bid), the triplet (TG-1801 + U2), or an equal volume of vehicle. Tumour volumes were measured each 2-3 days with external callipers. (D) Mice with no tumour or low tumour size were kept alive for another 35 days. At day 52 all the mice either tumour-free (green) or bearing a small tumour (orange, < 100 mm3) were alive. The triplet combo group showed a higher number of tumour-free or low tumour burden-bearing mice. (E) Weight recording of Raji CAM-derived tumour at day 15 exposed to TG-1801, U2 or triplet combination (n=8-10 replicates per treatment group). * p<0.05, ** p<0.01, *** p<0.001, when compared to control group. # p<0.05, ## p<0.01 and ### p<0.001 when compared to TG-1801 alone. ns, non-significant. Karpas-422; Supplemental Figure S1C), or FL (RL; Supplemental to CD47/CD19 ratios (Supplemental Figure 1D), in accordance Figure S1C) origin. Although both biological processes were visibly with previous reports (10). To carry out an ad-hoc drug-drug potentiated in almost all of the cell lines exposed to the triplet interaction analysis, a new ADCP analysis was performed in the 3 treatment, a comparative analysis demonstrated that, in BL cell lines BL cell lines exposed to increasing doses of TG-1801 (5-10-20 ng/ both TG-1801 pro-cytotoxic and pro-phagocytic activities were ml), ublituximab (1-2-4 ng/ml) and umbralisib (0.5-1-2 µM), and potentiated (1.4- to 3.2-fold) by U2 addition, whereas only a the drug combination indexes (CI) were calculated using the Chou barely additive effect of the triplet combination on ADCC was and Talalay’s algorithm. As shown on Supplemental figure S1E, for observed in DLBCL- and FL-derived cell lines. Of note, this effect 20 out of the 27 different TG-1801/U2 combinations evaluated, the appeared to be related to neither the expression levels of CD47, nor CI value was ≤ 0.8, indicative of synergistic drug interaction. Frontiers in Immunology 06 frontiersin.org Ribeiro et al. 10.3389/fimmu.2023.1130052 Based on these results, we evaluated the activity of the TG-1801 1801/U2 combo (Figure 2C; Supplemental Figure S1G). A +U2 triplet combo in a BL (Raji-derived) mouse xenograft. In line comparable increase in GPR183 protein levels was also shown with our abovementioned observation, in tumor-bearing mice TG- using western blotting in the Raji and Daudi cell lines subjected 1801 and U2 exerted notable anti-lymphoma activities, with 76% to the same treatments (+49% and +43%, respectively; Figure 2D), and 89% tumor growth inhibition (TGI) at day 17 of treatment, and by immunohistochemistry (IHC) in representative tumors respectively (Figure 1C). Nonetheless, the activity of the triplet was from the two Raji xenograft models (mouse and CAM) dosed maximum as early as 7 days of treatment, reaching a 93% TGI at a with the triplet regimen (Figure 2E; Supplemental Figure S1H). time point where TG-1801 monotherapy was almost ineffective. GPR183 was first identified by sequence similarity as a GPCR This superior efficacy was maintained during the whole treatment induced by Epstein-Barr virus (EBV) infection. The upregulation of schedule (Figure 1C), with no detectable toxicity (data not shown). this pro-inflammatory receptor is associated with a better Of special interest, 2 out of 5 mice (40%) remained tumor-free 35 prognosis of DLBCL patients treated with the standard days after the last dose in the triplet arm, compared to the reduced immunochemotherapeutic (R-CHOP) regimen, according to rate of prolonged remission (12.5%) in the TG-1801 published gene array database (gse10846; R2: Genomics Analysis group (Figure 1D). and V isu alization Pla tform (http://r2. amc.nl ; http:// To pinpoint the effect of the triple combination, an r2platform.com)). In addition, GPR183 plays an important role in immunocompetent chicken chorioallantoic membrane (CAM)- B-cell motility and positioning during the germinal center reaction derived xenograft Raji model (18) was carried out (see (20, 21). The gradient of its natural ligand, oxysterol, acts as a experimental workflow in Supplemental Figure S1F). Similarly, to chemoattractant of GPR183+ cells. Interestingly, among a panel of the mouse model, in the Raji-derived CAM assay, both TG-1801 eight genes identified besides GPR183 in the two inflammation gene and U2 treatments inhibited 70% of tumor growth and the activity signatures, the transcript of another chemoattractant gene, CCL20, of the triplet was significantly higher (86% TGI, Figure 1E). was upregulated by the