TYPE Original Research PUBLISHED 25 May 2023 DOI 10.3389/fpsyt.2023.1148993 THC exposure during OPEN ACCESS adolescence increases EDITED BY Roberto Ciccocioppo, University of Camerino, Italy impulsivity-like behavior in REVIEWED BY Francisco Alen, adulthood in a WIN 55,212-2 Complutense University of Madrid, Spain John Mantsch, Medical College of Wisconsin, United States self-administration mouse model *CORRESPONDENCE Rafael Maldonado María del Mar Cajiao-Manrique1† , Verònica Casadó-Anguera1† , rafael.maldonado@upf.edu Elena Martín-García Alejandra García-Blanco1† , Rafael Maldonado1,2* and elena.martin@upf.edu Elena Martín-García1,2,3* † These authors have contributed equally to this 1 Laboratory of Neuropharmacology-Neurophar, Department of Medicine and Life Sciences, Universitat work Pompeu Fabra (UPF), Barcelona, Spain, 2 Hospital del Mar Medical Research Institute (IMIM), Barcelona, Spain, 3 Departament de Psicobiologia i Metodologia de les Ciències de la Salut, Universitat Autònoma RECEIVED 20 January 2023 de Barcelona (UAB), Barcelona, Spain ACCEPTED 04 May 2023 PUBLISHED 25 May 2023 Background: Cannabis addiction is a chronically relapsing disorder lacking CITATION Cajiao-Manrique MdM, Casadó-Anguera V, effective treatment. Regular cannabis consumption typically begins during García-Blanco A, Maldonado R and adolescence, and this early cannabinoid exposure may increase the risk for drug Martín-García E (2023) THC exposure during adolescence increases impulsivity-like addiction in adulthood. behavior in adulthood in a WIN 55,212-2 self-administration mouse model. Objective: This study investigates the development of cannabis addiction-like Front. Psychiatry 14:1148993. behavior in adult mice after adolescent exposure to the main psychoactive doi: 10.3389/fpsyt.2023.1148993 component of cannabis, 19 -tetrahydrocannabinol (THC). COPYRIGHT © 2023 Cajiao-Manrique, Casadó-Anguera, Methods: Adolescent male mice were exposed to 5 mg/kg of THC from García-Blanco, Maldonado and Martín-García. postnatal days 37 to 57. Operant self-administration sessions of WIN 55,212-2 This is an open-access article distributed under the terms of the Creative Commons Attribution (12.5 µg/kg/infusion) were conducted for 10 days. Mice were tested for three License (CC BY). The use, distribution or addiction-like criteria (persistence of response, motivation, and compulsivity), reproduction in other forums is permitted, provided the original author(s) and the two parameters related to craving (resistance to extinction and drug-seeking copyright owner(s) are credited and that the behavior), and two phenotypic vulnerability traits related to substance use original publication in this journal is cited, in accordance with accepted academic practice. disorders (impulsivity and reward sensitivity). Additionally, qPCR assays were No use, distribution or reproduction is performed to detect differentially expressed genes in medial prefrontal cortex permitted which does not comply with these terms. (mPFC), nucleus accumbens (NAc), dorsal striatum, and hippocampus (HPC) of “addicted” and “non-addicted” mice. Results: Adolescent THC exposure did not modify WIN 55,212-2 reinforcement nor the development of cannabis addiction-like behavior. Inversely, THC pre- exposed mice displayed impulsive-like behavior in adulthood, which was more pronounced in mice that developed the addiction-like criteria. Moreover, downregulated drd2 and adora2a gene expression in NAc and HPC was revealed in THC pre-exposed mice, as well as a downregulation of drd2 expression in mPFC of vehicle pre-treated mice that developed addiction-like behaviors. Discussion: These findings suggest that adolescent THC exposure may promote impulsivity-like behavior in adulthood, associated with downregulated drd2 and adora2a expression in NAc and HPC. KEYWORDS cannabis addiction, adolescence, WIN 55,212-2 self-administration mouse model, THC, impulsivity, drd2, adora2a Frontiers in Psychiatry 01 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 1. Introduction diagnostic criteria as it is directly related to the vulnerability to relapse after abstinence (16, 17). In our mouse model of cannabis Cannabis sativa derivatives have become the most widely used addiction, we study these three stages through the three hallmarks illicit drugs worldwide, and regular cannabis use mainly begins of addiction based on the DSM-5 addiction criteria: (1) persistence during adolescence. Indeed, it is estimated that 15.5% of EU of drug-seeking, (2) motivation for the drug, and (3) compulsive- inhabitants aged 15–34 used cannabis in 2021, while 19.1% of those like behavior. Moreover, we also evaluate two parameters related aged 15–24 had consumed cannabis in the last year and 10.4% to craving, resistance to extinction and drug-seeking behavior after in the last month (1). With a recent increase in the prevalence abstinence, and two phenotypic traits considered to be factors of of cannabis use disorder (CUD) and a reduction in the perceived vulnerability to substance misuse, impulsivity and sensitivity to risk of cannabis use (2), it is necessary to further understand reward. According to its multifactorial origin, only a subset of the neurobiological consequences associated with this cannabis individuals repeatedly exposed to the drug will develop addiction consumption. However, the consequences of early-life cannabis (9, 18, 19). use are still poorly understood. Recent evidence indicates that In this study, we aim to investigate the development of early exposure to 19 -tetrahydrocannabinol (THC), the primary cannabis addiction-like behavior and related behavioral alterations psychotropic constituent of cannabis, produces changes in the in adult mice after adolescent exposure to THC. For this purpose, structure and function of brain circuits implicated in decision- adolescent mice received daily administration of THC or vehicle from postnatal days (PND) 37 to 57, considered to be the adolescent making and cognitive processes (3). However, whether such period in mice, equivalent to 12–19 years old in humans (20). changes might be long-lasting and persistently disrupt healthy Then, mice were trained to acquire an operant intravenous (iv) behaviors remains unknown. self-administration conditioning sustained by WIN 55,212-2, a The adolescent period is a critical phase of brain development, potent synthetic cannabinoid agonist (21). The addiction-like neuronal maturation, and restructuring (4–6). Imaging studies criteria were evaluated, as well as parameters related to craving have reported that higher-order structures, such as the prefrontal and phenotypic traits, as previously described. We also evaluated cortex, are still immature at that time point (7, 8) and they cannot molecular markers of cannabis addiction-like behavior in brain fully inhibit behavior favoring impulsivity and risk-taking (9). areas of the mesocorticolimbic circuit. Additionally, the striatal and limbic circuits are hyperactive during adolescence, leading to greater emotional reactivity and reward- seeking behaviors (7). These studies propose that early-life cannabis exposure may impair neurodevelopment and induce changes that 2. Materials and methods affect the adult brain (8). Thus, a loss of gray matter was revealed in the prefrontal areas of adolescent cannabis users (10). Moreover, 2.1. Animals THC mediates its pharmacological effect through the activation of the endocannabinoid (eCB) system, a key modulatory system Eight weeks old male C57BL/6J mice (n = 40) (Charles crucial in synapse pruning, formation, and maturation (10, 11). River, France) were housed individually in controlled laboratory Therefore, dysregulation of the eCB system by the action of THC conditions (21 ± 1◦ C, 55 ± 10%) with food and water available or other exogenous cannabinoids during adolescence could disrupt ad libitum. The male sex was chosen considering previous normal brain development and function. These alterations have literature that has validated the operant WIN 55,212-2 self- been demonstrated to be involved in the earlier onset of psychiatric administration model only in males (22). Mice were tested during disorders (6, 10, 12). In addition, a gateway hypothesis has been the first hours of the dark phase of a reversed light/dark cycle postulated, proposing a causal chain sequence in which cannabis (lights off at 8:00 a.m. and on at 20:00 p.m.). Body weight consumption would be used prior to other illicit drugs and cannabis and food intake were monitored throughout the experiment. All use would increase the likelihood of using other illicit drugs animal procedures were approved by the local ethical committee (9, 13, 14). However, studies on the long-term neurobiological (Comitè Ètic d’Experimentació Animal-Parc de Recerca Biomèdica consequences of cannabis consumption in juveniles are scarce and de Barcelona, CEEA-PRBB, agreement N◦ 9687) and conducted often contradictory. strictly in accordance with the guidelines of the European Cannabis addiction can be conceptualized as a three-stage Communities Council Directive (2010/63/EU) regulating animal recurring cycle of “binge/intoxication,” “withdrawal/negative experimentation, in the animal facility at Universitat Pompeu affect,” and “preoccupation/anticipation,” each sustained by Fabra-Barcelona Biomedical Research Park (UPF-PRBB; Barcelona, neurobiological alterations mainly in the basal ganglia, extended Spain). All the experiments were performed under blind and amygdala, and prefrontal cortex, respectively (15). According to randomized conditions. the Diagnostic and Statistical Manual of Mental Disorders (DSM-5), these stages are characterized by (1) dysregulation of rewarding or pleasurable effects, (2) emergence of a negative emotional state 2.2. Drugs when access to the reward is prevented, and (3) loss of control in limiting drug intake despite repeated unsuccessful efforts to Dronabinol, 1-9-tetrahydrocannabinol (THC), generously resist, respectively (8, 15). These stages are repeated and worsen gifted by Rhodes Pharmaceuticals, Coventry, RI, USA, stored at over time, perpetuating the addiction cycle until they produce 100 mg/ml in sesame oil, was dissolved in a vehicle containing a maladaptive habit formation that is governed by compulsive 5% ethanol 100%, 5% cremophor-LE (C5135, Sigma-Aldrich, behavior. Moreover, craving was included in the DSM-5 addiction USA) and 90% physiological saline solution, and administered by Frontiers in Psychiatry 02 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 intraperitoneal (ip) injection at a dose of 5 mg/kg of body weight. 2.5. Adolescent THC treatment For the self-administration, WIN 55, 212-2 [(R)-(+)-WIN 55,212- 2 mesylate salt, Sigma-Aldrich, USA] was dissolved in one drop We evaluated the long-term effect of THC exposure during of Tween 80 (TWEEN 80, Sigma-Aldrich, USA) and then diluted adolescence on WIN 55,212-2 self-administration, reinstatement, in heparinized (1%) sterile saline solution and made available at addiction-like criteria, and phenotypic traits present in adulthood. 