METHODS Improved mini-Tn7 Delivery Plasmids for Fluorescent Labeling of Stenotrophomonas maltophilia Uwe Mamat,a Manuel Hein,a Dörte Grella,a Claire S. Taylor,a Thomas Scholzen,b Ifey Alio,c Wolfgang R. Streit,c Pol Huedo,d,e Xavier Coves,d,e Oscar Conchillo-Solé,d,e Andromeda-Celeste Gómez,d,e Isidre Gibert,d,e Daniel Yero,d,e Ulrich E. Schaiblea a Cellular Microbiology, Priority Research Area Infections, Research Center Borstel, Leibniz Lung Center, Borstel, Germany b Core Facility Fluorescence Cytometry, Research Center Borstel, Leibniz Lung Center, Borstel, Germany c Department of Microbiology and Biotechnology, Universität Hamburg, Hamburg, Germany d Institut de Biotecnologia i de Biomedicina (IBB), Universitat Autònoma de Barcelona (UAB), Barcelona, Spain e Departament de Genètica i de Microbiologia, Universitat Autònoma de Barcelona (UAB), Barcelona, Spain ABSTRACT Fluorescently labeled bacterial cells have become indispensable for many aspects of microbiological research, including studies on biofilm formation as an important virulence factor of various opportunistic bacteria of environmental origin such as Stenotrophomonas maltophilia. Using a Tn7-based genomic integration system, we report the construction of improved mini-Tn7 delivery plasmids for labeling of S. maltophilia with sfGFP, mCherry, tdTomato and mKate2 by expressing their codon-optimized genes from a strong, constitutive promoter and an optimized ribosomal binding site. Transposition of the mini-Tn7 transposons into single neutral sites located on average 25 nucleotides downstream of the 39-end of the conserved glmS gene of different S. maltophilia wild- type strains did not have any adverse effects on the fitness of their fluorescently labeled derivatives. This was demonstrated by comparative analyses of growth, resistance profiles against 18 antibiotics of different classes, the ability to form biofilms on abiotic and biotic surfaces, also independent of the fluorescent protein expressed, and virulence in Galleria mellonella. It is also shown that the mini-Tn7 elements remained stably integrated in the genome of S. maltophilia over a prolonged period of time in the absence of antibiotic selection pressure. Overall, we provide evidence that the new improved mini-Tn7 delivery plasmids are valuable tools for generating fluorescently labeled S. maltophilia strains that are indistinguishable in their properties from their parental wild-type strains. IMPORTANCE The bacterium S. maltophilia is an important opportunistic nosocomial pathogen that can cause bacteremia and pneumonia in immunocompromised patients with a high rate of mortality. It is now considered as a clinically relevant and notorious pathogen in cystic fibrosis patients but has also been isolated from lung specimen of healthy donors. The high intrinsic resistance to a wide range of antibiotics complicates treatment and most likely contributes to the increasing incidence of S. maltophilia infec- tions worldwide. One important virulence-related trait of S. maltophilia is the ability to form biofilms on any surface, which may result in the development of increased transient phenotypic resistance to antimicrobials. The significance of our work is to provide a Editor Jeremy D. Semrau, University of mini-Tn7-based labeling system for S. maltophilia to study the mechanisms of biofilm for- Michigan-Ann Arbor mation or host-pathogen interactions with live bacteria under non-destructive conditions. Copyright © 2023 Mamat et al. This is an open-access article distributed under the terms KEYWORDS Stenotrophomonas maltophilia, fluorescent labeling, transposon, mini-Tn7, of the Creative Commons Attribution 4.0 International license. biofilm Address correspondence to Uwe Mamat, umamat@fz-borstel.de. S The authors declare no conflict of interest. tenotrophomonas maltophilia, a non-fermentative Gram-negative bacterium of the Received 23 February 2023 g -subclass of Proteobacteria, is found ubiquitously in nature, particularly in rhizo- Accepted 21 April 2023 spheric or endophytic communities, where it is implicated in different biogeochemical Published 17 May 2023 processes and interactions with plants (1–4). In recent years, however, the bacterium June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 1 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology has increasingly been recognized as an emerging opportunistic nosocomial pathogen associated with a wide range of serious infections in immunocompromised patients, such as bacteremia and pneumonia with a high rate of mortality (5, 6). Although S. malto- philia has frequently been co-isolated as a predominant organism from polymicrobial infections of the cystic fibrosis (CF) lung (7), it is still under discussion whether S. malto- philia is simply a co-colonizer, an independent risk factor or, as a true co-pathogen, signif- icantly contributes to progressive impairment of pulmonary functions in CF patients (8– 10). It is well known that there is considerable genotypic and phenotypic variability among S. maltophilia isolates, which is consistent with the tremendous versatility of the bacterium to adapt to many environmental niches, including the heterogenous environ- ment of the CF lung (11–16). The bacterium is one of the leading multidrug-resistant microorganism in the clinical setting, which makes treatment a difficult task and most likely promotes the increasing incidence of S. maltophilia infections worldwide (17, 18). It has therefore been included in the global priority list of the top 10 resistant microorgan- isms (TOTEM) isolated in intensive care units (19). The antimicrobial resistance (AMR) of S. maltophilia to structurally unrelated antibiotics, either encoded by the intrinsic resis- tome or acquired by horizontal gene transfer (20, 21), has been shown to result from effi- cient barrier functions of the outer membrane (22), the expression of multidrug efflux pumps (23), and the activity of a wide array of enzymes effective against antimicrobials (18). In addition, a multitude of potential virulence and virulence-associated factors, fre- quently expressed in a coordinated way as a function of cell density (24), have been sug- gested to enable the bacterium to induce inflammation, destroy infected host tissue, de- grade several human serum proteins, or adhere to and colonize biotic and abiotic surfaces such as implanted medical devices (25–28). The ability of S. maltophilia to read- ily form biofilms on virtually any surface is a key feature of this bacterium and allows for the development of transient phenotypic resistance to antimicrobials and persistence within the host over an extended period of time (2, 18). The availability of a large number of genome sequences and various molecular tools for genetic manipulation of S. maltophilia has not only facilitated the decoding of phylogenetic relationships between S. maltophilia isolates, but has also improved the identification and characterization of resistance determinants and virulence factors of the bacterium (2, 13, 15, 29–32). On the other hand, however, the cellular and molecular mechanisms underlying the pathogenesis of S. maltophilia infections are far from having been thoroughly investi- gated. These and other studies, e.g., on biofilm formation as an important factor in the pathogenesis of various opportunistic bacteria, often require the labeling of bacterial cells with bright and stable fluorescent proteins, which should preferentially be expressed by easily transferable genetic elements (33, 34). Plasmids carrying genes for fluorescent pro- teins undoubtedly meet the criteria of being easily transferable and giving the host bacteria increased fluorescence intensity as a consequence of the gene dosage effect. However, they can be lost in the absence of continuous selection pressure. Furthermore, the use of antibiotics to select for plasmids is rather inappropriate for studies on biofilm formation or testing of novel antibiotics. Among other mechanisms of high-level AMR development in biofilms, the self-produced extracellular polymeric substance matrix may efficiently act as a permeability barrier and thus strongly affect the penetration and efficacy of antibiotics against encased bacterial target cells (35–37). To ultimately prevent loss of fluorescence, the use of chromosomal integration systems has many advantages over plasmid-encoded fluorescent labeling of bacterial cells (34). However, for visualization of S. maltophilia cells in monospecies and mixed biofilms on abiotic and biotic surfaces, so far mainly fluorescent dyes have been used, including Syto 62 and Syto 9 fluorescent nucleic acid stains (38–40), propidium iodide (14, 41, 42), or fluorescein isothiocyanate (FITC) (43). Here, we report the construction of improved mini-Tn7 delivery plasmids to enable stable labeling of S. maltophilia with various fluorescent proteins through the expres- sion of codon-optimized genes from a strong, constitutive promoter and an optimized ribosomal binding site. It is shown that the chromosomally integrated genes did June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 2 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology neither affect bacterial growth, the antibiotic resistance pattern, biofilm formation, nor virulence of the fluorescently tagged S. maltophilia strains. RESULTS AND DISCUSSION The 39-end of the glmS gene in S. maltophilia. Mini-Tn7 transposons have become valuable tools for inserting heterologous genes into bacterial