triplet combination in all in vitro and in vivo Altogether, these in vitro and in vivo data suggested that the models (Figure 2C). In addition, increased tumor infiltration of combination of CD47 checkpoint blockade therapy to dual CD20/ mouse and chicken macrophages in BL tumors, as revealed by IHC PI3K targeting evokes a mechanism that promotes a stronger and detection of the mouse antigen F4/80 and qPCR quantification of the prolonged innate immune response when compared to each agent chicken antigen MRCL1 (22), was accompanied by a loss of histone used separately. H3-pSer10 nuclear staining, suggestive of a consistent reduction in tumor mitotic index in animals subjected to triplet therapy, when compared to TG-1801 and U2 treatment arms (Figures 2E, F). 3.2 GPR183 is upregulated in response to CD47/CD20/PI3Kdi triplet treatment 3.3 GPR183 is required for B-cell trafficking To uncover the mechanisms underlying the superior effect of and macrophage-dependent phagocytosis the triplet vs anti-CD47/CD19 monotherapy, transcriptomic after the triplet treatment analyses were carried out on a set of six samples that included Raji mouse xenograft tumors (n=2) and CD20+ cells isolated from To investigate how the upregulation of GPR183 in cancer cells Raji, Daudi and two adult sporadic BL primary samples (one case could impact their recognition and phagocytosis by M1 with abdominal involvement and another case with bone marrow macrophages, two Raji-GPR183KO single-clones (clone #1 and involvement), co-cultured with the bone marrow-derived stromal clone #2) were generated by CRISPR/Cas9 gene editing cell line, stromaNKtert (19), M2-polarized primary macrophages, (Figure 3A) using previously described procedures (14). Cells primary circulating PBMCs, in the presence of either TG-1801 or from clone #1 were co-cultured for 24h with primary M1 TG-1801+U2 triplet. As shown in Figure 2A, a total of 20 genes macrophages and BMSCs in a conditioned medium to form were significantly up- or down-regulated in the triplet compared to functional 3D spheroids, as previously reported (23). Compared TG-1801 monotherapy, in all six samples and in both in vitro and in to their Raji-GPR183wt counterparts, the Raji-GPR183KO spheroids vivo settings. A gene set enrichment analysis (GSEA) of the same displayed a complete absence of M1 cell infiltration within the data identified inflammatory (NES=2.43, FDR=0) and TNFa- multicellular aggregates, both at basal levels and upon exposure to driven signatures (NES=2.43, FDR=0) as predominantly the triplet therapy (Figure 3B). Accordingly, ADCP activity was expressed upon treatment with the triplet combination, when abrogated in the Raji-GPR183KO cell cultures obtained from the two compared to TG-1801 single agent therapy, suggesting that the clones (Figure 3C, left panel) highlighting the critical role of stronger activity of the triplet was based on the activation of an GPR183 in the recruitment of macrophages after CD47/CD20/ immune-related antitumor effect. In the heatmap showing a set of PI3Kd triple targeting. ADCC was also compromised, although to a genes strongly activated in all six samples in the triplet group lower extent (Figure 3C, right panel). Supporting these results, (Figure 2B), the highest up-regulated gene in both signatures was global inflammatory signature, and especially CCL20 gene the G protein-coupled receptor 183 (GPR183, also known as overexpression, was not detected anymore in Raji-GPR183KO Epstein-Barr virus (EBV)-induced G protein-coupled receptor 2, (clone #1) co-cultures exposed to the triplet therapy (Figure 3D). EBI2). An increase in GPR183 mRNA was confirmed by qPCR after To evaluate whether a functional GPR183 was required for the a 4-hour and a 24-hour incubation of the four cell lines with TG- triplet drug interaction, Raji cells were exposed for 1 hour to the Frontiers in Immunology 07 frontiersin.org Ribeiro et al. 10.3389/fimmu.2023.1130052 A B C D F E FIGURE 2 Upregulation of GPR183 is a hallmark of U2 and TG-1801 combinational effect in vitro and in vivo. (A) Volcano plot showing the most relevant significantly differentially expressed genes between triplet and TG-1801 treatments in n=6 BL samples (two cell lines, two primary samples and two representative Raji xenografts specimens). Genes undergoing a similar modulation in all the in vitro and in vivo models (n=20) have been labelled. (B) GSEA-mediated identification of the main enriched gene sets in the triplet-treated