0.1 mg/kg for ip injection 24 h before the first operant session Mice were divided into two groups and administered daily with and 12.5 µg/kg/infusion for the self-administered iv infusions. THC (n = 20) or its vehicle (n = 20) at a dose of 5 mg/kg of body The preparation was covered from the light and stored at room weight from PND 37 to PND 57, corresponding to the adolescent temperature. After each self-administration session, 0.05 ml of period in mice based on previous literature (23). This dose of THC sodic heparin (Hospira 5%, Hospira, Pfizer) was applied through was chosen according to previous studies using similar doses to the iv catheter to avoid coagulation and obstruction of the latter. translate in rodents the doses used for smoked cannabis in humans Thiopental sodium (5 mg/ml, Braun Medical S.A.) was dissolved (24–27). Body weight and food intake were strictly monitored for in distilled water and delivered in a volume of 0.05 ml through the entire period of treatment. Subsequently, animals underwent the iv catheter. surgical procedures, and once adulthood was reached (PND 68), self-administration experiments were started. 2.3. Operant self-administration apparatus 2.6. WIN 55,212-2 self-administration Experiments were performed in mouse operant chambers 2.6.1. Jugular vein catheterization (model ENV-307A-CT, Med Associates Inc., Georgia, VT, USA) Mice were anesthetized by ip injection (0.2 ml/10 g of body equipped with two nose-poke holes, one randomly selected as the weight) of ketamine hydrochloride (75 mg/kg of body weight, active hole and the other as the inactive hole. A house light was Ketamidor, Richter Pharma AG, Austria) and medetomidine located on the ceiling of the chamber, and two stimuli lights (cues) hydrochloride (1 mg/kg of body weight, Domtor, Esteve, Spain) were located one inside the active hole and the other above it. dissolved in 0.9% physiological saline and then implanted with Nose-poking in the active hole resulted in the delivery of one indwelling iv catheters in the right jugular vein, as previously WIN 55,212-2 infusion (under the associated schedule) paired with described (22). Briefly, a 6 cm long silicone tubing (0.3 mm the activation of the stimulus light located above the active hole, inner diameter, 0.6 mm outer diameter; Silastic, Dow Corning, while nose-poking in the inactive hole had no consequences. The Houdeng-Goegnies, Belgium) was adapted to a 22-gauge steel chambers were made of aluminum and acrylic and were housed cannula (Semat, Herts, United Kingdom) angled at a right angle inside sound- and light-attenuated boxes equipped with fans that and then embedded in a dental cement disk (Dentalon Plus, provided ventilation and white noise. The chamber’s floor was a Heraeus Kulzer, Germany) with an underlying nylon mesh. The grid made of metal bars that could conduct electrical current when catheter tubing was inserted 1.1 cm into the right jugular vein performing the shock test. WIN 55,212-2 was delivered in a volume and attached with a suture, and the remaining tubing was placed of 23.5 µl over 2 s via a syringe mounted on a microinfusion pump subcutaneous (sc) to the cannula, exiting at the midscapular (PHM-100A, Med-Associates, Georgia, VT, USA) and connected region. All incisions were sutured and coated with a local analgesic with flexible polymer tubing (0.96 mm outer diameter, Portex Fine (Blastoestimulina, Almirall, Spain). After, a post-surgery procedure Bore Polythene Tubing, Portex Limited, Kent, United Kingdom) consisting of an ip injection of antibiotic (1 mg/kg of body weight, to a single channel liquid swivel (375/25, Instech Laboratories, Gentamicine, Genta-Gobens, Laboratorios Normon, Spain), a sc Plymouth Meeting, PA, USA) and to the mouse iv catheter. injection of analgesic (mixture of glucose serum (GlucosaVet, B. Braun Vet Care, Spain) and meloxicam (2 mg/kg of body weight, Metacam, Boehringer Ingelheim, Rhein) and a sc injection 2.4. Experimental design of anesthesia reverser, atipamezole hydrochloride (2.5 mg/kg of body weight, Revertor, Virbac, Spain) was applied, all dissolved in Adolescent mice received a daily dose of 5 mg/kg of THC sterile 0.9% physiological saline. Mice were allowed to recover for or vehicle from PND 37 to PND 57. Afterward, mice were 3 days with follow-up analgesics prior to the initiation of the self- implanted with an intrajugular catheter in order to perform iv administration sessions. The patency of iv catheters was evaluated drug administrations. Subsequently, mice were trained to acquire by a thiopental sodium test at the end of the self-administration an operant drug self-administration conditioning maintained by iv experimental sequence. If prominent signs of anesthesia were not infusions of WIN 55,212-2 under a fixed-ratio (FR) 1 schedule of observed immediately after injection, the mouse was removed reinforcement during five sessions, followed by five sessions of a from the experiment. FR2 schedule of reinforcement. After the training, three addiction- like criteria resembling DSM-5 criteria for addiction, persistence 2.6.2. WIN 55,212-2 self-administration training to response, motivation, and compulsive-like behavior, two The operant model was applied similarly to previous drug parameters related to craving, resistance to extinction and drug- self-administration paradigms (22, 28) with the inclusion of seeking behavior, and two phenotypic traits considered factors of the addiction-like criteria, parameters related to craving and vulnerability to substance misuse, impulsivity and sensitivity to phenotypic traits. To avoid the aversive effects to the drug’s first reward, were evaluated in each mouse (Supplementary Figure 3). administration, mice received an ip injection of WIN 55,212-2 24 h Frontiers in Psychiatry 03 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 before the first self-administration session. Subsequently, mice were 2.6.3.3. Compulsivity trained to acquire operant self-administration maintained by iv Resistance to punishment, defined as compulsive-like behavior, infusions of WIN 55,212-2. The schedule was a fixed ratio (FR) corresponded to the maintenance of active responding behavior 1 schedule of reinforcement (one active nose-poking resulted in despite its association with a negative consequence. It was measured one drug delivery) during five consecutive sessions, followed by a by the total number of shocks obtained in a 50 min shock test, progression to FR2 (two active nose-pokings resulted in one drug during which each drug delivered was associated with a foot-shock- delivery) for another five sessions. All sessions were performed at induced punishment. This shock session was performed after a the same time every day. Each daily self-administration session stabilizing FR2 self-administration session following the PR test. initiated with a priming injection of the drug, followed by two Mice were placed in a different operant box than the one usually 55 min active periods separated by a 15 min drug-free period. The used for operant training. Then, mice underwent a FR2 self- beginning of each operant session was signaled by turning on the administration schedule of reinforcement for 50 min composed of house-light only during the first 3 s. During the active periods, each two schedule changes: after nose-poking once in the active hole, drug infusion was paired contingently with the cue light located mice received an electric foot-shock (0.18 mA, 2 s), while if they above the active nose-poke under the specific FR schedule. These performed a second active nose-poke, the electric foot-shock was cue lights, together with the noise of the infusion pump, acted as paired with the drug delivery and the associated cue light. After the environmental cues signaling the drug infusion. A 10 s time-out time-out period that follows drug delivery, the latter schedule was period was fixed after each drug delivery, during which the cue reinitiated. In parallel, if the second response was not completed light was off and no infusion was provided after responding to the within a min after completing the first response, the sequence was active nose-poke. Responses to the active and inactive holes and also reinitiated. all responses executed during the time-out period were recorded. During the drug-free period, neither reinforcer nor contingent 2.6.4. Establishment of mice subpopulations cue light was delivered, and this period was signaled by the After performing the three behavioral tests, mice were illumination of the whole self-administration chamber. The session categorized into “addicted” and “non-addicted” animals based on was concluded after 50 reinforcers were delivered or after 125 min, the number of achieved positive criteria. A mouse was considered whichever occurred first. If a mouse reached 50 reinforcers, the positive for an addiction-like criterion when the score of the limit was expanded to 100 reinforcers in the following session. The behavioral test was equal to or beyond the 75th percentile of acquisition of the self-administration behavior was achieved when the normal distribution of the vehicle group. Mice that achieved all of the following conditions were met: (1) mice maintained 80% 2 or 3 criteria were considered “addicted” and categorized as stability in three consecutive sessions, that is, the variance across vulnerable, whereas those reaching 0 or 1 criteria were considered these 3 days was 20% or less, (2) at least 75% responding in the “non-addicted” and categorized as resilient. active hole, and (3) a minimum of five reinforcers per session. After each session, mice were brought back to their home cages. 