genomes in a site- and orien- tation-specific manner (44–49). In the presence of the Tn7-encoded TnsABCD(E) transpo- sase complex, the right (Tn7R) and left (Tn7L) ends of the transposon are sufficient for transposition of mini-Tn7 elements at a high frequency into a single Tn7 insertion site that is located about 25 nucleotides downstream of the conserved glmS gene for the essential glutamine-fructose-6-phosphate aminotransferase involved in cell wall metabolism of many bacteria (44, 50, 51). The transposase complex additionally requires an attTn7-associ- ated sequence motif at the immediate 39-end of glmS to direct transposition into the sin- gle insertion site (50). With very few exceptions that contain multiple glmS genes and attTn7 sites, such as members of the genus Burkholderia (52), most bacterial species carry only a single glmS gene and thus only one attTn7 site, which allows the insertion of a sin- gle-copy gene at a unique neutral intergenic site of the bacterial genome. To the best of our knowledge, there is a very limited number of previous studies using S. maltophilia strains that have been fluorescently labeled with a mini-Tn7 delivery system (53–55). In fact, the plasmid pURR25 carrying the mini-Tn7KSGFP transposon and engi- neered for use in other g -Proteobacteria, such as Photorhabdus luminescens, Pseudomonas aeruginosa or Serratia spp. (56), was applied in all these studies for labeling of S. maltophilia with GFP, but without providing further details or background information. To address the question of whether S. maltophilia is indeed a suitable host for the de- velopment of a site-specific chromosome integration system based on Tn7, we searched the NCBI genome database and found only one glmS gene in most S. maltophilia strains, which suggests a single attTn7 site in this bacterium. A total of 75 S. maltophilia strains, belonging to 15 out of 23 different monophyletic lineages (13), was then randomly selected to compare the 39-ends and 40 nucleotides of the intergenic regions down- stream of the glmS gene (Fig. S1). Noteworthy, the sequence variations downstream of the glmS gene allowed classification of the intergenic regions into groups that were largely consistent with the monophyletic lineages of the strains, suggesting, like in many other bacteria (57, 58), a naturally evolved region as an insertion site of mini-Tn7 trans- posons in S. maltophilia. This assumption was additionally supported by the fact that the attTn7-associated sequence motif at the immediate 39-end of glmS was as highly con- served in S. maltophilia as in other Gram-negative bacteria. Taken together, the data described above strongly suggested that S. maltophilia contains the genetic background required for single-copy insertion of Tn7-based genetic elements. Construction of mini-Tn7 delivery plasmids for S. maltophilia. It has long been known that transposable genetic elements based on Tn7 have an extraordinarily broad host range, with at least 20 different bacterial species in which Tn7 is able to transpose (44). The original classification of S. maltophilia as a member of the genus Pseudomonas (59), followed by assignment of the bacterium to the genus Xanthomonas (60) and reclassification as Stenotrophomonas (61) has prompted us to first test the utility of pUC18T-mini-Tn7T-Gm-ecfp, pUC18T-mini-Tn7T-Gm-eyfp and pUC18T-mini-Tn7T-Gm- dsRedExpress for fluorescent labeling of S. maltophilia. The latter mobilizable mini-Tn7 delivery vectors, which have been successfully developed to fluorescently label P. aerugi- nosa (45), were transferred from E. coli DH5a donor strains to different S. maltophilia recipients by four-parental mating experiments, using E. coli DH5a with pRK2013 for mo- bilization of mini-Tn7 plasmids and E. coli SM10 (l pir) carrying the plasmid pUX-BF13 for TnsABCDE transposase expression as helper strains. However, although colony PCRs using the primer pairs PTn7L/PSmltglmS-up and PSmltglmS-down/PTn7R indicated that insertion of the mini-Tn7 elements occured at attTn7 in S. maltophilia, the signals from all fluores- cent proteins proved to be quite weak (data not shown). We therefore decided to develop improved mini-Tn7 delivery plasmids derived from the base vectors pUC18R6K-mini-Tn7T-Gm and pUC18T-mini-Tn7T (44, 45). Using June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 3 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology a multiple-step cloning strategy, the fluorescence intensity of S. maltophilia cells as examined by confocal laser-scanning microscopy (CLSM) was successively increased in the course of plasmid construction. As described in detail in Materials and Methods and depicted in Fig. S2, amplification of the fluorescence signal was mainly achieved by optimization of three functional mini-Tn7 elements, i.e., i) adaptation of codon usage of the genes for the fluorescent proteins sfGFP, mCherry, tdTomato and mKate2 to their expression in bacteria of the family Xanthomonadaceae, ii) change to the strong, constitutive promoter Pc from class III integron of Delftia acidovorans C17 (62, 63) to drive expression of the fluorescent proteins, and iii) replacement of the putative ribosomal site sequence GCGAGC of the rpoD gene of S. maltophilia K279a with the six-base consensus sequence AGGAGG seven bases upstream of the AUG start codons. Interestingly, the Pc promoter was also recently used to achieve high expression levels of fluorescent proteins on mini-Tn7 elements in P. fluorescens (64) and could therefore serve as an alternative to other constitutive promoters used for protein expression in different Gram-negative bacteria. If required, genes for other fluorescent proteins can be placed under the control of the Pc promoter by replacement of the existing genes using BamHI/Sacl cloning (see Fig. S2). Gentamycin is one of the few antibiotics to which multidrug-resistant S. maltophilia strains are sensitive to varying degree. Therefore, we did not replace the original aacC1 gene for aminoglycoside-(3)-N-acetyltransferase in the improved mini-Tn7 elements, but usually checked the intrinsic resistance to gentamicin of the strains to be labeled before each experiment. For selection, we routinely used a concentration of 60 m g/mL gentamicin, but this could be adjusted if intrinsic resistance to this antibiotic was ele- vated in certain strains. As part of the initial mini-Tn7T-Gm transposon encoded by pUC18R6K-mini-Tn7T-Gm (Fig. S2), the aacC1 gene was flanked by FLP recombinase target (FRT) sites and could therefore offer the opportunity of being removed from the genome by Flp-mediated excision to yield strains with unmarked mini-Tn7 insertions (44). For expression of the yeast FLP recombinase, the helper plasmid pFLP2 has been widely used (45, 65). However, due to the highly intrinsic resistance of S. maltophilia to ß-lactams, the plasmid was unsuitable for removal of the FRT cassette from these bac- teria. Following the approach to construct an alternative for pFLP2 in phytopathogenic Xanthomonas spp. (47), we cloned a 5.1-kb Pstl fragment containing the cI857-FLP-sacB fragment from pFLP2 into the Pstl site of pBBR1MCS-1, a cloning vector with moderate copy number coding for chloramphenicol resistance (66). However, various attempts to excise the aacC1 gene in the presence of the pBBR1MCS-1-FLP2 helper plasmid failed (data not shown) and were therefore not pursued further. Chromosomal insertion of mini-Tn7 elements and fluorescent labeling of S. maltophilia. The improved mini-Tn7 delivery plasmids could be transferred with high efficiency into various S. maltophilia isolates by conjugative transfer. For fluorescent labeling, we aimed not only to use a selection of strains from different monophyletic lin- eages but also to place focus on clinical isolates from different sources such as blood, lung puncture, vascular ulcer, perineum, oropharynx, hematologic neoplasia, or cystic fi- brosis patients. As shown in Fig. 1 and Fig. S3, the four-parental mating experiments yielded fluorescently labeled strains with a high signal-to-noise ratio at single-cell resolu- tion. While the site- and orientation-specific insertion of the mini-Tn7 elements down- stream of glmS were routinely verified by PCR with primer pairs PTn7L/PSmltglmS-up and PSmltglmS-down/PTn7R, the actual mini-Tn7 insertion sites in S. maltophilia strains K279a, PC313, H5726, PC240, UV74, OC194 and LMG11112 were determined by sequencing of the flanking mini-Tn7 regions using DNA fragments amplified from fluorescently labeled derivatives of the strains. Because the Tn7 transposition event generates characteristic 5- bp duplications of the insertion site (67), the host target sequence of the mini-Tn7 ele- ments could be readily identified in the different S. maltophilia strains (Fig. 2, Fig. S1 and S4B). According to the nomenclature of Craig and colleagues (58, 68), in which the base pair located in the middle of the 5-bp sequence is referred to as nucleotide position 0, with sequences toward glmS possessing a positive numbering, the average distance between the mini-Tn7 insertion site and the 39-end of the glmS gene was 25 nucleotides June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 4 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology FIG 1 Microscopic analysis of S. maltophilia strains carrying chromosomally integrated mini-Tn7 elements for expression of different fluorescent proteins. Confocal (left panel), transmitted light (middle panel) and merged (right panel) images of