samples compared to the samples treated with TG-1801. Samples were sorted from left to right: 1-Raji, 2-Daudi, 3-4- BL primary samples and 5-6- CD20+ cells sorted from 2 representative Raji xenograft specimens. (C) qPCR determination of GPR183 and CCL20 transcript levels in Raji and Daudi cell lines exposed to TG-1801 or to the triplet therapy as previously, and in the two Raji in vivo (mouse and CAM) models dosed with the different agents. Values are referred to untreated Raji cultures. (D) Immunoblot detection and densitometric quantification of GPR183 protein levels (SantaCruz, #sc-514342) in BL cell lines exposed to TG-1801 +/- U2 dual asset, using GAPDH as a loading control. Values are normalized to control untreated cells. For each cell line, shown is a representative experiments out of three. (E) Immunohistochemistry (IHC) labelling of CD20 (Clone L26, Sigma-Aldrich), GPR183 (Clone G-12, Santa Cruz), F4/80 (Clone SP115, Abcam), Histone H3-pSer10 (Clone E173, Abcam) and CD56/NCAM-1 (Clone EPR1827, Abcam) in tissue sections from tumour specimens (shown are pictures from 1 out of 3 representative specimens) Scale bar: 50 µm. (F) MRCL1 transcript levels in the Raji-derived CAM model. Data are presented in fold-change related to the control (N=8-10) according to the different treatment regimens. * p<0.05, *** p<0.001, ### p<0.001, and † p<0.05 and ††† p<0.001 when compared to control group in Raji (in vitro), Daudi (in vitro) and Raji (in vivo) models, respectively. ns, non-significant. GPR183 inhibitor NIBR189 (24), washed out, and co-cultured for 4 co-cultures, thus confirming the requirement of an active GPR183 hours with M1-polarized macrophages, in the presence of U2 +/- TG- receptor for the full activation of macrophage function. 1801, and ADCP induction was quantified as described above. As Since GPR183 is a known antagonist of chemokine-mediated B shown in Figure 3E, the relative levels of phagocytosis were decreased cell migration (25), a transwell migration assay using recombinant by 3-fold after GPR183 pharmacological blockade in triplet-treated CXCL12 as a chemoattractant was set up. The chemotaxis Frontiers in Immunology 08 frontiersin.org Ribeiro et al. 10.3389/fimmu.2023.1130052 A B C D E G F H I FIGURE 3 GPR183 is required for impaired B cell trafficking and tumour cell phagocytosis upon TG-1801/U2 triple combination therapy. (A) Immunoblot detection and densitometric quantification of GPR183 in both Raji-GPR183WT and Raji-GPR183KO cells, using GAPDH expression as a loading control. Values are referred to control, wild type cells. (B) Raji-GPR183WT or Raji-GPR183KO 3D spheroid in presence or absence of 10 ng/mL TG-1801 +/- U2 (10 µg/mL ublituximab + 1 µM umbralisib) for one more day. The infiltration of M1 macrophages was evaluated by live-cell red fluorescence. Scale bar: 500 µm. (C) Triggering of phagocytosis (left panel) and cell-mediated cytotoxicity (right panel) was assessed in Raji-GPR183WT and Raji- GPR183KO cultures upon quantification of engulfed B cell red fluorescence with pHrodo and LDH release assay, respectively. For each assay, shown are average values obtained from three independent replicates. (D) Raji-GPR183WT and Raji-GPR183KO were co-cultured with BMSCs, M2-polarized primary macrophages and PBMCs (4:1:1:1) and treated with vehicle, TG-1801 or the triplet combination for 24h. Then, purified CD20+ cells were subjected to RNA extraction and qPCR. Data are presented in fold-change related to the Raji-GPR183WT control. (E) ADCP activities were assessed in Raji cells with or without the GPR183 inhibitor NIBR189 prior to treatment with 10 ng/mL TG-1801 +/- U2. Shown are average values from n=3 replicates. (F) The cell migration index of Raji-GPR183WT, Raji-GPR183KO (clone #1) cells exposed to the GPR183 inhibitor NIBR189, in presence or absence of 10 ng/mL TG-1801 +/- U2 combination. Shown are average values from n=3 replicates. (G) F-actin levels were assessed in the different cultures exposed to TG-1801 +/- U2 as in (E), followed by staining with a TRITC-labelled phalloidin and direct red fluorescence recording. Nuclei were counterstained with DAPI (blue) (shown are representative pictures from 1 out of 3 fields). Scale bar: 50 µm. (H) Tumour weights at day 15 for Raji GPR183KO (N=8-10) exposed to TG-1801, U2 or triplet combination. (I) CCL20 and MRCL1 transcript levels in GPR183KO tumours. Data are presented in fold-change related to the control (shown are median values from 8-10 