2.6.5. Extinction and parameters related to craving 2.6.3. Three addiction-like criteria Only mice with patent catheters that achieved all acquisition The development of addictive-like behaviors was evaluated at criteria continued to the extinction phase. After thiopental testing, the end of the training sessions based on three addiction-like mice were allowed to rest for 1 day, during which they underwent criteria that summarize the addiction hallmarks according to the a 2-h locomotion test in individual locomotor activity boxes DSM-5 (29, 30). The addiction-like score developed was then (10.8 × 20.3 × 18.6 cm, Imetronic, Pessac, France) equipped with attributed based on the results of these three criteria, determined infrared sensors to detect locomotor activity and an infrared plane by the respective behavioral test: to detect rearings. During the extinction period, neither WIN 55,212-2 infusions 2.6.3.1. Persistence of response nor the associated environmental cues were delivered after nose- Non-reinforced active responses during the 15 min drug-free poking in the active hole. Mice were exposed to 2-h daily sessions period were measured as persistence of drug-seeking behavior. for 12 consecutive days in the same operant chamber as the Mice were scored on the three consecutive days before the self-administration sessions. During this period, the extinction progressive ratio (PR). criterion was achieved when active responses were <35% of the mean responses obtained during the last 3 days of WIN 55,212- 2.6.3.2. Motivation 2 self-administration across three consecutive extinction sessions. The PR schedule of reinforcement evaluated the motivation for Only mice that met the extinction criterion were evaluated for WIN 55,212-2. The responses required to receive one single drug reinstatement. Two parameters related to craving were evaluated infusion escalated following this series: 1, 5, 12, 21, 33, 51, 75, 90, before and after this extinction period: 120, 155, 180, 225, 260, 300, 350, 410, 465, 540, 630, 730, 850, 1,000, 1,200, 1,500, 1,800, 2,100, 2,400, 2,700, 3,000, 3,400, 3,800, 4,200, 2.6.5.1. Resistance to extinction 4,600, 5,000, and 5,500. The breaking point, the maximal number Number of active responses in 2 h during the first extinction of responses the animal performs to obtain one infusion, defined as session. Animals with significant sensitivity to drug withdrawal the motivation value, corresponds to the last ratio completed. The would increase their resistance to extinction by enhancing the duration of the PR session was maximum 4 h-long or until mice number of active nose-pokes to seek the drug when access is stopped responding to any nose-poke within 1 h. prevented for 2 h the first time after the training sessions (31–33). Frontiers in Psychiatry 04 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 2.6.5.2. Drug-seeking behavior measured by cue-induced collected and incubated in isopropanol to isolate the RNA. Samples reinstatement of WIN 55,212-2-seeking behavior were kept in dry ice meanwhile to ensure their integrity. Tubes The day after reaching the extinction criterion, we performed a were then centrifuged and pellets were resuspended in 75% single cue-induced reinstatement test in the same operant chamber, ethanol, before another centrifugation. Supernatants were carefully in order to test reinstatement of drug-seeking behavior upon discarded to air dry the pellet for at least 2 h. Finally, pellets were exposure to the environmental stimuli. The cue test was conducted resuspended in RNase-free water, incubated for 15 min at 55– under the same conditions used in the acquisition phase, except 60◦ C and stored at −80◦ C. RNA concentrations were quantified by that active responding was not reinforced by the drug. Mice were Nanodrop (NanoDrop One, Thermo Fisher Scientific, USA). exposed to a 90-min FR2 session, where the first 60 min were similar to an extinction session, but in the last 30 min, nose- 2.7.3. Quantitative polymerase chain reaction poking in the active hole led to the presentation of all associated (qPCR) environmental cues (cue light, pump noise, and priming injection The quantitative conversion of the extracted RNA into light), but not the delivery of WIN 55,212-2. single-stranded complementary DNA (cDNA) was performed using random primers included in the High Capacity cDNA 2.6.6. Behavioral tests to evaluate addiction-like Reverse Transcription (RT) kit (Applied Biosystems, 4390778, phenotypic traits Thermo Fisher Scientific, USA). Real-time PCR analysis was Two additional phenotypic traits were also evaluated as factors carried out with the following primers (Sigma-Aldrich, USA): of vulnerability to addiction-like behavior: drd1: forward “AGATTGACCAGGAAGAGGCC,” reverse “GCAATCCAAGCCATACCAGG”; drd2: forward “CCATCTC 2.6.6.1. Impulsivity TTGCCCACTGCTCTTTGG,” reverse “GGTGACGATGAAGGG Non-reinforced active responses during the time-out periods CACGTAGAAC”; adora2a: forward “CGTCACCAACTT (10 s) after each drug delivery were used as measures of impulsivity- CTTCGTGG,” reverse “GCTGAAGATGGAACTCTGCG”; like behavior, which indicated the inability to end a response once cnr1: forward “CCTGGGAAGTGTCATCTTTGT,” reverse it is initiated. The three consecutive days before the PR test were “GGTAACCCCACCCAGTTTGA.” These primers were used in considered for this criterion. Mice were then categorized as high- combination with the PowerSYBR Green PCR MasterMix kit impulsive (HI) (score above the median) or low-impulsive (LI) (Applied Biosystems, Thermo Fisher Scientific, USA). Assays (score below the median), as previously described (34, 35). The were analyzed with the QuantStudioTM 12K Flex real-time PCR different subpopulations were split according to the median since system (Applied Biosystems, Thermo Fisher Scientific, USA). impulsivity data was not normally distributed. Relative expression of mRNAs was determined after normalization with a housekeeping gene using the 11Ct method. All validated 2.6.6.2. Sensitivity to reward differentially expressed genes were normalized using β-actine. The The number of reinforcers obtained in 2-h sessions during the gene expression of β-actine was measured as housekeeping gene last three consecutive FR2 operant conditionings maintained by in these samples using quantitative polymerase chain reaction WIN 55,212-2. Animals with higher levels of sensitivity to reward (qPCR) to verify that the expression of these genes was not affected will obtain a higher number of reinforcers. by the operant model used. 2.8. Statistics 2.7. Gene expression analysis 2.8.1. Statistical analysis of behavioral data 2.7.1. Tissue preparation The number of mice (n) in each experimental condition Tissue collection was performed immediately after the cue- is indicated in figure legends. All statistical comparisons were induced reinstatement test. Mice were euthanized by cervical performed with SPSS (IBM, version 25). Comparisons between two dislocation. Immediately afterward, brains were extracted from groups were performed by Student’s t-test or U Mann–Whitney the skull and processed rapidly on ice. The medial prefrontal test depending on the distribution defined by the Shapiro–Wilk cortex (mPFC), nucleus accumbens (NAc), dorsal striatum (DS), test. ANOVA with repeated measures (or Friedman test when non- and hippocampus (HPC) were isolated according to the following parametric) was employed when required to test the evolution over coordinates from the Paxinos and Franklin atlas (36): (mPFC) AP time, with subsequent post hoc analysis (Fisher LSD). Two-way +1.98 mm; (NAc) AP +1.94 mm; (DS) AP +0.62 mm; (HPC) AP ANOVA with subsequent post hoc analysis (Tukey) was used for −2.92 mm. Samples were placed in individual tubes, frozen on dry multiple group comparisons. The Pearson correlation coefficient ice and stored at −80◦ C until RNA isolation. The remaining brain was performed to analyze the relationship between values in each parts from the same animals were also frozen on dry ice and stored addiction-like criterion and the final criteria achieved. The Chi- at −80◦ C. square analysis was used to compare the percentage of “addicted” with the “non-addicted” mice. Results were expressed as individual 2.7.2. RNA extraction values with the median and the interquartile range or with the Total RNAs from the mPFC, NAc, DS, and HPC were extracted mean ± SEM, specified in the figure legend. A p-value < 0.05 was using TRIzolTM (Thermo Fisher Scientific, USA) for subsequent used to determine statistical significance. RT-PCR analysis. Briefly, tissues were homogenized in TRIzol The sample size was calculated based on the power analysis. reagent and, after adding chloroform, the aqueous phase was The significance criterion (alpha) was set at 0.050 and the statistical Frontiers in Psychiatry 05 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 test used was the two-sample t-test. With the sample size of 14– that present a high persistence of response, motivation, and 16 mice per group, our studies achieved a power superior to 80%. compulsivity were observed in both groups. Additionally, positive Supplementary Tables 1–7 give details of the statistical results for correlations between the number of responses to each addiction- the data presented in the figures. like criterion (non-reinforced active responses, breaking point or number of shocks) and the number of addiction-like criteria 2.8.2. Principal component analysis achieved were found in the vehicle group, while the THC group The principal component analysis (PCA) was performed to presented only a positive correlation for the motivation (Pearson evaluate the multidimensional behavioral data by reducing it correlations, p < 0.05, p < 0.01, Figures 1J–L), where “addicted” to fewer dimensions to observe trends, jumps, clusters, and mice showed the highest values. Mice individually classified into outliers. PCA and varimax rotation were conducted using the three the “addicted” group following the previously described criteria addiction-like criteria, the two parameters related to craving and were 37.5% in the vehicle pre-treated group and 35.71% in mice the two phenotypic traits considered as vulnerability factors of receiving THC during adolescence (Chi-square, C-S = 0.019, n.s., addiction-like behavior, and dimensionality was reduced to the Figure 1F). Based on this classification, addiction-like behaviors minimum number of components that best explain and maximize were compared, revealing that vehicle pre-treated “addicted” mice the variance present in the data set. An eigenvalue greater than 1 had higher persistence of response than “non-addicted” mice was set as the selecting criterion. (Student’s t-test, t = −2.72, p < 0.05, Figure 1G), whereas no significant differences were found between “addicted” and “non- addicted” mice in terms of motivation and compulsivity regardless 3. Results of the treatment (Figures 1H, I). 