S. maltophilia strains K279a::sfGFP, K279a:: tdTomato, K279a::mCherry, UV74::sfGFP and UV74::tdTomato show that the entire population of each strain is fluorescently labeled. Scale bars correspond to 10 m m. in S. maltophilia (Fig. 2 and Fig. S1), consistent with the distance determined in other bacteria, such as Xanthomonas spp. (47), P. aeruginosa (44, 45), E. coli (68), Acinetobacter baumannii (48), P. putida, Yersinia pestis, or Burkholderia thailandensis (44). Given the degree of sequence conservation of the intergenic regions downstream of the glmS gene within individual monophyletic lineages, it is reasonable to assume that S. malto- philia strains of the same monophyletic lineage have identical target sequences that serve as insertion sites for mini-Tn7 transposons (Fig. S1). Stability of mini-Tn7 insertions. To answer the question of whether integration of the mini-Tn7 transposons into the chromosome of S. maltophilia affects strain fitness, June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 5 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology FIG 2 Insertion sites of mini-Tn7 elements in various S. maltophilia strains. Alignment of the highly conserved attTn7-associated sequence motif at the immediate 39-end of glmS and downstream sequences of the intergenic region. The mini-Tn7 insertion sites with an average distance of 25 nucleotides from the 39-end of the glmS gene are indicated with a red bar. The center of the 5-bp target site is designated nucleotide position 0, while sequences in the direction of the glmS gene have positive numbering and nucleotides in the other direction, away from glmS, have negative numbering (58, 68). The alignment was created with Geneious Prime 2023.0.4 (www.geneious.com). we used fluorescent derivatives of strains K279a and UV74 throughout this study. The blood isolate K279a is considered the clinical reference strain for which the first whole- genome sequence of an S. maltophilia bacterium was available (69), whereas strain UV74 isolated from a vascular ulcer was found to be genetically very similar to strain D457 (70), a bronchial-aspiration isolate that is used as a model strain for studying the expression and regulation of resistance determinants in S. maltophilia (71). As a first step, we aimed to investigate the chromosomal stability of improved mini- Tn7 elements in strains K279a::sfGFP, K279a::tdTomato, UV74::sfGFP and UV74:: tdTomato. Since the aacC1 gene was genetically linked to the corresponding gene for a fluorescent protein on the inserted mini-Tn7 transposon, we considered a stable in- heritance of the gentamicin resistance marker as a measure of the stability of the entire mini-Tn7 element, including a stable replication of the gene for the fluorescence pro- tein in the absence of continued antibiotic selection. We therefore grew all strains in media without gentamicin for five consecutive days, followed by the testing of 100 individual clones of each strain for their ability to grow in media containing the antibi- otic. As expected from chromosomally inserted markers, 100% of the clones retained their mini-Tn7-encoded gentamicin resistance in the absence of sustained selection June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 6 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology FIG 3 Comparative growth analysis of S. maltophilia wild-type strains and their fluorescently labeled derivatives. The growth of strains K279a, K279a::sfGFP and K279a::tdTomato (A) and UV74, UV74::sfGFP and UV74::tdTomato (B) was recorded by measuring the optical density of the cultures at 600 nm (OD600) at 37°C over a period of 24 h. The data are represented as means 6 SD of three replicates per strain. pressure. This result was confirmed by the detection of mini-Tn7 elements in the cor- rect orientation as 502-bp PCR products in 10 randomly selected clones of each strain (Fig. S4). Taken together, these data indicated that the mini-Tn7 transposons are stable in S. maltophilia over a longer time period without the need for continuous selection pressure. Growth properties of fluorescently labeled S. maltophilia strains. Acquisition of antibiotic resistance determinants, e.g., through mobile genetic elements, may be associated with fitness deficits due to an overall metabolic burden and, as a result, may lead to lower bacterial growth rates (72–74). While integration of unmarked mini-Tn7 transposons at a unique neutral intergenic site downstream of the glmS gene does not appear to have adverse effects on bacterial fitness (44), we wondered whether the ac- quisition of the aacC1 gene together with the mini-Tn7 element and the development of resistance to gentamicin might affect the fitness of fluorescent S. maltophilia strains. As shown herein for S. maltophilia strains K279a::sfGFP, K279a::tdTomato, UV74::sfGFP and UV74::tdTomato, there were no growth differences between the parental strains and their fluorescent derivatives (Fig. 3). The mean generation times (mean 6 SD) of K279a, K279a::sfGFP, K279a::tdTomato, UV74, UV74::sfGFP and UV74::tdTomato were similar and amounted to 106.90 6 0.44 min, 111.90 6 0.10 min, 111.75 6 1.19 min, 91.22 6 0.97 min, 93.49 6 9.14 min and 100.37 6 12.96 min, respectively. To address the question of whether integrated mini-Tn7 elements have an impact on the antibiograms of fluorescently labeled S. maltophilia in comparison to their pa- rental strains, we examined the resistance profiles of K279a, K279a::sfGFP, K279a:: tdTomato, UV74, UV74::sfGFP and UV74::tdTomato with 18 antibiotics of different classes. As shown in Table 1, the MIC values of almost all tested antibiotics against the parental strains and their fluorescently labeled derivatives were identical. Only the MIC of the combination of the antibiotic ticarcillin with the ß-lactamase inhibitor clavulanic acid against the tdTomato-labeled derivative of strain K279a was reduced by half and, conversely, the MIC values of ticarcillin-clavulanic acid combination and another com- binatorial antibiotic, piperacillin-tazobactam, were doubled in UV74::tdTomato com- pared to UV74 and UV74::sfGFP. It must be emphasized, however, that a 2-fold dilution difference is within the intrinsic error of the broth microdilution method and is not usually considered significant in susceptibility tests (75). Overall, the results allowed us to draw the conclusion that integration of the improved mini-Tn7 transposons does neither alter the growth characteristics nor the resistance patterns of the fluorescently labeled S. maltophilia strains. Biofilm formation of fluorescently labeled S. maltophilia strains. The ability to form biofilms as an important virulence factor is a characteristic feature of S. malto- philia (15, 41, 76–78). Because biofilm growth is another measure of bacterial fitness, changes in the capacity to form biofilms can have far-reaching consequences, such as June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 7 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology TABLE 1 Antibiotic resistance profiles of S. maltophilia wild-type strains K279a and UV74 in comparison to their fluorescently labeled derivatives MIC (mg/mL) Antibiotic K279a K279a::sfGFP K279a::tdTomato UV74 UV74::sfGFP UV74::tdTomato Sulfonamides Trimethoprim-sulfamethoxazole 0.25 0.25 0.25 0.25 0.25 0.25 Polypeptides Colistin 2 2 2 32 32 32 Carbapenems (ß-lactam) Imipenem 64 64 64 256 256 256 Meropenem 8 8 8 2 2 2 Cephalosporins (ß-lactam) Ceftazidime 4 4 4 2 2 2 Penicillins (ß-lactam) Piperacillin-tazobactam 16 16 16 64 64 128 Ticarcillin-clavulanic acid 2 2 1 16 16 32 Aminoglycosides Tobramycin 32 32 32 8 8 8 Amikacin 16 16 16 16 16 16 Streptomycin 64 64 64 64 64 64 Chloramphenicol Chloramphenicol 16 16 16 16 16 16 Tetracyclines Tetracycline 16 16 16 8 8 8 Minocycline 0.5 0.5 0.5 0.25 0.25 0.25 Tigecycline 2 2 2 2 2 2 Fluoroquinolones Ciprofloxacin 8 8 8 16 16 16 Levofloxacin 4 4 4 1 1 1 Ofloxacin 4 4 4 2 2 2 Norfloxacin 32 32 32 128 128 128 altering the pathogenic and resistance potential of bacteria (74). To determine whether fluorescently labeled S. maltophilia strains are unchanged in their ability to produce biofilm, we first used crystal violet (CV) staining to quantify the amount of biofilm rela- tive to bacterial growth to deduce the values of relative biofilm formation for strains K279a, K279a::sfGFP, K279a::tdTomato, UV74, UV74::sfGFP and UV74::tdTomato (Fig. 4). Based on the mean ratio (OD550 of CV/OD620 of cell growth), we were able to confirm that strains with a diffusible signal factor-based quorum sensing system of the rpf-2 type (UV74) are stronger biofilm formers than strains of the rpf-1 type (K279a) (78). Our results further showed only marginal, statistically non-significant differences in biofilm formation between the parent strains and their fluorescently labeled derivatives under the experimental conditions used, suggesting once again that the chromosomally inte- grated mini-Tn7 elements did not negatively affect the fitness of the bacterial cells. Imaging techniques are increasingly being used in biofilm research, with bacteria expressing fluorescent proteins finding wide application, for example, in studies of spa- tial biofilm structure or the dynamics of biofilm maturation as a function of time (79, 80). Here we used confocal laser-scanning microscopy (CLSM) to visualize the three- dimensional architecture of biofilms formed by fluorescently labeled S. maltophilia strains. For this purpose, the biofilms were grown on a polymer surface under static