replicates) according to the different treatment regimens. Values are expressed as mean ± SD. * p<0.05, *** p<0.001, when compared to control group. ## p<0.01 and ### p<0.001 when compared to TG- 1801 alone. ns, non-significant. Frontiers in Immunology 09 frontiersin.org Ribeiro et al. 10.3389/fimmu.2023.1130052 properties of CXCL12 were tested on the Raji parental cells, the migration and differentiation. Dysregulation of this pathway have Raji-GPR183 KO cells, and the NIBR189-pretreated cultures. been described in several types of cancer, including BL (34, 35). Figure 3F shows that BL cell migration was significantly impaired Expression of the PI3Kd subunit is generally restricted to by both U2 and TG-1801 treatments, and that the combination led hematopoietic cells, and is essential for the development and to an accentuated (75%) inhibition of cell mobility. This effect was expansion of normal and malignant B-cells (36). Preclinical data completely lost either after GPR183 pharmacological inhibition by with different class-specific PI3K inhibitors have suggested that part NIBR189 or upon the genetic deletion of the receptor. Accordingly, of their antitumor activity relies on the modulation of the tumor F-actin polymerization was decreased by 70% in Raji cells exposed microenvironment (TME) and to an enhancement of adaptive to the triplet treatment and this effect was counteracted by the immunity, including an improved intratumoral macrophage absence of GPR183 (clone #1) or by its pharmacological blockade infiltration, thereby increasing the efficacy of immune checkpoint (Figures 3G, S1I), in agreement with previous studies highlighting blockade therapy (37–39). Our present data support for the first the relevance of F-actin disruption in the anti-lymphoma effect of time the use of a PI3Kd inhibitor to promote the remodeling of the anti-CD47 antibodies (26). Finally, the crucial role of GPR183 in BL tumor microenvironment in vitro and in vivo, for a better anti- response to the triplet was confirmed in vivo in a Raji-GPR183KO CD47-mediated activation of macrophages. Indeed, we observed CAM model, in which TG-1801, U2, and the combination that the TG-1801/ublituximab/umbralisib triplet, when compared treatment failed to impact tumoral growth, with no modulation to TG-1801 monotherapy, significantly improved innate immunity of CCL20 expression and failed intratumoral infiltration of MRCL1 in vitro and in vivo, with the potentiation of both macrophages and + macrophages (Figures 3H, I). cytotoxic cell activity, although this latter at a lower extent. Altogether, these data strongly support that GPR183 Unsurprisingly, most of this effect was due to TG-1801, which upregulation is a prerequisite to the recruitment of macrophages was already known to exert its antitumor effect by eliciting ADCP and to the initiation of the inflammatory response, in Raji and ADCC (10) and to increase the phagocytosis of tumor cells by xenografts subjected to the triplet treatment. the macrophage and monocyte populations present in lymphoid TME (11). Of special interest, the superior antitumor activity of the triplet combination in mice resulted in a prolonged response with a 4 Discussion higher number of tumor-free animals 35 days after the last dose. Transcriptomic and immunophenotypic analyses revealed that this CD47 immune checkpoint inhibitors have emerged as sustained effect was closely linked to an enrichment in promising immunotherapy in cancer treatment thanks to their inflammatory gene signatures and an enhanced recruitment of ability to facilitate the concomitant inhibition of the “do-not-eat- macrophages and NK cells at the tumor site, being these two me” signal and to boost antitumor T-cell response. Indeed, although phenomena known prerequisites for full activity of immune CD47/SIRPa axis blockade was initially believed to lead to checkpoint blockers (40). antitumor activity exclusively through ADCP (27), it was further By coupling phenotypic characterization to gene edition, we demonstrated that targeting CD47 also promotes T cell–mediated further propose that among the main pro-inflammatory genes elimination of immunogenic tumors (28, 29). Considering the activated in a set of in vitro and in vivo models of B-NHL that relevance of the CD47/SIRPa axis in tumor progression, reconstitute most features of the lymphoid TME and the main including under (chemo)-therapeutic pressure, several novel aspects of B-NHL architecture, the GPR183 receptor