3.1. Effects of THC pre-treatment during adolescence on the operant model of 3.3. THC pre-exposure during cannabinoid addiction-like behavior adolescence decreased the resistance to using WIN 55,212-2 self-administration extinction in adulthood training in adulthood Mice then underwent 12 sessions of extinction. The extinction We explored the effects of THC exposure in adolescent mice on trend of both groups was similar, indicating that both displayed specific behavioral signatures of cannabis addiction-like behavior the same ability to extinguish the self-administration behavior in adulthood. Mice were trained to acquire an operant self- (Repeated measures ANOVA, F (1 ,26) = 1.20, n.s., Figure 2A). administration conditioning maintained by iv infusions of WIN A total of 26.7% of vehicle and 8.3% of THC pre-treated mice 55,212-2 under an FR1 schedule of reinforcement during 5 sessions (Chi-square, C-S = 2.06, n.s.) acquired the extinction criteria, as followed by 5 sessions under FR2, for a total of 10 consecutive previously described. sessions (Figure 1A). Under the FR1 schedule, no significant Two parameters closely related to craving and reinstatement of differences were found between THC and vehicle pre-treated mice, drug-seeking were evaluated. First, the pattern of activity on the suggesting similar reinforcing effects of WIN 55,212-2 (Repeated first extinction day was evaluated every 10 min as a measurement measures ANOVA, F (1 ,28) = 0.00, n.s., Figure 1B). When the of resistance to extinction (Supplementary Figure 2). All groups requirement was increased to FR2, THC pre-treated mice showed a highly responded to the previous active nose-poke at the beginning tendency to obtain a higher number of reinforcers (mean ± SEM of the session, meaning that mice were seeking the reinforcer of the last three operant sessions = 15.7 ± 3.18) compared to and the cue light associated with it. However, as non-reinforced vehicle pre-treated mice (mean ± SEM of the last three operant sessions continued, we see that this behavior diminished, which sessions = 11.81 ± 1.31), which was maintained until the end is characteristic of an extinction behavior. THC pre-treated mice of the sessions (Repeated measures ANOVA, F (1 ,28) = 1.00, n.s.). responded less during the first extinction session than vehicle pre- The acquisition of operant learning was equivalent between groups treated mice (Student’s t-test, t = −2.18, p < 0.05, Figure 2B). (percentage of mice having acquired the behavior: 58.82% of vehicle In a two-way ANOVA analysis, this global treatment effect and 50% of THC, Chi-square, C-S = 0.45, n.s.). was also observed between THC and vehicle pre-treated mice. When separating groups into “addicted” and “non-addicted,” an increased resistance to extinction was observed in “addicted” mice 3.2. Mouse model of addiction-like compared to “non-addicted” [two-way ANOVA, Treatment effect: behavior using WIN 55,212-2 F(1,25) = 6.872, p < 0.05, Phenotype effect: F(1,25) = 12.52, self-administration and THC p < 0.01, Interaction: F(1,25) = 1.998, n.s., Figure 2D]. In the pre-treatment during adolescence vehicle group, active nose-pokes in the first session were very high and decreased across sessions until reducing by 70% in the last After the operant training, the addiction-like behaviors were session compared to the first one, whereas THC pre-treated mice evaluated, as explained above. No significant differences were found decreased only by 30% (Figure 2A). In addition, active nose-poking between THC and vehicle pre-treated mice in any of the addiction- by both groups was significantly higher than inactive nose-poking like criteria, namely, persistence of response, motivation, and (Repeated measures ANOVA, F (1 ,48) = 15.26, p < 0.001, post-hoc compulsivity (Figures 1C–E). As expected, extreme subpopulations DMS test: Actives vs. Inactives: p < 0.001 in all the comparisons). Frontiers in Psychiatry 06 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 FIGURE 1 THC administration during adolescence led to the development of an addictive-like phenotype after WIN 55,212-2 operant self-administration in adult mice. (A) Timeline of the experimental sequence of the WIN 55,212-2 self-administration mouse model. (B) Number of infusions obtained by vehicle and THC pre-treated groups during 2 h of operant self-administration maintained by intravenous infusions of WIN 55,212-2 under both FR1 and FR2 schedules of reinforcement (mean ± SEM, repeated measures ANOVA). (C–E) Mice presented similar responses in the three addiction-like criteria tests (individual data with median and interquartile range). (C) Persistence of response: number of active nose-poke responses during the 15 min drug-free period (U Mann–Whitney). (D) Motivation: breaking point determined during a 4 h progressive schedule of reinforcement represents the maximal number of responses that an animal is able to emit to obtain one drug infusion (Student’s t-test). (E) Compulsivity: number of shocks received following the schedule described in section “Materials and methods”, reflecting the compulsivity level of each group (U Mann–Whitney). The dashed horizontal line indicates the 75th percentile of the distribution of the group, used as the threshold to consider a mouse positive for one criterion. “Addicted” mice are represented in gray-filled circles for the vehicle group and green-filled circles for the THC group. (F) Percentage of mice categorized as “addicted” (Chi-square). (G–I) Behavioral tests of the three addiction-like criteria when separated between “addicted” and “non-addicted” (individual data with median and interquartile range, Student’s t-test for persistence and motivation, U Mann–Whitney for compulsivity, *p < 0.05). Pearson correlations between individual values of addiction-like criteria, and (J) non-reinforced active responses in 15 min, (K) breaking point in 4 h, and (L) number of shocks in 50 min (nVehicle = 16, nTHC = 14; statistical details are included in Supplementary Table 1). Frontiers in Psychiatry 07 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 FIGURE 2 THC administration during adolescence favored the parameters related to craving and the phenotypic vulnerability traits to addiction-like behavior after WIN 55,212-2 operant self-administration in adult mice. (A) Extinction pattern of the WIN 55,212-2 self-administration behavior (mean ± SEM, repeated measures ANOVA). (B,C) Behavioral tests of the two parameters related to craving (individual data with median and interquartile range). (B) Resistance to extinction: number of active nose-poke responses during the first 2-h extinction session is significantly higher in vehicle compared to THC pre-treated mice (Student’s t-test, *p < 0.05). (C) Drug-seeking behavior with the cue-induced reinstatement after abstinence: number of active responses performed during the 90 min cue-induced drug-seeking test performed after extinction (Student’s t-test). The dashed horizontal line indicates the 75th percentile of distribution of the group, used as the threshold to consider a mouse positive for one criterion. “Addicted” mice are represented in gray-filled circles for the vehicle group and green-filled circles for the THC group. (D,E) Behavioral tests regarding the parameters related to craving when separating between “addicted” and “non-addicted” mice (individual data with mean ± SEM). (D) In resistance to extinction, an effect of THC pre-treatment was detected between vehicle and THC groups as well as an effect of phenotype between “addicted” and “non-addicted” mice (two-way ANOVA, Treatment effect = *p < 0.05, Phenotype effect = + p < 0.01). (E) Higher drug-seeking behavior was observed in “addicted” vehicle pre-treated animals compared to “non-addicted” (U Mann–Whitney, *p < 0.05). Pearson correlations between individual values of addiction-like criteria, and (F) number of responses in 2 h during the first day of extinction and (G) number of responses in 90 min during the cue-induced reinstatement test. (H,I) Behavioral tests used to evaluate phenotypic traits considered to be factors of vulnerability to addiction-like behavior (individual data with median with interquartile range). (H) Impulsivity: number of responses to the active nose-poke during the 10 s time-out period (Student’s t-test, *p < 0.05). (I) Reward sensitivity: number of reinforcers performed to the active nose-poke during the 2 h of the last three sessions of self-administration (U Mann–Whitney). (J,K) Behavioral tests of the phenotypic traits showing higher reward sensitivity in “addicted” mice pre-treated with vehicle compared to “non-addicted”, whereas this difference was observed in the THC group for impulsivity (individual data with mean ± SEM, U Mann–Whitney, *p < 0.05). (L,M) Pearson correlations between individual values of addiction-like criteria, and (L) number of active responses during time-out period and (M) number of reinforcers in 2 h in the last three consecutive days of operant training (nVehicle = 16, nTHC = 14; statistical details are included in Supplementary Table 2). Frontiers in Psychiatry 08 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 On the first, third and fourth extinction sessions, vehicle pre- THC pre-treated low-impulsive mice (Repeated measures ANOVA, treated mice showed less extinction responding compared to mice F (1 ,26) = 3.44, p < 0.05, post-hoc DMS test: HI THC vs. LI THC: pre-treated with THC (Student’s t-test, p < 0.05). p < 0.01, Figure 3C), as well as to high-impulsive mice pre-treated The reinstatement of drug-seeking behavior was evaluated after with vehicle during sessions 4 (U Mann–Whitney, U = 1.000, mice achieved extinction. No significant differences were found p < 0.01) and 5 (U Mann–Whitney, U = 7.000, p < 0.05). between vehicle and THC pre-treated groups regarding the cue- Also, high-impulsive mice pre-treated with THC presented higher induced reinstatement of drug-seeking behavior. Only a significant responses in the FR2 schedule compared to high-impulsive mice difference was revealed when comparing “addicted” and “non- pre-treated with vehicle and to both low-impulsive mice (Repeated addicted” mice pre-treated with vehicle. Indeed, “addicted” mice measures ANOVA, F (1 ,26) = 12.73, p < 0.001, post-hoc DMS test: pre-treated with vehicle presented higher responses than vehicle HI THC vs. HI vehicle: p < 0.01, HI THC vs. LI vehicle: p < 0.001, “non-addicted” mice (U Mann–Whitney, U = 10.000, p < 0.05) and HI THC vs. LI THC: p < 0.001). Furthermore, high-impulsive (Figures 2C–E). mice presented higher motivation compared to low-impulsive mice only in the THC pre-treated group, whereas no significant results were revealed for other addiction-like criteria (U Mann–Whitney, 3.4. THC exposure during adolescence U = 7.000, p < 0.05, Figures 3D–F). increased impulsivity-like behavior in No significant differences were revealed in the parameters related to craving (Figures 3G, H). Both low-impulsive (U Mann– adulthood Whitney, U = 15.000, p < 0.05) and high-impulsive mice (U Mann– Whitney, U = 0.000, p < 0.001) receiving THC during adolescence Two additional phenotypic traits considered as factors of show more extreme values of impulsivity compared to those pre- vulnerability to substance misuse were evaluated. THC pre-treated treated with vehicle (Figure 3I). As expected, high-impulsive mice mice displayed higher impulsivity-like behavior compared to have higher impulsivity than low-impulsive mice regardless of the vehicle pre-treated mice (Student’s t-test, t = −2.17, p < 0.05, treatment (U Mann–Whitney, U = 0.000, p < 0.001 for vehicle, Figure 2H), an effect that was more pronounced in “addicted” and U Mann–Whitney, U = 0.000, p < 0.001 for THC). In terms mice pre-treated with THC (U Mann–Whitney, U = 6.500, of reward sensitivity, a phenotypic difference was found between p < 0.05, Figure 2J). Contrary, no significant differences were low-impulsive and high-impulsive mice, as well as an effect of the found between vehicle and THC pre-treated groups for the reward treatment and of the interaction between both [two-way ANOVA, sensitivity during the last 3 days of operant training (Figure 2I), Phenotype effect: F(1,26) = 39.38, p < 0.001, Treatment effect: although “addicted” mice pre-treated with vehicle had more F(1,26) = 5.194, p < 0.05, Interaction: F(1,26) = 7.314, p < 0.05, reward sensitivity compared to “non-addicted” (U Mann–Whitney, Figure 3J]. High-impulsive animals pre-treated with THC showed U = 10.000, p < 0.05, Figure 2K). These results were emphasized by the positive correlations found between the number of responses higher reward sensitivity compared to low-impulsive mice pre- to each addiction-like criterion and the number of addiction-like treated with THC (Tukey’s multiple comparisons, p < 0.001), as criteria achieved (Pearson correlations, Figures 2F, G, L, M). well as to high-impulsive mice pre-treated with vehicle (Tukey’s multiple comparisons, p < 0.05). 