conditions for either 48 h (bacteria with tdTomato labeling) or 72 h (bacteria with sfGFP or mKate2 labeling), followed by reconstruction of representative biofilm images June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 8 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology FIG 4 Biofilm formation of S. maltophilia wild-type strains K279a and UV74 in comparison to their sfGFP- and tdTomato-labeled derivatives. The amount of each biofilm as quantified by crystal violet staining (OD550 value) was normalized by the optical density of the cell suspension at 620 nm (OD620) and shown as relative biofilm formation. Values are presented as means 6 SD of six technical replicates for each of four biological replicates per strain. Statistical significance was determined by the non-parametric Kruskal-Wallis one-way Analysis of Variance (ANOVA) test corrected for multiple comparisons using Dunn’s test (ns: not significant). from CLSM Z-axis serial sections (Fig. 5 and Fig. S5). As expected, the CLSM images showed biofilm-forming ability of all strains on a solid polymeric surface and strain-de- pendent variations in biofilm architecture, characterized by loosely to densely packed populations of bacterial cells. All strains tested appeared to maintain the biofilm mass formed after 48 h throughout the 72-h experimental period, with strain S. maltophilia LMG11112, a clinical isolate from a lung puncture, proving to be the most potent bio- film producer in this study after 48 and 72 h of growth (Fig. 5). However, we attached even more importance to the observation that the various fluorescent proteins encoded on the corresponding mini-Tn7 transposons have no effect on biofilm architecture. This was particularly evident in the Sm454::sfGFP and Sm454::mKate2 strains, which had formed biofilms of microcolonies of varying sizes after 72 h of incubation (Fig. 5 and Fig. S6). Interestingly, and as the example of strain Sm454::sfGFP showed (Fig. S7), the micro- colonies possessed a characteristic ultrastructure consisting of densely packed cell layers adhering to the polymer surface and layers with loosely packed cell aggregates. The lat- ter were reminiscent of rosettes, which appeared to be formed by adhesion between cells at their poles. Of note, a similar rosette-like biofilm architecture of S. maltophilia Sm454 was recently observed, but visualized using a live/dead staining protocol (41). However, the mechanisms responsible for intercellular cohesion still needs to be eluci- dated, e.g., whether the aggregates are held together by a unipolar adhesion polysaccha- ride, similar to that described for rosette formation of cells in biofilms of other bacteria, such as Rhodopseudomonas palustris (81) or Agrobacterium tumefaciens (82). Taken to- gether, the results indicated that the presence of the mini-Tn7 elements does not affect the biofilm formation of the fluorescently labeled strains compared with their parental strains, nor does it lead to differences between biofilms of differently labeled cells of the same strain. The differently labeled S. maltophilia strains would thus be interchangeable if necessary. Using CLSM, we were also able to monitor the succession of biofilm formation of S. maltophilia Sm314::sfGFP on confluent Calu-3 cell monolayers over a 48-h period (Fig. 6). The gradual damage of Calu-3 cells by the growing biofilm, starting with the formation of aggregates of bacterial cells on the Calu-3 cells after a period of 16 h, June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 9 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology FIG 5 Biofilm formation of fluorescently labeled S. maltophilia strains as analyzed by confocal laser- scanning microscopy (CLSM). Representative CLSM images show the comparison of biofilm architecture of strains expressing two different fluorescent proteins. Biofilms composed of sfGFP- and mKate2-labeled bacterial cells were grown on a polymer surface for 72 h, whereas biofilms consisting of tdTomato- labeled cells were grown for 48 h under static conditions. The three-dimensional images were generated with daime (93). followed by the onset of biofilm formation on the polymer surface after 24 h, and finally ending with the complete destruction of the Calu-3 monolayer after 48 h, con- firmed the role of biofilm as one of the major virulence determinants in pathogen-host interaction between S. maltophilia and pulmonary epithelial cells. Collectively, our results provided evidence that the fluorescently labeled S. maltophilia strains are equally capable of forming biofilms on abiotic and biotic surfaces, suggesting that they could serve as valuable tools in biofilm research or investigations into the host- pathogen interactions. Virulence of fluorescently labeled S. maltophilia strains. Comparative virulence tests using the larvae of the greater wax moth Galleria mellonella were performed with the strains K279a and UV74 and their sfGFP- and tdTomato-labeled derivatives. As Fig. 7 June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 10 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology FIG 6 Biofilm formation of S. maltophilia Sm314::sfGFP on adherent Calu-3 cells. The representative CLSM images show the succession of biofilm formation 16 h (A), 24 h (B) and 48 h (C) after infection. The bacterial cells glow with green fluorescence, the nuclei are stained blue with DAPI, and the Alexa Fluor 647 conjugated C-11 monoclonal antibody reacts with a conserved epitope of human cytokeratins 4, 5, 6, 8, 10, 13 and 18 (red). The confocal image stacks were processed with Leica's Lightning Deconvolution Tool (Leica Application Suite X, version 3.0.0_15697) and the Imaris Viewer 10.0.0 (Oxford Instruments). Each scale bar represents 20 m m. shows, all strains were moderately virulent in the larval killing assays, with no significant difference between wild-type and fluorescently labeled strains. The inoculum used, approximately 5  105 CFU, resulted in 5–10% mortality for all strains 24 h postinfection, while 35–45% of larvae were killed after 120 h. However, this assay was only useful for demonstrating that fluorescent labeling has no effect on the virulence of the strains. As shown previously, fluorescently labeled strains are not suitable for monitoring the course of infection within the larvae due to their autofluorescence and the fact that the cuticle does not allow detection of fluorescence inside the larvae (83). MATERIALS AND METHODS Bacterial strains, plasmids and growth conditions. All strains and plasmids used in the present study are described in Table 2. Unless otherwise stated, the E. coli and S. maltophilia strains were grown aerobically with shaking (220 rpm) at 37°C in LB-Miller medium (10 g of tryptone, 5 g of yeast extract, 10 g of NaCl per L), except E. coli SM10 (l pir)/pUX-BF13 was routinely cultured at 30°C. For plasmids con- taining the R6Kg origin of replication, E. coli SY327 expressing the l PI protein served as a cloning host. All other plasmids were constructed and propagated in E. coli DH5a. Gentamycin at concentrations of 15 m g/mL, 30 m g/mL and 60 m g/mL, kanamycin (30 m g/mL), ampicillin (100 m g/mL), or norfloxacin (5 m g/mL) were added to the media as required. June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 11 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology FIG 7 Virulence of S. maltophilia wild-type strains in comparison to their fluorescently labeled derivatives in G. mellonella larvae. Survival of infected larvae (5  105 CFU of each strain per larva) was examined for strains K279a, K279a::sfGFP, and K279a::tdTomato (A) and UV74, UV74::sfGFP, and UV74::tdTomato (B) at 24-h intervals over 120 h, and survival curves were analyzed using the Kaplan- Meier method (log-rank test: not significant, P . 0.05). Cell culture. The Calu-3 human lung adenocarcinoma cell line was obtained from the American Type Culture Collection (ATCC HTB-55, Lot No. 2454196), and all cell culture reagents were purchased from PAN- Biotech (Aidenbach, Germany). The cells were grown in cell culture flasks at 37°C in a humidified atmosphere of 5% CO2, using RPMI 1640 culture medium with stable L-glutamine, 2.0 g/L NaHCO3 and 10% of heat-inacti- vated fetal bovine serum (FBS). Adherent Calu-3 cells were dissociated the day before the infection experi- ments by trypsinization with a trypsin 0.05%/EDTA 0.02% solution at 37°C for 3 min, collected and sedimented by centrifugation at 280  g for 3 min. The cell pellet was then resuspended in culture medium, followed by determination of the cell number with a hemocytometer and evaluation of cell viability with Trypan blue. Finally, the cells were transferred in a volume of 250 m L and a density of 6.25  104 cells/cm2 into each well of a m -Slide 8-Well ibiTreat slide (ibidi GmbH, Gräfelfing, Germany). Construction of mini-Tn7 delivery plasmids for fluorescent labeling of S. maltophilia. Standard recombinant DNA methods were used for nucleic acid preparation and analysis (84). The sequences of pri- mers with integrated recognition sites for restriction enzymes and control primers are listed in Table 3. Using the codon usage adaptation tool Jcat (85), codon optimization of the genes for fluorescent proteins was per- formed for protein expression in Xanthomonadaceae. The successful construction of all plasmids was verified by DNA sequence analysis performed by LGC Biosearch Technologies (Berlin, Germany). As a first step, the gene for the red-fluorescence mCherry protein was placed