represents a studies have demonstrated the potential of CD47-based crucial regulator involved in the efficacy of the drug combination. combination therapies in different types of cancer (30). Among GPR183 belongs to the rhodopsin family and is widely expressed in the most promising combinations, the synergistic FcR-dependent B, T, and dendritic cells (20, 40). This factor is responsible for activation of phagocytosis by the anti-CD47 mAb Hu5F9-G4 regulating the positioning and migration of immune cells within associated to rituximab signaling has demonstrated great secondary lymphoid organs (41, 42) and its deregulated activity or effectivity in B-NHL cell lines and primary samples (31), and has expression has been found in germinal center B-like DLBCL, FL, further shown promising clinical activity with few side effect in the CLL and acute myeloid leukemia (43). Accordingly, we found that phase Ib clinical trial NCT02953509 involving R/R DLBCL and FL treatment-induced upregulation of GRP183 in BL tumors strongly patients (32). Similarly, bispecific antibodies that co-target CD47 affect F-actin polymerization in B cells, with the consequent and CD20 can induce selective phagocytosis of B-NHL cells, and impairment of CXCL12-dependent chemotaxis, a phenomenon prolong the survival time of mice transplanted with these tumors that possibly render these latter more accessible to pro- (33). This dual anti-CD20/anti-CD47 approach has provided inflammatory macrophages with the capacity to limit tumor convincing clinical results and is still being extensively evaluated, growth (42). Finally, and in agreement with our finding although both pre-clinically and clinically, in B-cell lymphoma (7). Here, we in another cellular context, loss-of-function mutation of GPR183 or present a new set of data that propose for the first time a biological treatment with a GPR183 antagonist, have recently been associated rationale for the combination of the first-in-kind anti-CD47/CD19 with a reduced macrophage infiltration and a lower inflammatory bispecific antibody, TG-1801, with the clinically tested pair of the cytokine production in the lungs of mice infected by respiratory anti-CD20 antibody ublituximab with umbralisib, a PI3K inhibitor. viruses (44). PI3Ks are a key component of cell machinery controlling PI3K/Akt signaling was recently identified as the main cellular key pathways such as growth, proliferation, survival, downstream axis synergistically affected by co-exposure of Frontiers in Immunology 10 frontiersin.org Ribeiro et al. 10.3389/fimmu.2023.1130052 FIGURE 4 Mechanism of action of the TG-1801/U2 triplet combination therapy in BL. The novel CD47-CD19 bispecific antibody potentiates the anti-tumour activity of the ublituximab-umbralisib regimen through activation of the pro-inflammatory GPR183, thus promoting macrophage-dependent phagocytosis, B-cell cytoskeleton remodelling and B-cell motility. malignant B cells to different anti-CD20 mAbs and to the PI3Kd project administration, writing–review and editing. All authors inhibitor idelalisib (45). However, in the case of BL and under contributed to the article and approved the submitted version. determined experimental settings (i.e. upon exposure to immunomodulatory drugs), the anti-CD20 mAb rituximab was shown to promote EBV reactivation, thereby stimulating PI3K Funding signaling (46). Although EBV intracellular signaling hasn’t been challenged here, one may hypothesize that, as a bona fide EBV- This study was financially supported by TG Therapeutics, Fondo responsive gene, GPR183 may be upregulated by the simultaneous de Investigació n Sanitaria PI18/01383, European Regional ligation of CD47 and CD20 by TG-1801 and ublituximab, rending Development Fund (ERDF) “Una manera de hacer Europa” (to at the same time these cells more susceptible to PI3Kd blockade GR). JS and MF-S were recipients of a Sara Borrell research contract by umbralisib. (CD19/00228) and a predoctoral fellowship (FI19/00338) from In summary, our results support a role for GPR183 in the Instituto de Salud Carlos III, respectively. MA was a fellow of recognition and elimination in vitro and in vivo of malignant B cells PROTEOblood, a project co-financed by the European Regional by activated macrophages, upon concomitant targeting of CD20, Development Fund (ERDF) through the Interreg V-A Spain- CD47 and PI3Kd in tumor cells (Figure 4). Future studies will be France-Andorra (POCTEFA) program (EFA360/19). This work was