3.5. High- and low-impulsive subgroups reveal behavioral differences in adult 3.6. THC pre-treatment did not produce mice after WIN 55,212-2 major long-term behavioral or somatic self-administration alterations To further investigate the enhanced impulsive behavior 19 -Tetrahydrocannabinol exposure has been reported to promoted by THC pre-exposure, mice were categorized into high- produce a series of behavioral and somatic alterations (37). Several impulsive and low-impulsive subgroups defined according to the behavioral and somatic responses (body weight, food intake, and median (see section “Materials and methods”). We find 50.0% of locomotor activity) were monitored throughout the experiment in high-impulsive mice in the vehicle group and 71.43% in the THC order to verify that THC pre-treatment during adolescence at the group (Chi-square, C-S = 2.571, n.s., Figure 3A). High-impulsive dose of 5 mg/kg did not produce any long-term effect in adulthood mice pre-treated with THC showed a higher number of active that could bias our self-administration protocol. No significant responses during the time-out period compared to high-impulsive differences were observed between THC and vehicle pre-treated mice pre-treated with vehicle, as well as to low-impulsive mice mice in body weight and food intake during the whole operant under both the FR1 (Repeated measures ANOVA, F (1 ,26) = 3.46, sequence, even though the weight gain of mice pre-treated with p < 0.05, post-hoc DMS test: HI THC vs. HI vehicle: p < 0.05, THC was apparently lower than that of vehicle pre-treated mice HI THC vs. LI vehicle: p < 0.05, Figure 3B) and FR2 schedules during the adolescent treatment (Supplementary Figures 1A–C). (Repeated measures ANOVA, F (1 ,26) = 7.86, p < 0.001, post-hoc This is in accordance with previous studies employing similar DMS test: HI THC vs. HI vehicle: p < 0.01, HI THC vs. LI vehicle: protocols that have shown that THC treatment may reduce weight p < 0.001). Moreover, high-impulsive mice pre-treated with THC gain in adolescent mice compared to vehicle pre-treated animals obtained a higher number of reinforcers during the operant (27, 38). Moreover, no significant differences were observed conditioning when tested under the FR1 schedule compared to between groups in the number of beam breaks per 10 min during Frontiers in Psychiatry 09 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 FIGURE 3 Characterization of low-impulsive (LI) and high-impulsive (HI) subgroups. (A) Percentage of mice categorized as LI and HI (Chi-square). (B) HI mice pre-treated with THC showed a higher number of responses during the time-out period under both FR1 and FR2 schedules compared to HI mice pre-treated with vehicle, as well as to LI mice (repeated measures ANOVA, *p < 0.05 session effect in FR1, + p < 0.05 treatment effect in FR1, +++ p < 0.001 treatment effect in FR2). (C) HI mice pre-treated with THC showed higher acquisition of the operant conditioning under FR2 schedule compared to HI mice pre-treated with vehicle, as well as to LI mice (Repeated measures ANOVA, ***p < 0.001 session effect in FR1, ++ p < 0.01 treatment × session effect in FR1, + p < 0.05 treatment effect in FR1; +++ p < 0.001 treatment effect in FR2). (D–F) Behavioral tests of the three addiction-like criteria when separated between LI and HI (mean ± SEM, U Mann–Whitney, *p < 0.05). (G–J) Behavioral tests of the (G,H) two parameters related to craving (Student t-test or U Mann–Whitney) and (I,J) the two phenotypic vulnerability traits when separated between LI and HI (mean ± SEM, impulsivity: Student t-test or U Mann–Whitney, reward sensitivity: two-way ANOVA with Tukey’s multiple comparisons test, *p < 0.05, ***p < 0.001) (nVehicle = 16, nTHC = 14; statistical details are included in Supplementary Table 3). Frontiers in Psychiatry 10 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 120 min (Supplementary Figure 1D), which supports the absence study, the expression of drd1, drd2, and adora2a genes was of major behavioral alteration promoted by THC pre-exposure. found to be upregulated in food- and cocaine-addicted mice after operant self-administration paradigms (40). Moreover, the cnr1 gene has been revealed to be involved in addictive disorders (41). 3.7. Principal component analysis of THC Consequently, RT-qPCR assays were performed to compare the differential gene expression of these candidate genes in areas of exposure during adolescence in the mesocorticolimbic circuit. No significant differences between self-administration of WIN 55,212-2 in THC and vehicle pre-treated mice were revealed in the mPFC adulthood (Figures 6A–D ). However, a downregulation in the expression of the drd2 gene was observed in “addicted” mice pre-treated Principal component analysis was used to characterize whether with vehicle compared to “non-addicted” in this brain area (U the behavioral outcomes previously described could be reduced to Mann–Whitney, U = 6.000, p < 0.05, Figure 6G). No significant fewer dimensions. All addiction-like criteria, parameters related differences were found for cb1 (Figure 6E), drd1 (Figure 6F) or to craving, and phenotypic traits were taken into account. This adora2a (Figure 6H). In the NAc, drd2 and adora2a expression was analysis separated two clear clusters representing the separation significantly downregulated in THC pre-treated mice compared to between the “addicted” and “non-addicted” groups and both vehicle (Student’s t-test, t = 2.60, p < 0.05 and t = 2.83, p < 0.01, populations present clear behavioral differences that allow for a respectively, Figures 6K, L), and these differences were specifically distinction (Figure 4B). Component 1 accounts for 26.2% of the found in “addicted” mice (Student’s t-test, t = 2.44, p < 0.05 and variance (Figures 4A, B) and has strong loadings (>0.7) from t = 3.10, p < 0.05, respectively, Figures 6O, P). Similarly, drd2 three behavioral variables: motivation, impulsivity, and reward and adora2a expression was downregulated in THC pre-treated sensitivity. The second component is orthogonal to component mice in the HPC (Student’s t-test, t = 2.54, p < 0.01 and U 1, accounts for 26.0% of the variance, and comprises four Mann–Whitney, U = 31.000, p < 0.05, respectively, Figures 7K, variables: the criteria of persistence of response, compulsivity, L), and these differences were specifically found in “addicted” resistance to extinction, and drug-seeking behavior. Impulsivity mice (Student’s t-test, t = 3.18, p < 0.05 and t = 3.06, p < 0.05, participates more in the first component, while compulsivity respectively, Figures 7O, P). No significant differences were found is more critical in the second component (Figures 4C, D), for cb1 or drd1 in the NAc (Figures 6I, J, M, N) or the HPC resembling the sequential feature of the transition from impulsivity (Figures 7I, J, M, N). No significant differences were found in the to compulsivity that has been described in addiction (39). Also, DS (Figures 7A–H). motivation and compulsivity belong to different components, as the neural substrate of each addiction criterion is different (15). 4. Discussion 3.8. Correlation heatmap between the In this study, we assessed the effects of THC exposure during addiction-like criteria, parameters adolescence on the vulnerability to develop cannabis addiction-like related to craving and vulnerability behavior and related behavioral alterations in adulthood by using phenotypic traits a WIN 55,212-2 self-administration mouse model. We found that chronic exposure to THC from PND 37 to 57 increased impulsivity When representing the addiction-like criteria, parameters in adult mice, which was more pronounced in the subgroup of related to craving and phenotypic traits in a heat map (Figure 5), mice that developed the addiction-like criteria. Furthermore, THC we revealed significant correlations in “non-addicted” animals treatment during adolescence increased the percentage of high- between response persistence and impulsivity (r = 0.49, p < 0.05), impulsive mice and favored the reinforcement of WIN 55,212-2 persistence of response and sensitivity to reward (r = 0.54, p < 0.05), in this group. Moreover, high-impulsive mice pre-treated with persistence of response and drug-seeking behavior (r = 0.52, THC presented an increased reward sensitivity compared to low- p < 0.05), and sensitivity to reward and impulsivity (r = 0.91, impulsive mice pre-treated with THC, as well as to high-impulsive p < 0.05). In “addicted” animals, a significant correlation was mice pre-treated with vehicle. Inversely, pre-exposure to THC revealed between drug-seeking behavior and drd2 NAc (r = 0.76, during adolescence decreased the resistance to extinguishing the p < 0.01). operant behavior. Impulsivity is a complex construct defined as a “predisposition toward rapid, unplanned reactions to internal and external stimuli without regard for the negative consequences of these 3.9. THC exposure during adolescence reactions to themselves or others” (42) that is composed of produced a downregulation of the drd2 motor and choice impulsivity (43–47). Motor impulsivity is and adora2a gene expression in the NAc described as the inability to inhibit behavior by changing the and HPC course of action or to stop a response once it is initiated (48). We have defined motor impulsivity as the non-reinforced The mPFC, NAc, DS, and HPC were extracted at the end of the active nose-pokes during the time-out periods that reflect the operant evaluation to study potential neurobiological alterations motor disinhibition, as previously described (47). Compulsivity promoted by THC pre-exposure during adolescence. In a previous has its roots in the signs associated with obsessive-compulsive Frontiers in Psychiatry 11 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 FIGURE 4 Principal component analysis of the effect of adolescent THC exposure in WIN 55,212-2 operant self-administration in adulthood. (A) Factor loadings of principal component 1 (PC1) and principal component 2 (PC2) for all variables studied. (B) Individual mice clustered according to addiction or non-addiction in the space yielded by the 2 PCA components, which accounted for the maximum data variance, with factor loadings of 26.2% for PC1 and 26.0% for PC2. (C,D) Order of factor loading of the different variables in PC1 and PC2. The dashed horizontal line marks loading greater than 0.7, mainly contributing to the