under the control of the rpoD promoter of S. maltophilia K279a. The rpoD promoter region was obtained by PCR from the genomic DNA of S. maltophilia K279a with primers KpnI-rpoDprom and XhoI-rpoDprom, followed by digestion of the PCR product of 232 bp with Kpnl/Xhol and cloning into the Kpnl/Xhol sites of pUC18R6K-mini-Tn7T-Gm to yield pUC18R6K-mini-Tn7T-Gm-rpoD. Then the primer pair 5XhoI-Fluores/3BamHI-Fluores and pGEM-T Easy- mCherry as a template were used to amplify a 731-bp fragment containing the mCherry gene. The PCR prod- uct was digested with Xhol/BamHl and ligated into the Xhol/BamHl sites of pUC18R6K-mini-Tn7T-Gm-rpoD, yielding plasmid pUC18R6K-mini-Tn7T-Gm-rpoD-mCherry. To allow for conjugative transfer of the mini-Tn7 delivery plasmids to S. maltophilia, the pUC18T-mini-Tn7T-Gm-rpoD-mCherry plasmid carrying the oriT trans- fer origin was constructed by ligation of the internal mini-Tn7 Kpnl/SalI fragment of pUC18R6K-mini-Tn7T- Gm-rpoD-mCherry of 2370 bp with the 3104-bp Kpnl/SalI fragment of pUC18T-mini-Tn7T. In order to improve protein expression levels in S. maltophilia, the Apal/BamHI fragment within the mini-Tn7 element of pUC18T-mini-Tn7T-Gm-rpoD-mCherry, comprising the mCherry gene and upstream sequences with the putative ribosomal binding site of rpoD, was replaced with Apal/BamHI inserts of pEX- A2-mCherry_opt and pEX-A2-sfGFP_opt to obtain the plasmids pUC18T-mini-Tn7T-Gm-rpoD-mCherry_opt and pUC18T-mini-Tn7T-Gm-rpoD-sfGFP_opt, respectively. The synthetic Apal/BamHl inserts of pEX-A2- mCherry_opt and pEX-A2-sfGFP_opt were composed of codon-optimized genes for mCherry and the “superfolder” variant of the green fluorescent protein (sfGFP) (86), each fused to an optimized ribosomal binding site of the rpoD gene of K279a, respectively. With the aim of further increasing the rate of gene expression, codon-optimized genes for various fluorescent proteins were placed under the control of the strong, constitutive promoter Pc from class III integron of Delftia acidovorans C17 (62, 63). The synthetic Pc promoter sequence was ligated as a 237-bp Kpnl/BamHl fragment from plasmid pEX-A128-Pc with the 4533-bp Kpnl/BamHl fragment of pUC18T- mini-Tn7T-Gm-rpoD-sfGFP_opt to generate the plasmid pUC18T-mini-Tn7T-Gm-Pc. Next, the mCherry- opt and sfGFP_opt genes were PCR-amplified from pUC18T-mini-Tn7T-Gm-rpoD-mCherry_opt and pUC18T-mini-Tn7T-Gm-rpoD-sfGFP_opt with primer pairs 5BamHI-Pcprom/3SacI-Pc-mChopt and 5BamHI-Pcprom/3SacI-Pc-sfGFPopt, respectively. The putative optimized ribosomal binding site of the rpoD gene of K279a was inserted into the PCR products with primer 5BamHI-Pcprom. Finally, the June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 12 TABLE 2 Bacterial strains and plasmids used in this work Strain or plasmid Genotype or description Source or reference Escherichia coli SM10 (l pir) KmR thi-1 thr leu tonA lacY supE recA::RP4-2-Tc::Mu l pir (88, 89) SY327 D(lac pro) argE(Am) recA56 rif R nalA l pir (88) DH5a F– U80lacZDM15 D(lacZYA-argF) U169 recA1 endA1 hsdR17(rK–mK1) phoA supE44 thi-1 gyrA96 relA1 l – (97) Stenotrophomonas maltophilia June 2023 Volume 89 Issue 6 K279a Clinical isolate from the blood of a cancer patient (98) LMG11112 Clinical isolate from lung puncture Belgian Co-ordinated Collections of Microorganisms (BCCM) UV74 Clinical isolate from vascular ulcer (95) PC313 Clinical isolate from perineum (95) mini-Tn7 Delivery Plasmids for Stenotrophomonas PC240 Clinical isolate from perineum (95) OC194 Clinical isolate from oropharynx (95) H5726 Clinical isolate from hematologic neoplasia (95) Sm454 Clinical isolate from a cystic fibrosis patient (15) Sm314 Clinical isolate from a cystic fibrosis patient (15) K279a::sfGFP K279a carrying the mini-Tn7T-Gm-Pc-sfGFP_opt element downstream of the glmS (SMLT_RS19505) gene This study K279a::mCherry K279a carrying the mini-Tn7T-Gm-Pc-mCherry_opt element downstream of the glmS (SMLT_RS19505) gene This study K279a::tdTomato K279a carrying the mini-Tn7T-Gm-Pc-tdTomato_opt element downstream of the glmS (SMLT_RS19505) gene This study LMG11112::sfGFP LMG11112 carrying the mini-Tn7T-Gm-Pc-sfGFP_opt element downstream of the glmS gene This study LMG11112::tdTomato LMG11112 carrying the mini-Tn7T-Gm-Pc-tdTomato_opt element downstream of the glmS gene This study UV74::sfGFP UV74 carrying the mini-Tn7T-Gm-Pc-sfGFP_opt element downstream of the glmS gene This study UV74::tdTomato UV74 carrying the mini-Tn7T-Gm-Pc-tdTomato_opt element downstream of the glmS gene This study PC313::sfGFP PC313 carrying the mini-Tn7T-Gm-Pc-sfGFP_opt element downstream of the glmS gene This study PC313::tdTomato PC313 carrying the mini-Tn7T-Gm-Pc-tdTomato_opt element downstream of the glmS gene This study PC240::sfGFP PC240 carrying the mini-Tn7T-Gm-Pc-sfGFP_opt element downstream of the glmS gene This study PC240::tdTomato PC240 carrying the mini-Tn7T-Gm-Pc-tdTomato_opt element downstream of the glmS gene This study OC194::sfGFP OC194 carrying the mini-Tn7T-Gm-Pc-sfGFP_opt element downstream of the glmS gene This study OC194::tdTomato OC194 carrying the mini-Tn7T-Gm-Pc-tdTomato_opt element downstream of the glmS gene This study H5726::sfGFP H5726 carrying the mini-Tn7T-Gm-Pc-sfGFP_opt element downstream of the glmS gene This study Sm454::sfGFP Sm454 carrying the mini-Tn7T-Gm-Pc-sfGFP_opt element downstream of the glmS gene This study Sm454::mKate2 Sm454 carrying the mini-Tn7T-Gm-Pc-mKate2_opt element downstream of the glmS gene This study Sm314::sfGFP Sm314 carrying the mini-Tn7T-Gm-Pc-sfGFP_opt element downstream of the glmS gene This study Plasmids pRK2013 KanR; RK2-derived helper plasmid carrying the tra and mob genes for mobilization of plasmids containing oriT (87) pUC18R6K-mini-Tn7T-Gm AmpR; GmR on mini-Tn7; R6Kg -based mini-Tn7 cloning and integration vector (44, 45) (Addgene plasmid # 65022; http://n2t.net/addgene:65022; RRID:Addgene_65022) pUC18T-mini-Tn7T AmpR; mobilizable mini-Tn7 cloning and integration vector (44, 45) (Addgene plasmid # 64957; http://n2t.net/addgene:64957; RRID:Addgene_64957) pUX-BF13 AmpR; R6Kg -based helper plasmid containing the Tn7 transposase genes tnsABCDE for transposition of mini-Tn7 (90) elements pGEM-T Easy-mCherry AmpR; pGEM-T Easy vector (Promega) carrying the gene for the mCherry red fluorescent protein Anke Becker, Center for Synthetic 10.1128/aem.00317-23 Microbiology (SYNMIKRO), Marburg, Germany Applied and Environmental Microbiology 13 (Continued on next page) TABLE 2 (Continued) Strain or plasmid Genotype or description Source or reference pEX-A2-mCherry_opt AmpR; pEX-A2 vector with a synthetic 779-bp ApaI/BamHI insert containing an mCherry gene with optimized Eurofins Genomics, Ebersberg, codon usage for Xanthomonadaceae and fused with an optimized ribosomal binding site of the rpoD Germany; this study (SMLT_RS19820) gene of K279a pEX-A2-sfGFP_opt AmpR; pEX-A2 vector with a synthetic 788-bp ApaI/BamHI insert containing an sfGFP gene with optimized codon Eurofins Genomics, Ebersberg, usage for Xanthomonadaceae and fused with an optimized ribosomal binding site of the rpoD (SMLT_RS19820) Germany; this study gene of K279a June 2023 Volume 89 Issue 6 pEX-A128-Pc AmpR; pEX-A128 vector with a synthetic 237-bp KpnI/BamHI insert containing the Pc promoter from class III Eurofins Genomics, Ebersberg, integron of Delftia acidovorans C17 Germany; this study pUC18R6K-mini-Tn7T-Gm- rpoD AmpR; GmR on mini-Tn7; pUC18R6K-mini-Tn7T-Gm with a 224-bp KpnI/XhoI insert containing the promoter and This study ribosomal binding site of the rpoD (SMLT_RS19820) gene of K279a pUC18R6K-mini-Tn7T-Gm-rpoD- AmpR; GmR on mini-Tn7; pUC18R6K-mini-Tn7T-Gm-rpoD with a 723-bp XhoI/BamHI insert containing the mCherry This study mCherry gene of pGEM-T Easy-mCherry mini-Tn7 Delivery Plasmids for Stenotrophomonas pUC18T-mini-Tn7T-Gm-rpoD- AmpR; GmR on mini-Tn7; hybrid plasmid comprising the 3104-bp and 2370-bp KpnI/SalI fragments of pUC18T-mini- This study mCherry Tn7T and pUC18R6K-mini-Tn7T-Gm-rpoD-mCherry, respectively pUC18T-mini-Tn7T-Gm-rpoD- AmpR; GmR on mini-Tn7; hybrid plasmid comprising the 4700-bp and 779-bp ApaI/BamHI fragments of pUC18T- This study mCherry_opt mini-Tn7T-Gm-rpoD-mCherry and pEX-A2-mCherry_opt, respectively pUC18T-mini-Tn7T-Gm-rpoD- AmpR; GmR on mini-Tn7; hybrid plasmid comprising the 4700-bp and 788-bp ApaI/BamHI fragments of pUC18T- This study sfGFP_opt mini-Tn7T-Gm-rpoD-mCherry and pEX-A2-sfGFP_opt, respectively pUC18T-mini-Tn7T-Gm-Pc AmpR; GmR on mini-Tn7; hybrid plasmid consisting of the 4533-bp KpnI/BamHI fragment of pUC18T-mini-Tn7T-Gm- This study rpoD-sfGFP_opt and the 237-bp KpnI/BamHI insert of pEX-A128-Pc promoter pUC18T-mini-Tn7T-Gm-Pc-sfGFP AmpR; GmR on mini-Tn7; pUC18T-mini-Tn7T-Gm-Pc with a 758-bp BamHI/SacI insert containing the sfGFP_opt gene This study of pUC18T-mini-Tn7T-Gm-rpoD-sfGFP_opt pUC18T-mini-Tn7T-Gm-Pc- AmpR; GmR on mini-Tn7; pUC18T-mini-Tn7T-Gm-Pc with a 749-bp BamHI/SacI insert containing the mCherry_opt This study mCherry gene of pUC18T-mini-Tn7T-Gm-rpoD-mCherry_opt pEX-A258-tdTomato_opt AmpR; pEX-A258 vector with a synthetic 1469-bp BamHI/SacI insert containing the tdTomato gene with optimized Eurofins Genomics, Ebersberg, codon usage for Xanthomonadaceae and fused with an optimized ribosomal binding site of the rpoD Germany; this study (SMLT_RS19820) gene of K279a pUC18T-mini-Tn7T-Gm-Pc- AmpR; GmR on mini-Tn7; pUC18T-mini-Tn7T-Gm-Pc with a 1469-bp BamHI/SacI insert containing the tdTomato_opt This study tdTomato gene of pEX-A258-tdTomato_opt pEX-A128-mKate2_opt AmpR; pEX-A128 