aimed at understanding whether GPR183 could constitute a bona carried out under the CERCA Program (Generalitat de Catalunya). fide biomarker for the activity of anti-CD47-based therapeutic regimens. Testing whether this discovery can be generalized to other agents from the same classes than those used here, is Acknowledgments currently underway. We are very grateful to Salvador Sánchez Vinces, at Sao Francisco University/Brazil, for his support in bioinformatics analysis. Samples Data availability statement included in this study were provided by “Colecció n de muestras bioló gicas del Institut de Recerca contra la Leucèmia Josep Carreras” The datasets presented in this study can be found in online and were processed following standard operating procedures with the repositories. The names of the repository/repositories and accession approval of the Ethics and Scientific Committees of the Germans Trias number(s) can be found in the article/Supplementary Material. I Pujol University Hospital (Badalona, Spain). Author contributions Conflict of interest MR, NP-P and JS: Resources, investigation, methodology, Authors HP and EN were employed by company writing–original draft. PB: Data curation, software, visualization. TG Therapeutics. DR-G: Investigation, methodology. MA: Investigation. MF-S: The authors declare that this study received funding from TG Investigation. HM: Validation, writing review and editing. FB: Therapeutics. The funder had the following involvement in the study: Writing–review and editing. ME: Data curation, writing review study design, data validation and manuscript preparation. HM reports and editing. EN: Conceptualization, resources, supervision, personal fees from TG Therapeutics, Inc. during the conduct of the validation, writing–original draft, writing–review and editing. GR: study. EN reports employment and ownership of stock with TG Conceptualization, resources, supervision, funding acquisition, Therapeutics. GR reports grants from TG Therapeutics and Instituto validation, investigation, visualization, writing–original draft, de Salud Carlos III during the conduct of the study. Frontiers in Immunology 11 frontiersin.org Ribeiro et al. 10.3389/fimmu.2023.1130052 The remaining authors declare that the research was conducted reviewers. Any product that may be evaluated in this article, or in the absence of any commercial or financial relationships that claim that may be made by its manufacturer, is not guaranteed or could be construed as a potential conflict of interest. endorsed by the publisher. Publisher’s note Supplementary material All claims expressed in this article are solely those of the authors The Supplementary Material for this article can be found online at: and do not necessarily represent those of their affiliated https://www.frontiersin.org/articles/10.3389/fimmu.2023.1130052/ organizations, or those of the publisher, the editors and the full#supplementary-material References 1. Blattman JN, Greenberg PD. Cancer immunotherapy: a treatment for the masses. 19. Dlouhy I, Armengol M, Recasens-Zorzo C, Ribeiro ML, Pé rez-Galá n P, Bosch F, Science (2004) 305:200–5. doi: 10.1126/science.1100369 et al. Interleukin-1 receptor associated kinase 1/4 and bromodomain and extraterminal 2. Banerjee T, Vallurupalli A. Emerging new cell therapies/immune therapies in b- inhibitions converge on NF-kB blockade and display synergistic antitumoral activity in cell non-hodgkin’s lymphoma. Curr Probl Canc (2022) 46(1):100825. doi: 10.1016/ activated b-cell subset of diffuse large b-cell lymphoma with MYD88L265P mutation. j.currproblcancer.2021.100825 Haematologica (2020) 106:2749. doi: 10.3324/haematol.2022.281988 3. Rushton CK, Arthur SE, Alcaide M, Cheung M, Jiang A, Coyle KM, et al. Genetic 20. Liu C, Yang XV, Wu J, Kuei C, Mani NS, Zhang L, et al. Oxysterols direct b-cell and evolutionary patterns of treatment resistance in relapsed b-cell lymphoma. Blood migration through EBI2. Nat (2011) 475(7357):519–23. doi: 10.1038/nature10226 Adv [Internet] (2020) 4(13):2886–98. doi: 10.1182/bloodadvances.2020001696 21. Pereira JP, Kelly LM, Xu Y, Cyster JG. EBV induced molecule-2 mediates b cell 4. Miles RR, Arnold S, Cairo MS. Risk factors and treatment of childhood and segregation between outer and center follicle. Nature (2009) 460(7259):1122. adolescent burkitt lymphoma/leukaemia. Br J Haematol (2012) 156:730–43. doi: 10.1038/nature08226 doi: 10.1111/j.1365-2141.2011.09024.x 22. Hu T, Wu Z, Bush SJ, Freem L, Vervelde