component. In regards to the addiction-like criteria, a dissociation between motivation, mainly contributing to PC1, and compulsivity, mainly contributing to PC2, can be observed. Moreover, impulsivity and reward sensitivity weighted more in the PC1, while resistance to extinction and drug-seeking weighted more in the PC2. disorder and might comprise repetitive behaviors in the face rats displayed greater resistance to punishment of the cocaine- of adverse consequences after the loss of control (49). As taking response compared to low impulsive rats, while a correlation such, we implemented a punishment-based behavioral test analysis revealed, at the population level, that impulsivity predicts where perseverance in responding despite punishment defined compulsivity (56). Compulsivity shares similarities with impulsivity compulsive behavior. Finally, reward sensitivity represents the in inhibitory control dysfunction, which relates to alterations in tendency of individuals to approach a positive reinforcer (50). In the mPFC networks to subcortical regions. However, impulsivity this article, it is operationally defined as the mean of drug infusions and compulsivity may be on a continuum, with compulsivity obtained during the last three sessions of operant training. being repetitive and perseverative (57). In our study, THC pre- treatment during adolescence did not increase the percentage of 19 -Tetrahydrocannabinol pre-treatment during adolescence mice reaching cannabinoid addiction-like criteria but increased the increased impulsivity in adulthood. Although impulsive behavior levels of impulsivity-like behavior. Furthermore, within this group, may be a pre-existing trait that promotes the usage of drugs, “addicted” mice showed the highest values of motor impulsivity acute and chronic cannabis consumption may result in behavioral compared to the rest of the groups. This result highlights that the changes, including increases in impulsivity, which may facilitate interaction between THC adolescent exposure and impulsivity in further drug use or the transition to use other drugs of abuse addiction development should be explored further. according to the gateway theory (51). In humans, marijuana use Our results are in accordance with observations suggesting an has been associated with increased impulsivity when given in an overrepresentation of highly impulsive individuals with substance acute (52) or chronic manner (53). Concomitantly, individuals abuse disorders and a high comorbidity between impulsive with CUD have been shown to present increased impulsivity (54). behavior and substance misuse (56). Indeed, the development Interestingly, impulsivity is suggested to predispose compulsivity, of drug addiction would represent a progression from initial which leads to drug abuse and addiction (55, 56). Indeed, it has impulsivity mediated by the NAc to compulsive, habitual been shown that high impulsivity predicts the transition from responding, a hallmark feature of addiction (49, 56). Accordingly, controlled to compulsive cocaine-taking in rats, as high impulsive in our study, PCA analysis separated the constructs of impulsivity Frontiers in Psychiatry 12 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 FIGURE 5 Correlation heatmap of the variables of cannabis addiction-like criteria, parameters related to craving and vulnerability phenotypic traits. (A,B) Pearson correlations between the three addiction-like criteria, the two parameters related to craving and the two phenotypic traits in both (A) “non-addicted” and (B) “addicted” groups (Pearson correlation, *p < 0.05, **p < 0.01, ***p < 0.001). Frontiers in Psychiatry 13 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 FIGURE 6 drd1, drd2, adora2a, and cnr1 gene expression in the medial prefrontal cortex (mPFC) and nucleus accumbens (NAc) after adolescent THC exposure in WIN 55,212-2 operant self-administering adult mice. Gene expression measured by the 11Ct after RT-qPCR of cnr1, drd1, drd2, and adora2a in the PFC: (A–D) between vehicle and THC pre-treated mice respectively (mean ± SEM, Student’s t-test for CB1R and D1R, U Mann–Whitney for D2R and Adora2AR), (E–H) between “addicted” and “non-addicted” mice respectively (mean ± SEM, Student’s t-test or U Mann–Whitney, *p < 0.05). Gene expression measured by the 11Ct after qPCR of cnr1, drd1, drd2, and adora2a in the NAc: (I–L) between vehicle and THC pre-treated mice respectively (mean ± SEM, Student’s t-test, *p < 0.05, **p < 0.01), (M–P) between “addicted” and “non-addicted” mice respectively (mean ± SEM, Student’s t-test or U Mann–Whitney, *p < 0.05) (nVehicle = 16, nTHC = 14; statistical details are included in Supplementary Table 4). Frontiers in Psychiatry 14 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 FIGURE 7 drd1, drd2, adora2a, and cnr1 gene expression in the dorsal striatum (DS) and hippocampus (HPC) after adolescent THC exposure in WIN 55,212-2 operant self-administering adult mice. Gene expression measured by the 11Ct after RT-qPCR of cnr1, drd1, drd2, and adora2a in the DS: (A–D) between vehicle and THC pre-treated mice respectively (mean ± SEM, Student’s t-test for CB1R, D2R, and Adora2AR, U Mann–Whitney for D1R), (E–H) between “addicted” and “non-addicted” mice respectively (mean ± SEM, Student’s t-test). Gene expression measured by the 11Ct after qPCR of cnr1, drd1, drd2, and adora2a in the NAc: (I–L) between vehicle and THC pre-treated mice respectively (mean ± SEM, Student’s t-test for CB1R, D1R, and D2R, U Mann–Whitney for Adora2AR, *p < 0.05, **p < 0.01), (M–P) between “addicted” and “non-addicted” mice respectively (mean ± SEM, Student’s t-test or U Mann–Whitney, *p < 0.05) (nVehicle = 16, nTHC = 14; statistical details are included in Supplementary Table 5). Frontiers in Psychiatry 15 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 from compulsivity and reward sensitivity from resistance to users (62). Reduced D2R expression in the striatum has been extinction, distinguishing the two extremes in the development linked with enhanced impulsivity (7). Furthermore, low D2R continuum of the disorder between the early stage of onset and the availability in the striatum predicts subsequent levels of cocaine late stage of establishment (15). Consequently, exposure to THC self-administration in rhesus monkeys (77) and human cocaine during adolescence may increase the vulnerability to developing abusers (55). We suggest that adolescent THC exposure in our cannabis addiction by enhancing impulsivity. study, promoted impulsivity-like behavior in adulthood through High-impulsive mice pre-treated with THC obtained more the downregulation of drd2 expression in the NAc. The dopamine reinforcers during the operant conditioning sessions than vehicle- system exerts different roles in reinforcement, motivation, and treated mice, suggesting increased reinforcing effects of WIN self-regulation, leading to up and downregulated expression of 55,212-2. In the same line, the acquisition of WIN 55,212-2 self- the dopamine receptors as the addiction develops (76). Further administration was also reported to be enhanced in rats after research should assess whether the impulsivity trait predates the adolescent THC exposure, suggesting an increased sensitivity to onset of cannabis use or if the use of cannabis during adolescence the reinforcing effects of cannabinoid agonists in adulthood (26). produces alterations in the brain. However, the relationships between this change and impulsive Downregulation of the adora2a gene is also observed in the behavior were not evaluated in this previous study. Moreover, in NAc of mice exposed to THC during adolescence. Adenosine our study, THC pre-treatment increased the reward sensitivity to A2A receptors (A2AR) participate in the control of the rewarding WIN 55,212-2 in high-impulsive mice. It has been documented and motivational properties of drugs (78). In agreement with our that a history of cannabinoid exposure in adolescent animals may results, the specific involvement of the A2AR in the addictive- enhance the sensitivity to other drugs of abuse (58), as the positive related properties of THC has been demonstrated (79). Also, hedonic experience generated by these early cannabinoid exposures methamphetamine self-administration for 14 days in rats decreased may alter mesocorticolimbic dopaminergic pathways, increasing A2AR in the accumbens shell (80), whereas stimulation of the later probability of responding to other drugs of abuse A2AR was reported to decrease drug self-administration, primarily (15). Thus, understanding adolescent cannabis use mechanisms is through the formation of a heteromer with the D2R (81). crucial for drug use prevention, considering that several authors The drd2 gene is also downregulated in the mPFC of “addicted” have suggested a controversial gateway theory proposing that mice pre-treated with vehicle compared to “non-addicted.” In cannabis users gradually transition into taking more addictive agreement, a decrease in drd2 expression was reported in the drugs (59–62). Yet, further research is required, as other competing mPFC of addicted mice chronically treated with cocaine (82). This explanations of the association between cannabis use and the use of downregulation of the drd2 gene in the mPFC further supports the other illicit drugs have been debated over the last decades (63–65). impulsive phenotype revealed in “addicted” mice. THC treatment during adolescence decreased the resistance Pre-treatment with THC downregulated the drd2 gene in the to the extinction of WIN 55,212-2 self-administration behavior. Resistance to extinction can be observed as an “extinction burst” HPC. Accordingly, cocaine-induced downregulation of the D2R behavior typically seen in rodents during the first day of extinction in the HPC promotes spine plasticity that favors conditioned (31, 66–68), which is reported to reflect a “craving-like” state (17) place preference behaviors (83). The downregulation observed in directly linked with the vulnerability to relapse after abstinence (16, our study after THC during adolescence could alter short- and 17). The eCB system plays a central role in the regulation of learning long-term memory processes necessary for the development of and memory (69) and THC treatment during adolescence might cannabis addiction-like behavior in adulthood. The adora2a gene alter memory processes, leading to this lack of extinction burst that was also downregulated in the HPC, in accordance with literature reflects the strength of the previously acquired operant behavior. stating that deficits of A2AR function promote impulsive behavior A body of literature has demonstrated the deleterious impact of related to HPC modifications (84). Finally, no changes in cnr1 gene THC abuse during adolescence on memory function in adulthood expression were found in any of the four brain areas evaluated, in mice and rats (70–72). Cognitive deficits have also been revealed suggesting that any possible change in CB1R expression