vector with a synthetic 735-bp BamHI/SacI insert containing the mKate2 gene with optimized Eurofins Genomics, Ebersberg, codon usage for Xanthomonadaceae and fused with an optimized ribosomal binding site of the rpoD Germany; this study (SMLT_RS19820) gene of K279a pUC18T-mini-Tn7T-Gm-Pc- AmpR; GmR on mini-Tn7; pUC18T-mini-Tn7T-Gm-Pc with a 735-bp BamHI/SacI insert containing the mKate2_opt This study mKate2 gene of pEX-A128-mKate2_opt 10.1128/aem.00317-23 Applied and Environmental Microbiology 14 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology TABLE 3 Primers used in this study Primer Sequence KpnI-rpoDprom ATATggtaccCAATCGATTTGTCGAGATCTGTCGTa XhoI-rpoDprom ATATctcgagTAGTGCTCGCGCCACCGb 5XhoI-Fluores ATATctcgagATGGTGAGCAAGGGCGAGGb 3BamHI-Fluores ATATggatccTTACTTGTACAGCTCGTCCATGCCc 5BamHI-Pcprom TAGATggatccGAATTAAACGGTGGCAGGAGGACTACATc 3SacI-Pc-sfGFPopt TAGATgagctcTTATTACTTGTACAGTTCGTCCATGCCGTGGd 3SacI-Pc-mChopt TAGATgagctcTTACTTGTACAGTTCGTCCATGCCd PSmltglmS-up CATCGTCCTTCATCACCACCA PSmltglmS-down AAATCTCCTACATCCACGCC PTn7L ATTAGCTTACGACGCTACACCCe PTn7R CACAGCATAACTGGACTGATTTCe aKpnI site is shown in lower case letters. bXhoI site is shown in lower case letters. cBamHI site is shown in lower case letters. dSacI site is shown in lower case letters. eThe primers have been described previously (45). resulting PCR products of 759 bp (mCherry_opt) and 768 bp (sfGFP_opt) were digested with BamHl/Sacl and cloned between the same sites of pUC18T-mini-Tn7T-Gm-Pc to create pUC18T-mini-Tn7T-Gm-Pc- mCherry and pUC18T-mini-Tn7T-Gm-Pc-sfGFP, respectively. For construction of pUC18T-mini-Tn7T- Gm-Pc-tdTomato and pUC18T-mini-Tn7T-Gm-Pc-mKate2, the synthetic BamHI/Sacl inserts of plasmids pEX-A258-tdTomato_opt (1469 bp) and pEX-A128-mKate2_opt (735 bp) were ligated into the BamHI/ SacI sites of pUC18T-mini-Tn7T-Gm-Pc, respectively. Delivery of mini-Tn7 plasmids into S. maltophilia. The mini-Tn7 delivery plasmids were transferred to S. maltophilia by four-parental matings, using E. coli DH5a/pRK2013 (87–89) and E. coli SM10 (l pir)/ pUX-BF13 (88, 90) as helper strains, and E. coli DH5a/pUC18T-mini-Tn7T-Gm-Pc-mCherry, E. coli DH5a/ pUC18T-mini-Tn7T-Gm-Pc-sfGFP, E. coli DH5a/pUC18T-mini-Tn7T-Gm-Pc-tdTomato and E. coli DH5a/ pUC18T-mini-Tn7T-Gm-Pc-mKate2 as donor strains, respectively. The strains were grown in LB medium supplemented with kanamycin (30 m g/mL) for E. coli DH5a/pRK2013, 100 m g/mL of ampicillin for E. coli SM10 (l pir)/pUX-BF13, and ampicillin (100 m g/mL) and gentamicin (15 m g/mL) for E. coli DH5a strains carrying the mini-Tn7 plasmids. After overnight growth, the cells from 1 mL of each E. coli culture and 330 m L of S. maltophilia were harvested by centrifugation. To prepare a mating mixture, the cell pellets of all strains were pooled in 1 mL of LB medium, sedimented by centrifugation, resuspended in 100 m L SOB medium and then spotted onto an SOB agar plate as described previously for triparental mating experiments (91). Following overnight incubation of the SOB agar plate at 30°C, the bacterial spot was scraped and resuspended in 1 mL of PBS by rigorous vortexing. The S. maltophilia transconjugants were selected at 37°C on LB agar plates containing 60 m g/mL of gentamicin and 5 m g/mL of norfloxacin to counter-select against the E. coli helper and donor strains. Chromosomal insertion of the mini-Tn7 elements in gentamicin-resistant transconjugants was veri- fied by colony PCRs, using the primer pairs PTn7L/PSmltglmS-up and PSmltglmS-down/PTn7R (Table 3) to amplify the flanking mini-Tn7 regions of 671 bp and 502 bp with transposon- and bacterium-specific primers, respectively. For determination of the mini-Tn7 insertion site, the PCR products were ligated into the pCR2.1 cloning vector of the Original T/A Cloning Kit (ThermoFisher Scientific) and sequenced. Confocal laser-scanning microscopy of bacterial cells and biofilms. Confocal laser-scanning mi- croscopy (CLSM) was used for imaging of bacterial cells and biofilms. To prevent movement during imaging, the bacterial cells were immobilized using the agarose pad method essentially as described previously (92). Briefly, the cells of a 1-mL overnight culture were sedimented by centrifugation, washed once with PBS and resuspended in 250 m L of PBS. The bacterial suspension was then mixed with 1 vol- ume of ProLong Live Antifade Reagent in PBS (ThermoFisher Scientific) and placed between a coverslip and a thin pad of 0.5% agarose in PBS. To prepare the inoculum for biofilm formation on an abiotic polymer surface, exponentially growing cultures of fluorescently labeled strains were adjusted to a cell number of about 1.43  104 CFU/mL in 0.5  Brain Heart Infusion (BHI) broth. Each well of a m -Slide 8-Well ibiTreat slide was then seeded with a total volume of 350 m L, containing about 5  103 CFU of each bacterium, followed by incubation of the m -Slides at 30°C without shaking in a humidified chamber. Exhausted medium was replaced by 350 m L of fresh, prewarmed 0.5  BHI broth every 8 to 16 h. After an incubation for 48 or 72 h, the culture supernatants were aspirated and the wells were washed with 350 m L of PBS. The biofilms were then fixed in the dark with 350 m L of a 2% paraformaldehyde (PFA) solution in PBS at room temperature for 20 min. Finally, the biofilms were washed with 350 m L of PBS and overlaid with 200 m L of ProLong Live Antifade Reagent in PBS as recommended by the supplier (ThermoFisher Scientific). For biofilm experiments on a biotic surface, only Calu-3 cells that reached a confluence of at least 90% were used for infection with S. maltophilia Sm314::sfGFP cells of the early exponential growth phase. The multiplicity of infection was adjusted to 10. Following incubation of the m -Slides at 37°C in a humidified atmosphere of 5% CO2 for 16, 24 and 48 h, samples were fixed in the dark with 300 m L of a 1% PFA solution in PBS at room temperature for 20 min. The samples were then washed twice with June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 15 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology 200 m L of PBS for 5 min each. Permeabilization of fixed cells was achieved by treatment of the samples with 150 m L of 0.5% Triton X-100 in PBS at room temperature for 10 min. The samples were washed three times with 200 m L of PBS for 5 min each and then blocked with 200 m L of 5% FBS in PBS at room temperature for 30 min. Staining of Calu-3 cells with Alexa Fluor 647 anti-cytokeratin (pan reactive) anti- body (clone C-11; BioLegend) at a final concentration of 1 m g/mL was performed in 150 m L of 5% FBS in PBS containing 200 U/mL penicillin and 200 m g/mL streptomycin. After overnight incubation at 4°C, samples were washed three times with 200 m L of PBS for 5 min each and incubated in the dark with 150 m L of 300 nM DAPI (BioLegend) at room temperature for 10 min. Following an additional wash step with 200 m L of PBS, samples were overlaid with 200 m L of ProLong Live Antifade Reagent. Imaging was performed with a TCS SP5 inverse confocal laser-scanning microscope (Leica Microsystems, Mannheim, Germany) and analyzed with LAS AF software (version 2.73). The microscope was equipped with a Leica 63x/NA 1.40 HCX Plan Apochromat CS oil immersion objective. The sfGFP protein was excited with 488 nm laser light, and fluorescence emission was detected between 495 and 530 nm, whereas mKate2 was excited with laser light at 594 nm and fluorescence emission was detected between 605 and 670 nm. The excitation wavelength of laser light was 561 nm for both mCherry and tdTomato, but emission of their fluorescence was detected between 573 and 629 nm and 580 and 648, respectively. The excitation wavelength of laser light was 405 nm for DAPI, and its fluorescence emission was detected between 415 and 470 nm. Alexa Fluor 647 was excited with laser light at 633 nm, and fluo- rescence emission was detected between 660 and 685 nm. Three-dimensional biofilm images were rou- tinely generated from confocal image stacks using the daime computer program (93). However, in some specific cases, the confocal image stacks were further processed with Leica's Lightning Deconvolution Tool (Leica Application Suite X, version 3.0.0_15697) and the Imaris Viewer 10.0.0 (Oxford Instruments). Stability testing. The genome stability of mini-Tn7 insertions was investigated after growth of the bacteria in the absence of antibiotic selection pressure for 5 days essentially as described previously (44, 94). To ensure that the initial cultures have retained their selection marker at the beginning of the experiment, fluorescently labeled strains were grown aerobically (220 rpm) at 37°C overnight in LB me- dium containing 60 m g/mL gentamicin. From the overnight cultures, each strain was streaked onto LB agar with 60 m g/mL gentamicin to grow single colonies at 37°C as controls for later colony PCRs. The ini- tial overnight cultures were then grown for five consecutive days at 37°C on a rotary shaker at 200 rpm, with daily dilutions of the cultures by a thousandfold into fresh LB medium. Finally, serial dilutions of the cultures were plated on LB agar without gentamicin to subsequently test 100 single colonies of each strain for their growth on LB agar containing 60 m g/mL gentamicin. The presence and the correct orien- tation of the mini-Tn7 elements was examined in 10 randomly selected colonies of each strain by colony PCRs with primer pair PSmltglmS-down/PTn7R (Table 3). Growth of strains with mini-Tn7 insertions. To compare the growth of fluorescently