L, Summers KM, et al. Characterization 5. Hecht JL, Aster JC. Molecular biology of burkitt’s lymphoma. J Clin Oncol (2000) of subpopulations of chicken mononuclear phagocytes that express TIM4 and CSF1R. J 18(21):3707–21. doi: 10.1200/JCO.2000.18.21.3707 Immunol (2019) 202(4):1186–99. doi: 10.4049/jimmunol.1800504 6. Barclay A, Van den Berg T. The interaction between signal regulatory protein 23. Souza GR, Molina JR, Raphael RM, Ozawa MG, Stark DJ, Levin CS, et al. Three- alpha (SIRPa) and CD47: structure, function, and therapeutic target. Annu Rev dimensional tissue culture based on magnetic cell levitation. Nat Nanotechnol (2010) 5 Immunol (2014) 32:25–50. doi: 10.1146/annurev-immunol-032713-120142 (4):291–6. doi: 10.1038/nnano.2010.23 7. Armengol M, Santos JC, Ferná ndez-Serrano M, Profitó s-Pelejà N, Ribeiro ML, 24. Gessier F, Preuss I, Yin H, Rosenkilde MM, Laurent S, Endres R, et al. Identification Roué G. Immune-checkpoint inhibitors in b-cell lymphoma. Cancers (Basel) (2021) 13 and characterization of small molecule modulators of the Epstein–Barr virus-induced gene (2):1–41. doi: 10.3390/cancers13020214 2 (EBI2) receptor. J Med Chem (2014) 57(8):3358–68. doi: 10.1021/jm4019355 8. Matlung HL, Szilagyi K, Barclay NA, van den Berg TK. The CD47-SIRPa 25. Barroso R, Martı́nez Muñoz L, Barrondo S, Vega B, Holgado BL, Lucas P, et al. signaling axis as an innate immune checkpoint in cancer. Immunol Rev (2017) 276 EBI2 regulates CXCL13-mediated responses by heterodimerization with CXCR5. (1):145–64. doi: 10.1111/imr.12527 FASEB J (2012) 26(12):4841–54. doi: 10.1096/fj.12-208876 9. Hatterer E, Chauchet X, Richard F, Barba L, Moine V, Chatel L, et al. Targeting a 26. Barbier S, Chatre L, Bras M, Sancho P, Roué G, Virely C, et al. Caspase-independent membrane-proximal epitope on mesothelin increases the tumoricidal activity of a type III programmed cell death in chronic lymphocytic leukemia: the key role of the f-actin bispecific antibody blocking CD47 on mesothelin-positive tumors. MAbs [Internet] cytoskeleton. Haematologica (2009) 94(4):507–17. doi: 10.3324/haematol.13690 (2020) 12(1):1739408. doi: 10.1080/19420862.2020.1739408 27. Majeti R, Chao MP, Alizadeh AA, Pang WW, Jaiswal S, Gibbs KD, et al. CD47 is 10. Buatois V, Johnson Z, Salgado-Pires S, Papaioannou A, Hatterer E, Chauchet X, an adverse prognostic factor and therapeutic antibody target on human acute myeloid et al. Preclinical development of a bispecific antibody that safely and effectively targets leukemia stem cells. Cell (2009) 138(2):286–99. doi: 10.1016/j.cell.2009.05.045 CD19 and CD47 for the treatment of b-cell lymphoma and leukemia. Mol Cancer Ther 28. Liu X, Pu Y, Cron K, Deng L, Kline J, Frazier WA, et al. CD47 blockade triggers (2018) 17(8):1739–51. doi: 10.1158/1535-7163.MCT-17-1095 T cell-mediated destruction of immunogenic tumors. Nat Med (2015) 21(10):1209. 11. Chauchet X, Cons L, Chatel L, Daubeuf B, Didelot G, Moine V, et al. doi: 10.1038/nm.3931 CD47xCD19 bispecific antibody triggers recruitment and activation of innate 29. Tseng D, Volkmer JP, Willingham SB, Contreras-Trujillo H, Fathman JW, immune effector cells in a b-cell lymphoma xenograft model. Exp Hematol Oncol Fernhoff NB, et al. Anti-CD47 antibody-mediated phagocytosis of cancer by (2022) 11(1):1–13. doi: 10.1186/s40164-022-00279-w macrophages primes an effective antitumor T-cell response. Proc Natl Acad Sci USA 12. Palazzo A, Herter S, Grosmaire L, Jones R, Frey CR, Limani F, et al. The PI3Kd- (2013) 110(27):11103–8. doi: 10.1073/pnas.1305569110 selective inhibitor idelalisib minimally interferes with immune effector function 30. Veillette A, Chen J. SIRPa–CD47 immune checkpoint blockade in anticancer mediated by rituximab or obinutuzumab and significantly augments b cell depletion therapy. Trends Immunol (2018) 39(3):173–84. doi: 10.1016/j.it.2017.12.005 in vivo. J Immunol (2018) 200(7):2304–12. doi: 10.4049/jimmunol.1700323 31. Chao MP, Alizadeh AA, Tang C, Myklebust JH, Varghese B, Gill S, et al. Anti- 13. Lunning M, Vose J, Nastoupil L, Fowler N, Burger JA, Wierda WG, et al. Ublituximab CD47 antibody synergizes with rituximab to promote phagocytosis and eradicate non- and umbralisib in relapsed/refractory b-cell non-Hodgkin lymphoma and chronic lymphocytic Hodgkin lymphoma. Cell (2010) 142(5):699–713. doi: 10.1016/j.cell.2010.07.044 leukemia. Blood [Internet] (2019) 134(21):1811–20. doi: 10.1182/blood.2019002118 32. Advani R, Flinn I, Popplewell L, Forero A, Bartlett NL, Ghosh