promoted in human cannabis users after chronic cannabis consumption, by THC exposure during adolescence might be transient. associated with sustained CB1R activation, particularly in working In this study, the male sex was chosen considering the memory and cognitive flexibility (73). It is possible that these previous literature on drug addiction models (22, 27). Considering cognitive deficits may have accounted for the differences in all these studies previously performed in male rodents, further resistance to extinction and impulsivity found in THC pre- research should now focus on the potential sex differences in the treated mice. propensity of adolescent THC exposure to increase the sensitivity Treatment with THC during adolescence produced a to other drugs of abuse. downregulation in the expression of the drd2 gene in the NAc. This is in agreement with previous studies in chronic cannabis users showing a blunted brain reactivity to dopamine-releasing stimulant drugs in the striatum (74, 75), where dopamine responses measured 5. Conclusion with PET and [11 C]raclopride in the NAc were inversely correlated with addiction severity and craving (74). This pattern is also shown In summary, this study revealed that THC exposure during in the chronic use of other drugs of abuse, like in cocaine-addicted adolescence promoted impulsivity in adulthood, increased WIN human patients, where a downregulation of the dopamine D2 55,212-2 reinforcement and favored the sensitivity to reward in receptor (D2R) was reported in the NAc after repeated exposure high-impulsive mice, and decreased the resistance to extinction. to the drug (76), which has not been revealed to date in cannabis The behavioral changes promoted by adolescent THC exposure Frontiers in Psychiatry 16 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 were associated with downregulation of drd2 and adora2a the “European Commission-DG Research” (PainFact, H2020- expression in NAc and HPC, which may be closely related to SC1-2019-2-RTD-848099 and QSPain Relief, H2020-SC1-2019-2- the changes revealed in impulsive-like behavior. These behavioral RTD-848068) to RM, the Spanish “La Caixa” Foundation under and neurochemical changes reveal long-lasting consequences the project code LCF/PR/HR22/52420017 to RM, the Spanish promoted by THC exposure during adolescence and further “Instituto de Salud Carlos III, RETICS-RTA” (RD16/0017/0020) emphasize the potential negative consequences related to early to RM, the Spanish “Ministerio de Sanidad, Servicios Sociales consumption of cannabis. e Igualdad, Plan Nacional Sobre Drogas” (PNSD-2021I076 to RM and PNSD-2019I006 to EM-G), and Ministerio de Ciencia e Innovación (ERA-NET NEURON) PCI2021-122073-2A to EM-G. MC-M acknowledged the Generalitat de Catalunya and Data availability statement the AGAUR for a “FI-SDUR” scholarship (EMC/3345/2020). AG-B acknowledged the Generalitat de Catalunya and the AGAUR for The original contributions presented in this study are included the “FI” scholarship (FI_B00337_2020). VC-A acknowledged the in the article/Supplementary material, further inquiries can be Spanish MCIN/AEI/10.13039/501100011033 for a “Juan de la directed to the corresponding authors. Cierva” fellowship (FJC2019-041020-I). Ethics statement Acknowledgments This animal study was reviewed and approved by the Comitè We thank M. Linares, R. Martín, D. Real, and F. Porrón for their Ètic d’Experimentació Animal-Parc de Recerca Biomèdica de technical support. Barcelona, CEEA-PRBB, agreement N◦ 9687. Conflict of interest Author contributions The authors declare that the research was conducted in the EM-G and RM conceived and designed the animal model and absence of any commercial or financial relationships that could be the behavioral approaches associated, and supervised and revised construed as a potential conflict of interest. the manuscript. MC-M, VC-A, and AG-B conducted the behavioral experiments, and molecular experiments and analysis, performed the statistical and data analyses, generated the associated graphs, Publisher’s note and interpreted the results under the supervision of EM-G and RM. MC-M, VC-A, and EM-G performed the catheterization surgeries. All claims expressed in this article are solely those of the MC-M wrote the manuscript and prepared the figures under the authors and do not necessarily represent those of their affiliated supervision of EM-G and RM. All authors contributed to the article organizations, or those of the publisher, the editors and the and approved the submitted version. reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. Funding This work was supported by the Spanish “Ministerio de Ciencia Supplementary material e Innovación (MICIN), Agencia Estatal de Investigación (AEI)” (PID2020-120029GB-I00/MICIN/AEI/10.13039/501100011033, The Supplementary Material for this article can be found RD21/0009/0019) to RM, the “Generalitat de Catalunya, AGAUR” online at: https://www.frontiersin.org/articles/10.3389/fpsyt.2023. (2017 SGR-669) to RM, the “ICREA-Acadèmia” (2020) to RM, 1148993/full#supplementary-material References 1. European Monitoring Centre for Drugs and Drug Addiction. European Drug 3. Ferland J-MN, Ellis RJ, Betts G, Silveira MM, Firmino JB, Wistanley C, et al. Long- Report; Trends and Developments. Portugal: European Monitoring Centre for Drugs term outcomes of adolescent THC exposure on translational cognitive measures in and Drug Addiction (2022). doi: 10.2810/75644 adulthood in an animal model and computational assessment of human data. JAMA Psychiatry. (2022) 80:66–76. doi: 10.1001/jamapsychiatry.2022.3915 2. Palacios-Ceña D, Jiménez-Trujillo I, Hernández-Barrera V, Florencio LL, Carrasco-Garrido P. Time trends in the co-use of cannabis and the misuse of 4. Casey BJ, Tottenham N, Liston C, Durston S. Imaging the developing brain: tranquilizers, sedatives and sleeping pills among young adults in spain between 2009 what have we learned about cognitive development? Trends Cogn Sci. (2005) 9:104–10. and 2015. Int J Environ Res Public Health. (2019) 16:3423. doi: 10.3390/ijerph16183423 doi: 10.1016/j.tics.2005.01.011 Frontiers in Psychiatry 17 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 5. Marsh R, Gerber AJ, Peterson BS. Neuroimaging studies of normal brain 33. Cooper J, Heron T, Heward W. Applied Behavior Analysis. Upper Saddle River, development and their relevance for understanding childhood neuropsychiatric NJ: Pearson Education (2007). disorders. J Am Acad Child Adolesc Psychiatry. (2008) 47:1233–51. doi: 10.1097/CHI. 34. Piazza PV, Deminière JM, Le Moal M, Simon H. Factors that predict individual 0b013e318185e703 vulnerability to amphetamine self-administration. Science. (1989) 245:1511–3. doi: 6. Simpson AK, Magid V. Cannabis use disorder in adolescence. Child Adolesc 10.1126/science.2781295 Psychiatr Clin N Am. (2016) 25:431–43. doi: 10.1016/j.chc.2016.03.003 35. Antoniou K, Papathanasiou G, Papalexi E, Hyphantis T, Nomikos GG, Spyraki 7. Volkow ND, Boyle M. Neuroscience of addiction: relevance to prevention and C, et al. Individual responses to novelty are associated with differences in behavioral treatment. Am J Psychiatry. (2018) 175:729–40. doi: 10.1176/appi.ajp.2018.17101174 and neurochemical profiles. Behav Brain Res. (2008) 187:462–72. doi: 10.1016/j.bbr. 2007.10.010 8. Volkow ND, Michaelides M, Baler R. The neuroscience of drug reward and addiction. Physiol Rev. (2019) 99:2115–40. doi: 10.1152/physrev.00014.2018 36. Franklin K, Paxinos G. The Mouse Brain in Stereotaxic Coordinates. Cambridge, MA: Academic Press (1997). 9. Compton WM, Wargo EM, Volkow ND. Neuropsychiatric model of addiction simplified. Psychiatr Clin North Am. (2022) 45:321–34. doi: 10.1016/j.psc.2022.05.001 37. Addams IB, Martin BR. Cannabis: pharmacology and toxicology in animals and humans. Addiction. (1996) 91:1585–614. 10. Dhein S. Different effects of cannabis abuse on adolescent and adult brain. Pharmacology. (2020) 105:609–17. doi: 10.1159/000509377 38. Stopponi S, Soverchia L, Ubaldi M, Cippitelli A, Serpelloni G, Ciccocioppo R. Chronic THC during adolescence increases the vulnerability to stress-induced relapse 11. Maldonado R, Berrendero F, Ozaita A, Robledo P. Neurochemical basis of to heroin seeking in adult rats. Eur Neuropsychopharmacol. (2014) 24:1037–45. doi: cannabis addiction. Neuroscience. (2011) 181:1–17. doi: 10.1016/j.neuroscience.2011. 10.1016/j.euroneuro.2013.12.012 02.035 39. Lüscher C, Robbins TW, Everitt BJ. The transition to compulsion in addiction. 12. Hurd YL, Manzoni OJ, Pletnikov MV, Lee FS, Bhattacharyya S, Melis M. Nat Rev Neurosci. (2020) 21:247–63. doi: 10.1038/s41583-020-0289-z Cannabis and the developing brain: insights into its long-lasting effects. J Neurosci. (2019) 39:8250–8. doi: 10.1523/JNEUROSCI.1165-19.2019 40. Navandar M, Martín-García E, Maldonado R, Lutz B, Gerber S, Ruiz de Azua I. Transcriptional signatures in prefrontal cortex confer vulnerability versus resilience to 13. Kandel D. Stages in adolescent involvement in drug use. Science. (1975) 190:912– food and cocaine addiction-like behavior. Sci Rep. (2021) 11:9076. doi: 10.1038/s41598- 4. doi: 10.1126/science.1188374 021-88363-9 14. Fergusson DM, Boden JM, Horwood LJ. Cannabis use and other illicit drug use: 41. Benyamina A, Kebir O, Blecha L, Reynaud M, Krebs M-O. CNR1 gene testing the cannabis gateway hypothesis. Addiction. (2006) 101:556–69. doi: 10.1111/j. polymorphisms in addictive disorders: a systematic review and a meta-analysis. Addict 1360-0443.2005.01322.x Biol. (2011) 16:1–6. doi: 10.1111/j.1369-1600.2009.00198.x 15. Koob G, Volkow ND. Neurobiology of addiction: a neurocircuitry analysis. 42. Moeller FG, Barratt ES, Dougherty DM, Schmitz JM, Swann AC. Psychiatric Lancet Psychiatry. (2016) 3:760–73. doi: 10.1016/S2215-0366(16)00104-8 aspects of impulsivity. Am J Psychiatry. (2001) 158:1783–93. doi: 10.1176/appi.ajp.158. 16. Venniro M, Caprioli D, Shaham Y. Animal models of drug relapse and craving: 11.1783 from drug-priming induced reinstatement to incubation of craving after voluntary 43. Koob G, Volkow ND. Neurocircuitry of addiction. Neuropsychopharmacology. abstinence. Prog Brain Res. (2016) 224:25–52. doi: 10.1016/bs.pbr.2015.08.004 (2010) 35:217–38. doi: 10.1038/npp.2009.110 17. Fredriksson I, Venniro M, Reiner DJ, Chow JJ, Bossert JM, Shaham Y. Animal 44. Dalley JW, Everitt BJ, Robbins TW. Impulsivity, compulsivity and top-down models of drug relapse and craving after voluntary abstinence: a review. Pharmacol cognitive control. Neuron (2011) 69:680–94. doi: 10.1016/j.neuron.2011.01.020 Rev. (2021) 73:1050–83. doi: 10.1124/pharmrev.120.000191 45. Belcher AM, Volkow ND, Moeller FG, Ferré S. Personality traits and 18. Piazza PV, Deroche-Gamonet V. A multistep general theory of transition to vulnerability or resilience to substance use disorders. Trends Cogn Sci. (2014) 18:211–7. addiction. Psychopharmacology. (2013) 229:387–413. doi: 10.1007/s00213-013-3224-4 doi: 10.1016/j.tics.2014.01.010 19. Hamilton PJ, Nestler EJ. Epigenetics and addiction. Curr Opin Neurobiol. (2019) 46. Maldonado R, Calvé P, García-Blanco A, Domingo-Rodríguez L, Senabre E, 59:128–36. doi: 10.1016/j.conb.2019.05.005 Martín-García E. Vulnerability to addiction. Neuropharmacology. (2021) 186:108466. 