labeled strains with that of their parental strains, fresh overnight cultures were adjusted to an OD600 of 0.1 with LB- Miller medium, followed by transfer of 100 m L of each diluted culture to 100 m L of LB-Miller medium in each well of a Honeycomb X100 Bioscreen C sterile plate (ThermoFisher Scientific). The growth at 37°C and 220 rpm was recorded by measurement of the OD600 values at 15-minutes intervals for a total of 24 h using a Labsystems Bioscreen C automated microbiology growth curve analysis system (Labsystems, Helsinki, Finland). All growth curves were plotted in triplicate. Based on graphs of log OD600 versus time and estimation of the bacterial cell number from optical density, the generation time (G) of a strain was calculated using the formula G = t/(3.3 log Nt/N0), where t was the time interval, Nt the bacterial cell number at the end of the time interval and N0 the bacterial cell number at the begin- ning of the time interval. Antibiotic susceptibility testing. MICs were determined by the broth microdilution method in cation- adjusted Mueller-Hinton broth (CAMHB) following the recommendations of the Clinical and Laboratory Standards Institute (CLSI) (75). The antibiotic stock solutions were prepared according to the CLSI guidelines and the test panel included 18 antibiotics of different classes. Fluorescently labeled and wild-type parental strains were first grown overnight in CAMHB under the conditions recommended by the CLSI. The MICs were determined in sterile 96-well microplates using 2-fold serial dilutions of each antibiotic. After overnight growth of the strains, 100 m L of diluted bacterial cultures with a cell number of about 5  105 CFU/mL each were added to the wells containing the serial antibiotic dilutions. The microtiter plates were analyzed after 20 h of incubation at 37°C. The MIC was defined as the lowest concentration of the antibiotic (in m g/mL) that prevented visual growth. MIC determinations were done in duplicate. Biofilm formation assay. To evaluate biofilm formation, overnight cultures of the strains were grown aerobically (200 rpm) in 0.5  BHI broth at 37°C, followed by dilution of each culture with fresh medium to an optical density at 620 nm (OD620) of 0.05. Sterile, untreated 96-well microtiter plates (BrandTech 781662) were then inoculated with the bacterial suspensions (200 m L per well) and incu- bated at 37°C for 24 h. Prior to biofilm quantification, cell growth was estimated in each well by meas- uring the OD620 value using a microplate reader (Multilabel Plater Reader VICTOR3, PerkinElmer). Quantification of the biofilm biomass was performed by crystal violet (CV) staining as described previ- ously (95). The amount of biofilm was quantified by measuring the OD550 of dissolved CV using the microplate reader. Biofilm formation (OD550 of CV) was normalized by cell growth (OD620) and reported as relative biofilm formation. For each strain, four biological replicates with six technical replicates each were prepared. Statistical significance was determined by the non-parametric Kruskal-Wallis one-way Analysis of Variance (ANOVA) test corrected for multiple comparisons using Dunn’s test. Virulence in Galleria mellonella. Larvae of Galleria mellonella were reared in-house. A total of 30 lar- vae with a weight between 300 and 400 mg and no signs of melanization were infected with each S. maltophilia strain. For preparation of bacterial inoculums, fluorescently tagged and corresponding June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 16 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology parental wild-type strains were grown overnight in 10 mL of BHI medium at 37°C on a rotary shaker at 200 rpm. The bacterial cells were then sedimented by centrifugation, washed in PBS and adjusted to contain about 5  105 cells per larva, which has been shown previously as an optimal dose of S. malto- philia required to kill G. mellonella over a period of 24 to 96 h (38, 96). The bacterial burden of the doses was confirmed by plating the cells onto BHI agar. The larvae were infected with 10 m L of the inoculum through the left proleg using a 50 m L-Hamilton Microliter syringe and incubated in the dark at 30°C in empty Petri dishes. Survival of infected larvae was scored at 24-h intervals for 5 days. The larvae were considered dead when they failed to respond to touch, which was equivalent to complete melanization (blackening of the larvae). At least two replicates were performed with different batches of larvae. Kaplan–Meier survival curves were plotted using GraphPad Prism 5.0a, and survival analysis and statisti- cal significance was determined using the log-rank test (GraphPad Software, San Diego, CA). Data availability. The complete nucleotide sequences of delivery plasmids pUC18T-mini-Tn7T-Gm-Pc- mCherry (Addgene plasmid # 199247), pUC18T-mini-Tn7T-Gm-Pc-sfGFP (Addgene plasmid # 199248), pUC18T-mini-Tn7T-Gm-Pc-mKate2 (Addgene plasmid # 199249) and pUC18T-mini-Tn7T-Gm-Pc-tdTomato (Addgene plasmid # 199250) have been deposited in the GenBank database under accession numbers. OP566392, OP566393, OP566394 and OP566395, respectively. The plasmids are available through the Addgene repository upon request. SUPPLEMENTAL MATERIAL Supplemental material is available online only. SUPPLEMENTAL FILE 1, DOCX file, 3.3 MB. ACKNOWLEDGMENT The plasmids pUC18R6K-mini-Tn7T-Gm (Addgene plasmid # 65022; http://n2t.net/ addgene:65022; RRID:Addgene_65022), pUC18T-mini-Tn7T (Addgene plasmid # 64957; http://n2t.net/addgene:64957; RRID:Addgene_64957), pUC18T-mini-Tn7T-Gm-ecfp (Addgene plasmid # 65030; http://n2t.net/addgene:65030; RRID:Addgene_65030), pUC18T-mini-Tn7T-Gm-eyfp (Addgene plasmid # 65031; http://n2t.net/addgene:65031; RRID:Addgene_65031) and pUC18T-mini-Tn7T-Gm-dsRedExpress (Addgene plasmid # 65032; http://n2t.net/addgene:65032; RRID:Addgene_65032) were kindly provided by Herbert Schweizer (Colorado State University, Fort Collins, CO) through the Addgene repository. We thank Holger Lößner (Paul-Ehrlich-Institute, Federal Institute for Vaccines and Biomedicines, Langen, Germany) for E. coli SM10 (l pir)/pUX-BF13 and Anke Becker (Center for Synthetic Microbiology - SYNMIKRO, Marburg, Germany) for plasmid pGEM- T Easy-mCherry. U.M. and U.E.S. acknowledge support from the Leibniz Association, which included funding of a PhD Scholarship for C.S.T. (grant SAS-2021-1-FZB of the Leibniz Research Alliance INFECTIONS in an Urbanizing World - Humans, Animals, Environments). Research at Universitat Autònoma de Barcelona was funded by the Spanish MICINN (PID2019- 111364RB-I00) and Catalan AGAUR (2017 SGR 1062). W.R.S. and I.A. thank the PIER fund of the University of Hamburg and DESY. REFERENCES 1. Berg G, Eberl L, Hartmann A. 2005. The rhizosphere as a reservoir for oppor- 7. Steinkamp G, Wiedemann B, Rietschel E, Krahl A, Gielen J, Barmeier H, tunistic human pathogenic bacteria. Environ Microbiol 7:1673–1685. https:// Ratjen F. Emerging Bacteria Study G. 2005. Prospective evaluation of doi.org/10.1111/j.1462-2920.2005.00891.x. emerging bacteria in cystic fibrosis. J Cyst Fibros 4:41–48. https://doi.org/ 2. Brooke JS. 2012. Stenotrophomonas maltophilia: an emerging global 10.1016/j.jcf.2004.10.002. opportunistic pathogen. Clin Microbiol Rev 25:2–41. https://doi.org/10 8. Goss CH, Otto K, Aitken ML, Rubenfeld GD. 2002. Detecting Stenotrophomo- .1128/CMR.00019-11. nas maltophilia does not reduce survival of patients with cystic fibrosis. Am J 3. Denton M, Kerr KG. 1998. Microbiological and clinical aspects of infection Respir Crit Care Med 166:356–361. https://doi.org/10.1164/rccm.2109078. associated with Stenotrophomonas maltophilia. Clin Microbiol Rev 11: 9. Hansen CR. 2012. Stenotrophomonas maltophilia: to be or not to be a 57–80. https://doi.org/10.1128/CMR.11.1.57. cystic fibrosis pathogen. Curr Opin Pulm Med 18:628–631. https://doi 4. Ryan RP, Monchy S, Cardinale M, Taghavi S, Crossman L, Avison MB, Berg G, .org/10.1097/MCP.0b013e328358d4f8. van der Lelie D, Dow JM. 2009. The versatility and adaptation of bacteria from 10. Waters V, Yau Y, Prasad S, Lu A, Atenafu E, Crandall I, Tom S, Tullis E, the genus Stenotrophomonas. Nat Rev Microbiol 7:514–525. https://doi.org/ Ratjen F. 2011. Stenotrophomonas maltophilia in cystic fibrosis: serologic 10.1038/nrmicro2163. response and effect on lung disease. Am J Respir Crit Care Med 183: 5. Falagas ME, Kastoris AC, Vouloumanou EK, Rafailidis PI, Kapaskelis AM, 635–640. https://doi.org/10.1164/rccm.201009-1392OC. Dimopoulos G. 2009. Attributable mortality of Stenotrophomonas malto- 11. Chung H, Lieberman TD, Vargas SO, Flett KB, McAdam AJ, Priebe GP, philia infections: a systematic review of the literature. Future Microbiol 4: Kishony R. 2017. Global and local selection acting on the pathogen Steno- 1103–1109. https://doi.org/10.2217/fmb.09.84. trophomonas maltophilia in the human lung. Nat Commun 8:14078. 6. Paez JI, Costa SF. 2008. Risk factors associated with mortality of infections https://doi.org/10.1038/ncomms14078. caused by Stenotrophomonas maltophilia: a systematic review. J Hosp 12. Esposito A, Pompilio A, Bettua C, Crocetta V, Giacobazzi E, Fiscarelli E, Infect 70:101–108. https://doi.org/10.1016/j.jhin.2008.05.020. Jousson O, Di Bonaventura G. 2017. Evolution of Stenotrophomonas June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 17 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology maltophilia in cystic fibrosis lung over chronic infection: a genomic and Stenotrophomonas maltophilia. Microb Genom 4:e000207. https://doi.org/ phenotypic population study. Front Microbiol 8:1590. https://doi.org/10 10.1099/mgen.0.000207 .3389/fmicb.2017.01590. 