N, et al. CD47 14. Ribeiro ML, Reyes-Garau D, Vinyoles M, Profitos-Peleja N, Santos JC, Armengol blockade by Hu5F9-G4 and rituximab in non-hodgkin’s lymphoma. N Engl J Med M, et al. Antitumor activity of the novel BTK inhibitor TG-1701 is associated with (2018) 379(18):1711–21. doi: 10.1056/NEJMoa1807315 disruption of ikaros signaling in patients with b-cell non-Hodgkin lymphoma. Clin Cancer 33. Piccione EC, Juarez S, Liu J, Tseng S, Ryan CE, Narayanan C, et al. A bispecific Res (2021) 27(23):6591–601. doi: 10.1158/1078-0432.CCR-21-1067 antibody targeting CD47 and CD20 selectively binds and eliminates dual antigen expressing 15. Bankhead P, Loughrey MB, Ferná ndez JA, Dombrowski Y, McArt DG, Dunne lymphoma cells. MAbs (2015) 7(5):946–56. doi: 10.1080/19420862.2015.1062192 PD, et al. QuPath: open source software for digital pathology image analysis. Sci Rep 34. Cantrell DA. Phosphoinositide 3-kinase signalling pathways. J Cell Sci [Internet] (2017) 7(1):1–7. doi: 10.1038/s41598-017-17204-5 (2001) 114(8):1439–45. doi: 10.1242/jcs.114.8.1439 16. Balsas P, Esteve-Arenys A, Roldá n J, Jiménez L, Rodrı́guez V, Valero JG, et al. 35. Lawrence MS, Stojanov P, Mermel CH, Robinson JT, Garraway LA, Golub TR, Activity of the novel BCR kinase inhibitor IQS019 in preclinical models of b-cell non- et al. Discovery and saturation analysis of cancer genes across 21 tumour types. Nat Hodgkin lymphoma. J Hematol Oncol (2017) 10(1):1–14. doi: 10.1186/s13045-017-0447-6 [Internet] (2014) 505(7484):495–501. doi: 10.1038/nature12912 17. Mateo V, Lagneaux L, Bron D, Biron G, Armant M, Delespesse G, et al. CD47 36. Srinivasan L, Sasaki Y, Calado DP, Zhang B, Paik JH, DePinho RA, et al. PI3 ligation induces caspase-independent cell death in chronic lymphocytic leukemia. Nat kinase signals BCR-dependent mature b cell survival. Cell (2009) 139(3):573–86. Med (1999) 5(11):1277–84. doi: 10.1038/15233 doi: 10.1016/j.cell.2009.08.041 18. Klingenberg M, Becker J, Eberth S, Kube D, Wilting J. The chick chorioallantoic 37. Gouni S, Marques-Piubelli ML, Strati P. Follicular lymphoma and macrophages: membrane as an in vivo xenograft model for burkitt lymphoma. BMC Cancer (2014) 14 impact of approved and novel therapies. Blood Adv [Internet] (2021) 5(20):4303–12. (1):1–12. doi: 10.1186/1471-2407-14-339 doi: 10.1182/bloodadvances.2021005722 Frontiers in Immunology 12 frontiersin.org Ribeiro et al. 10.3389/fimmu.2023.1130052 38. Zheng W, Pollard JW. Inhibiting macrophage PI3Kg to enhance immunological function of splenic dendritic cells. Nat Immunol [Internet] (2013) 14 immunotherapy. Cell Res (2016) 26(12):1267–8. doi: 10.1038/cr.2016.132 (5):446–53. doi: 10.1038/ni.2555 39. Kaneda MM, Messer KS, Ralainirina N, Li H, Leem CJ, Gorjestani S, et al. PI3Kg 43. Gatto D, Brink R. B cell localization: regulation by EBI2 and its oxysterol ligand. is a molecular switch that controls immune suppression. Nat [Internet] (2016) 539 Trends Immunol [Internet] (2013) 34(7):336–41. doi: 10.1016/j.it.2013.01.007 (7629):437–42. doi: 10.1038/nature19834 44. Foo CX, Bartlett S, Chew KY, Ngo MD, Bielefeldt-Ohmann H, Arachchige BJ, 40. Wang C, Cui A, Bukenya M, Aung A, Pradhan D, Whittaker CA, et al. et al. GPR183 antagonism reduces macrophage infiltration in influenza and SARS- Reprogramming NK cells and macrophages via combined antibody and cytokine CoV-2 infection. Eur Respir J (2022) 61(3):2201306. doi: 10.1183/13993003.01306-2022 therapy primes tumors for elimination by checkpoint blockade. Cell Rep (2021) 37 45. Cavallini C, Galasso M, Pozza ED, Chignola R, Lovato O, Dando I, et al. Effects of (8):110021. doi: 10.1016/j.celrep.2021.110021 CD20 antibodies and kinase inhibitors on b-cell receptor signalling and survival of chronic 41. Sun S, Liu C. 7a, 25-dihydroxycholesterol-mediated activation of EBI2 in lymphocytic leukaemia cells. Br J Haematol (2021) 192(2):333–42. doi: 10.1111/bjh.17139 immune regulation and diseases [Internet]. Front Pharmacol (2015) 6:60. 46. Jones RJ, Iempridee T, Wang X, Lee HC, Mertz JE, Kenney SC, et al. doi: 10.3389/fphar.2015.00060 Lenalidomide, thalidomide, and pomalidomide reactivate the Epstein-Barr virus lytic 42. Gatto D, Wood K, Caminschi I, Murphy-Durland D, Schofield P, Christ D, et al. cycle through phosphoinositide 3-kinase signaling and ikaros expression. Clin Cancer The chemotactic receptor EBI2 regulates the homeostasis, localization and Res (2016) 22(19):4901–12. doi: 10.1158/1078-0432.CCR-15-2242 Frontiers in Immunology 13 frontiersin.org