20. Flurkey K, Currer JM, Harrison DE. Mouse models in aging research. Mouse doi: 10.1016/j.neuropharm.2021.108466 Biomed Res. (2007) III:637–72. 47. Domingo-Rodriguez L, Cabana-Domínguez J, Fernàndez-Castillo N, Cormand 21. Compton DR, Gold LH, Ward SJ, Balster RL, Martin BR. Aminoalkylindole B, Martín-García E, Maldonado R. Differential expression of miR-1249-3p and miR- analogs: cannabimimetic activity of a class of compounds structurally distinct from 34b-5p between vulnerable and resilient phenotypes of cocaine addiction. Addict Biol. delta 9-tetrahydrocannabinol. J Pharmacol Exp Ther. (1992) 263:1118–26. (2022) 27:e13201. doi: 10.1111/adb.13201 22. Mendizábal V, Zimmer A, Maldonado R. Involvement of kappa/dynorphin 48. Logan GD, Schachar RJ, Tannock R. Impulsivity and Inhibitory Control. Psychol system in WIN 55,212-2 self-administration in mice. Neuropsychopharmacology. Sci. (1997) 8:60–4. doi: 10.1111/j.1467-9280.1997.tb00545.x (2006) 31:1957–66. doi: 10.1038/sj.npp.1300957 49. Everitt BJ, Robbins TW. Neural systems of reinforcement for drug addiction: 23. Schneider M. Adolescence as a vulnerable period to alter rodent behavior. Cell from actions to habits to compulsion. Nat Neurosci. (2005) 8:1481–9. doi: 10.1038/ Tissue Res. (2013) 354:99–106. doi: 10.1007/s00441-013-1581-2 nn1579 24. Wiley JL, O’Connell MM, Tokarz ME, Wright MJ Jr. Pharmacological effects of 50. Hu W, Zhao X, Liu Y, Ren Y, Wei Z, Tang Z, et al. Reward sensitivity modulates acute and repeated administration of 19-tetrahydrocannabinol in adolescent and adult the brain reward pathway in stress resilience via the inherent neuroendocrine system. rats. J Pharmacol Exp Ther. (2007) 320:1097–105. doi: 10.1124/jpet.106.108126 Neurobiol Stress. (2022) 20:100485. doi: 10.1016/j.ynstr.2022.100485 25. Rubino T, Vigano D, Realini N, Guidali C, Braida D, Capurro V, et al. 51. De Wit H. Impulsivity as a determinant and consequence of drug use: a review Chronic 19-tetrahydrocannabinol during adolescence provokes sex-dependent of underlying processes. Addict Biol. (2009) 14:22–31. doi: 10.1111/j.1369-1600.2008. changes in the emotional profile in adult rats: behavioral and biochemical correlates. 00129.x Neuropsychopharmacology. (2008) 33:2760–71. doi: 10.1038/sj.npp.1301664 52. Ansell EB, Laws HL, Roche MJ, Sinha R. Effects of marijuana use on impulsivity 26. Scherma M, Dessì C, Muntoni AL, Lecca S, Satta V, Luchicchi A, et al. Adolescent and hostility in daily life. Drug Alcohol Depend. (2015) 148:136–42. doi: 10.1016/j. 1 9-Tetrahydrocannabinol exposure Alters WIN55,212-2 self-administration in adult drugalcdep.2014.12.029 rats. Neuropsychopharmacology (2016) 41:1416–26. doi: 10.1038/npp.2015.295 53. Gruber SA, Silveri MM, Dahlgren MK, Yurgelun-Todd D. Why so impulsive? 27. Flores A, Maldonado R, Berrendero F. THC exposure during adolescence white matter alterations are associated with impulsivity in chronic marijuana smokers. does not modify nicotine reinforcing effects and relapse in adult male mice. Exp Clin Psychopharmacol. (2011) 19:231–42. doi: 10.1037/a0023034 Psychopharmacology. (2020) 237:801–9. doi: 10.1007/s00213-019-05416-8 54. Wagner MF, de Oliveria CR, Paloski LH. Levels of impulsivity in individuals with 28. Vallée M, Vitiello S, Bellocchio L, Hébert-Chatelain E, Monlezun S, Martín- cannabis use disorder. Tends Psychiatry Psychother. (2022) 44(Suppl. 1):e20210449. García E, et al. Pregnenolone can protect the brain from cannabis intoxication. Science. doi: 10.47626/2237-6089-2021-0449 (2014) 343:94–8. doi: 10.1126/science.1243985 55. Dalley JW, Fryer TD, Brichard L, Robinson ESJ, Theobald DEH, Lääne 29. Deroche-Gamonet V, Belin D, Piazza PV. Evidence for addiction-like behavior K, et al. Nucleus accumbens D2/3 receptors predict trait impulsivity and in the rat. Science. (2004) 30586:1014–7. doi: 10.1126/science.1099020 cocaine reinforcement. Science. (2007) 31516:1267–70. doi: 10.1126/science. 30. Domingo-Rodriguez L, Ruiz, de Azua I, Dominguez E, Senabre E, Serra I, et al. A 1137073 specific prelimbic-nucleus accumbens pathway controls resilience versus vulnerability 56. Belin D, Everitt BJ. Cocaine seeking habits depend upon dopamine-dependent to food addiction. Nat Commun. (2020) 11:782. doi: 10.1038/s41467-020-14458-y serial connectivity linking the ventral with the dorsal striatum. Neuron. (2008) 3:432– 31. Cooper J, Heron T, Heward W. Applied Behavior Analysis. New York, NY: 41. doi: 10.1016/j.neuron.2007.12.019 Macmillan (1987). 57. Moore CF, Sabino V, Koob GF, Cottone P. Pathological overeating: emerging 32. Lerman DC, Iwata BA. Prevalence of the extinction burst and its attenuation evidence for a compulsivity construct. Neuropsychopharmacology. (2017) 42:1375–89. during treatment. J Appl Behav Anal. (1995) 28:93–4. doi: 10.1901/jaba.1995.28-93 doi: 10.1038/npp.2016.269 Frontiers in Psychiatry 18 frontiersin.org Cajiao-Manrique et al. 10.3389/fpsyt.2023.1148993 58. Rubino T, Zamberletti E, Parolaro D. Adolescent exposure to cannabis as a risk to a specific bio-behavioural profile in adult male rats. Br J Pharmacol. (2021) factor for psychiatric disorders. J Psychopharmacol. (2012) 26:177–88. doi: 10.1177/ 178:1722–36. doi: 10.1111/bph.15394 0269881111405362 73. Mizrahi R, Watts JJ, Tseng KY. Mechanisms contributing to cognitive deficits 59. Yamaguchi K, Kandel DB. Patterns of drug use from adolescence to young in cannabis users. Neuropharmacology. (2017) 124:84–8. doi: 10.1016/j.neuropharm. adulthood: III. predictors of progression. Am J Public Health. (1984) 74:673–81. doi: 2017.04.018 10.2105/ajph.74.7.673 74. Volkow ND, Wang G-J, Telang F, Fowler JS, Alexoff D, Logan J, et al. 60. Fergusson DM, Horwood LJ. Does cannabis use encourage other forms of illicit Decreased dopamine brain reactivity in marijuana abusers is associated with negative drug use? Addiction. (2000) 95:505–20. doi: 10.1046/j.1360-0443.2000.9545053.x emotionality and addiction severity. Proc Natl Acad Sci USA. (2014) 111:E3149–56. doi: 10.1073/pnas.1411228111 61. Ellgren M, Spano SM, Hurd YL. Adolescent cannabis exposure alters opiate intake and opioid limbic neuronal populations in adult rats. 75. Bloomfield MA, Ashok AH, Volkow ND, Howes OD. The effects of 19- Neuropsychopharmacology. (2007) 32:607–15. doi: 10.1038/sj.npp.1301127 tetrahydrocannabinol on the dopamine system. Nature. (2016) 53929:369–77. doi: 10.1038/nature20153 62. Zehra A, Burns J, Liu CK, Manza P, Wiers CE, Volkow ND, et al. Cannabis addiction and the brain: a review. J Neuroimmune Pharmacol. (2018) 13:438–52. 76. Volkow ND, Wise RA, Baler R. The dopamine motive system: implications for doi: 10.1007/s11481-018-9782-9 drug and food addiction. Nat Rev Neurosci. (2017) 18:741–52. doi: 10.1038/nrn.2017. 130 63. Morral AR, McCaffrey DF, Paddock SM. Reassessing the marijuana gateway effect. Addiction. (2002) 97:1493–504. doi: 10.1046/j.1360-0443.2002.00280.x 77. Nader MA, Morgan D, Gage HD, Nader SH, Calhoun TL, Buchheimer N, et al. PET imgaging of dopamine D2 receptors during chronic cocaine self-administration 64. Hall WD, Lynskey M. Is cannabis a gateway drug? testing hypotheses about the in monkeys. Nat Neurosci. (2006) 9:1050–6. doi: 10.1038/nn1737 relationship between cannabis use and the use of other illicit drugs. Drug Alcohol Rev. (2005) 24:39–48. doi: 10.1080/09595230500126698 78. Wydra K, Gawliński D, Gawlińska K, Frankowska M, Borroto-Escuela DO, Fuxe K, et al. Adenosine A2AReceptors in substance use disorders: a focus on cocaine. Cells. 65. Tarter RE, Kirisci L, Mezzich A, Ridenour T, Fishbein D, Horner M, et al. Does (2020) 9:1372. doi: 10.3390/cells9061372 the "gateway" sequence increase prediction of cannabis use disorder development beyond deviant socialization? Implications for prevention practice and policy. Drug 79. Soria G, Castañé A, Berrendero F, Ledent C, Parmentier M, Maldonado R, et al. Alcohol Depend. (2012) 123(Suppl. 1):S72–8. doi: 10.1016/j.drugalcdep.2012.01.015 Adenosine A2A receptors are involved in physical dependence and place conditioning 66. Peltier RL, Guerin GF, Dorairaj N, Goeders NE. Effects of saline substitution on induced by THC. Eur J Neurosci. (2004) 20:2203–13. doi: 10.1111/j.1460-9568.2004. responding and plasma corticosterone in rats trained to self-administer different doses 03682.x of cocaine. J Pharmacol Exp Ther. (2001) 299:114–20. 80. Kavanagh KA, Schreiner DC, Levis SC, O’Neill CE, Bachtell RK. Role of 67. Shalev U, Grimm JW, Shaham Y. Neurobiology of relapse to heroin and cocaine adenosine receptor subtypes in methamphetamine reward and reinforcement. seeking: a review. Pharmacol Rev. (2002) 54:1–42. doi: 10.1124/pr.54.1.1 Neuropharmacology. (2015) 89:265–73. doi: 10.1016/j.neuropharm.2014. 09.030 68. Soria G, Barbano MF, Maldonado R, Valverde O. A reliable method to study cue-, priming-, and stress-induced reinstatement of cocaine self-administration in mice. 81. Borroto-Escuela DO, Wydra K, Li X, Rodriguez D, Carlsson J, Jastrzȩbska J, Psychopharmacology (2008) 199:593–603. doi: 10.1007/s00213-008-1184-x et al. Disruption of A2AR-D2R heteroreceptor complexes after A2AR transmembrane 5 peptide administration enhances cocaine self-administration in rats. Mol Neurobiol. 69. Iversen L. Cannabis and the brain. Brain. (2003) 126(Pt. 6):1252–70. doi: 10. (2018) 55:7038–48. doi: 10.1007/s12035-018-0887-1 1093/brain/awg143 82. Clare K, Pan C, Kim G, Park K, Zhao J, Volkow ND, et al. Cocaine reduces the 70. O’Tuathaigh CM, Hryniewiecka M, Behan A, Tighe O, Coughlan C, Desbonnet neuronal population while upregulating dopamine D2-Receptor-Expressing neurons L, et al. Chronic adolescent exposure to 1-9-tetrahydrocannabinol in COMT mutant in brain reward regions: sex-effects. Front Pharmacol. (2021) 12:624127. doi: 10.3389/ mice: impact on psychosis-related and other phenotypes. Neuropsychopharmacology. fphar.2021.624127 (2010) 35:2262–73. doi: 10.1038/npp.2010.100 83. Li J, Wu Y, Xue T, He J, Zhang L, Liu Y, et al. Cdc42 signaling regulated 71. Renard J, Krebs M-O, Jay TM, Le Pen G. Long-term cognitive impairments by dopamine D2 receptor correlatively links specific brain regions of hippocampus induced by chronic cannabinoid exposure during adolescence in rats: a strain to cocaine addiction. Biochim Biophys Acta Mol Basis Dis. (2023) 1869:166569. doi: comparisons. Psychopharmacology. (2013) 225:781–90. doi: 10.1007/s00213-012- 10.1016/j.bbadis.2022.166569 2865-z 84. Oliveros A, Cho CH, Cui A, Choi S, Lindberg D, Hinton D, et al. Adenosine 72. Poulia N, Delis F, Brakatselos C, Polissidis A, Koutmani Y, Kokras N, et al. A2A receptor and ERK-driven impulsivity potentiates hippocampal neuroblast Detrimental effects of adolescent escalating low-dose 19 -tetrahydrocannabinol leads proliferation. Transl Psychiatry. (2017) 7:e1095. doi: 10.1038/tp.2017.64 Frontiers in Psychiatry 19 frontiersin.org