31. Welker E, Domfeh Y, Tyagi D, Sinha S, Fisher N. 2015. Genetic manipulation 13. Groschel MI, Meehan CJ, Barilar I, Diricks M, Gonzaga A, Steglich M, of Stenotrophomonas maltophilia. Curr Protoc Microbiol 37:6F.2.1–6F.214. Conchillo-Sole O, Scherer IC, Mamat U, Luz CF, De Bruyne K, Utpatel C, 6F.2.1-6F.2.14. https://doi.org/10.1002/9780471729259.mc06f02s37. Yero D, Gibert I, Daura X, Kampmeier S, Rahman NA, Kresken M, van der 32. Youenou B, Favre-Bonte S, Bodilis J, Brothier E, Dubost A, Muller D, Nazaret S. Werf TS, Alio I, Streit WR, Zhou K, Schwartz T, Rossen JWA, Farhat MR, 2015. Comparative genomics of environmental and clinical Stenotrophomo- Schaible UE, Nubel U, Rupp J, Steinmann J, Niemann S, Kohl TA. 2020. The nas maltophilia strains with different antibiotic resistance profiles. Genome phylogenetic landscape and nosocomial spread of the multidrug-resist- Biol Evol 7:2484–2505. https://doi.org/10.1093/gbe/evv161. ant opportunist Stenotrophomonas maltophilia. Nat Commun 11:2044. 33. Mavridou DA, Gonzalez D, Clements A, Foster KR. 2016. The pUltra plasmid https://doi.org/10.1038/s41467-020-15123-0. series: a robust and flexible tool for fluorescent labeling of Enterobacteria. 14. Pompilio A, Pomponio S, Crocetta V, Gherardi G, Verginelli F, Fiscarelli E, Plasmid 87-88:65–71. https://doi.org/10.1016/j.plasmid.2016.09.005. Dicuonzo G, Savini V, D'Antonio D, Di Bonaventura G. 2011. Phenotypic and 34. Schlechter RO, Jun H, Bernach M, Oso S, Boyd E, Munoz-Lintz DA, Dobson genotypic characterization of Stenotrophomonas maltophilia isolates from RCJ, Remus DM, Remus-Emsermann MNP. 2018. Chromatic bacteria - a patients with cystic fibrosis: genome diversity, biofilm formation, and viru- broad host-range plasmid and chromosomal insertion toolbox for fluo- lence. BMC Microbiol 11:159. https://doi.org/10.1186/1471-2180-11-159. rescent protein expression in bacteria. Front Microbiol 9:3052. https://doi 15. Steinmann J, Mamat U, Abda EM, Kirchhoff L, Streit WR, Schaible UE, .org/10.3389/fmicb.2018.03052. Niemann S, Kohl TA. 2018. Analysis of phylogenetic variation of Stenotro- 35. Dutt Y, Dhiman R, Singh T, Vibhuti A, Gupta A, Pandey RP, Raj VS, Chang CM, phomonas maltophilia reveals human-specific branches. Front Microbiol Priyadarshini A. 2022. The association between biofilm formation and anti- 9:806. https://doi.org/10.3389/fmicb.2018.00806. microbial resistance with possible ingenious bio-remedial approaches. Anti- 16. Yu D, Yin Z, Li B, Jin Y, Ren H, Zhou J, Zhou W, Liang L, Yue J. 2016. Gene biotics (Basel) 11:930. https://doi.org/10.3390/antibiotics11070930. flow, recombination, and positive selection in Stenotrophomonas maltophilia: 36. Stewart PS. 2015. Antimicrobial tolerance in biofilms. Microbiol Spectr 3 mechanisms underlying the diversity of the widespread opportunistic patho- MB-0010-2014. https://doi.org/10.1128/microbiolspec.MB-0010-2014. gen. Genome 59:1063–1075. https://doi.org/10.1139/gen-2016-0073. 37. Stewart PS, Costerton JW. 2001. Antibiotic resistance of bacteria in biofilms. 17. Brooke JS. 2014. New strategies against Stenotrophomonas maltophilia: a Lancet 358:135–138. https://doi.org/10.1016/s0140-6736(01)05321-1. serious worldwide intrinsically drug-resistant opportunistic pathogen. 38. Garcia CA, Alcaraz ES, Franco MA, Passerini de Rossi BN. 2015. Iron is a sig- Expert Rev Anti Infect Ther 12:1–4. https://doi.org/10.1586/14787210 nal for Stenotrophomonas maltophilia biofilm formation, oxidative stress .2014.864553. response, OMPs expression, and virulence. Front Microbiol 6:926. https:// 18. Sanchez MB. 2015. Antibiotic resistance in the opportunistic pathogen doi.org/10.3389/fmicb.2015.00926. Stenotrophomonas maltophilia. Front Microbiol 6:658. https://doi.org/10 39. Pompilio A, Ranalli M, Piccirilli A, Perilli M, Vukovic D, Savic B, Krutova M, .3389/fmicb.2015.00658. Drevinek P, Jonas D, Fiscarelli EV, Tuccio Guarna Assanti V, Tavío MM, 19. Rello J, Kalwaje Eshwara V, Lagunes L, Alves J, Wunderink RG, Conway- Artiles F, Di Bonaventura G. 2020. Biofilm formation among Stenotropho- Morris A, Rojas JN, Alp E, Zhang Z. 2019. A global priority list of the TOp monas maltophilia isolates has clinical relevance: The ANSELM prospec- TEn resistant Microorganisms (TOTEM) study at intensive care: a prioritiza- tive multicenter study. Microorganisms 9:49. https://doi.org/10.3390/ tion exercise based on multi-criteria decision analysis. Eur J Clin Microbiol microorganisms9010049. Infect Dis 38:319–323. https://doi.org/10.1007/s10096-018-3428-y. 40. Ryan RP, Fouhy Y, Garcia BF, Watt SA, Niehaus K, Yang L, Tolker-Nielsen T, 20. Alonso A, Sanchez P, Martinez JL. 2000. Stenotrophomonas maltophilia Dow JM. 2008. Interspecies signalling via the Stenotrophomonas malto- D457R contains a cluster of genes from gram-positive bacteria involved philia diffusible signal factor influences biofilm formation and polymyxin in antibiotic and heavy metal resistance. Antimicrob Agents Chemother tolerance in Pseudomonas aeruginosa. Mol Microbiol 68:75–86. https://doi 44:1778–1782. https://doi.org/10.1128/AAC.44.7.1778-1782.2000. .org/10.1111/j.1365-2958.2008.06132.x. 21. Sanchez MB, Hernandez A, Martinez JL. 2009. Stenotrophomonas malto- 41. Alio I, Gudzuhn M, Perez Garcia P, Danso D, Schoelmerich MC, Mamat U, philia drug resistance. Future Microbiol 4:655–660. https://doi.org/10 Schaible UE, Steinmann J, Yero D, Gibert I, Kohl TA, Niemann S, Groschel MI, .2217/fmb.09.45. Haerdter J, Hackl T, Vollstedt C, Bomeke M, Egelkamp R, Daniel R, Poehlein A, 22. Yamazaki E, Ishii J, Sato K, Nakae T. 1989. The barrier function of the outer membrane of Pseudomonas maltophilia in the diffusion of saccharides Streit WR. 2020. Phenotypic and transcriptomic analyses of seven clinical and beta-lactam antibiotics. FEMS Microbiol Lett 51:85–88. https://doi Stenotrophomonas maltophilia isolates identify a small set of shared and .org/10.1111/j.1574-6968.1989.tb03424.x. commonly regulated genes involved in the biofilm lifestyle. Appl Environ 23. Sanchez MB, Garcia-Leon G, Hernandez A, Martinez JL. 2016. Antimicro- Microbiol 86:e02038-20. https://doi.org/10.1128/AEM.02038-20. bial drug efflux pumps in Stenotrophomonas maltophilia, p 401. In Li X-Z, 42. Pompilio A, Crocetta V, Confalone P, Nicoletti M, Petrucca A, Guarnieri S, Elkins CA, Zgurskaya HI (ed), Efflux-mediated antimicrobial resistance in Fiscarelli E, Savini V, Piccolomini R, Di Bonaventura G. 2010. Adhesion to bacteria. Springer International Publishing Switzerland. and biofilm formation on IB3-1 bronchial cells by Stenotrophomonas mal- 24. Huedo P, Coves X, Daura X, Gibert I, Yero D. 2018. Quorum sensing signal- tophilia isolates from cystic fibrosis patients. BMC Microbiol 10:102. ing and quenching in the multidrug-resistant pathogen Stenotrophomo- https://doi.org/10.1186/1471-2180-10-102. nas maltophilia. Front Cell Infect Microbiol 8:122. https://doi.org/10.3389/ 43. Zhuo C, Zhao QY, Xiao SN. 2014. The impact of spgM, rpfF, rmlA gene dis- fcimb.2018.00122. tribution on biofilm formation in Stenotrophomonas maltophilia. PLoS 25. Abbott IJ, Slavin MA, Turnidge JD, Thursky KA, Worth LJ. 2011. Stenotropho- One 9:e108409. https://doi.org/10.1371/journal.pone.0108409. monas maltophilia: emerging disease patterns and challenges for treatment. 44. Choi KH, Gaynor JB, White KG, Lopez C, Bosio CM, Karkhoff-Schweizer RR, Expert Rev Anti Infect Ther 9:471–488. https://doi.org/10.1586/eri.11.24. Schweizer HP. 2005. A Tn7-based broad-range bacterial cloning and expres- 26. Adegoke AA, Stenstrom TA, Okoh AI. 2017. Stenotrophomonas maltophilia sion system. Nat Methods 2:443–448. https://doi.org/10.1038/nmeth765. as an emerging ubiquitous pathogen: looking beyond contemporary an- 45. Choi KH, Schweizer HP. 2006. mini-Tn7 insertion in bacteria with single tibiotic therapy. Front Microbiol 8:2276. https://doi.org/10.3389/fmicb attTn7 sites: example Pseudomonas aeruginosa. Nat Protoc 1:153–161. .2017.02276. https://doi.org/10.1038/nprot.2006.24. 27. Di Bonaventura G, Stepanovic S, Picciani C, Pompilio A, Piccolomini R. 46. Ducas-Mowchun K, De Silva PM, Crisostomo L, Fernando DM, Chao TC, 2007. Effect of environmental factors on biofilm formation by clinical Pelka P, Schweizer HP, Kumar A. 2019. Next generation of Tn7-based sin- Stenotrophomonas maltophilia isolates. Folia Microbiol (Praha) 52:86–90. gle-copy insertion elements for use in multi- and pan-drug-resistant https://doi.org/10.1007/BF02932144. strains of Acinetobacter baumannii. Appl Environ Microbiol 85:e00066-19. 28. Trifonova A, Strateva T. 2019. Stenotrophomonas maltophilia - a low-grade https://doi.org/10.1128/AEM.00066-19. pathogen with numerous virulence factors. Infect Dis (Lond) 51:168–178. 47. Jittawuttipoka T, Buranajitpakorn S, Fuangthong M, Schweizer HP, https://doi.org/10.1080/23744235.2018.1531145. Vattanaviboon P, Mongkolsuk S. 2009. Mini-Tn7 vectors as genetic tools 29. Lira F, Berg G, Martinez JL. 2017. Double-face meets the bacterial world: for gene cloning at a single copy number in an industrially important and the opportunistic pathogen Stenotrophomonas maltophilia. Front Micro- phytopathogenic bacteria, Xanthomonas spp. FEMS Microbiol Lett 298: biol 8:2190. https://doi.org/10.3389/fmicb.2017.02190. 111–117. https://doi.org/10.1111/j.1574-6968.2009.01707.x. 30. Patil PP, Kumar S, Midha S, Gautam V, Patil PB. 2018. Taxonogenomics 48. Kumar A, Dalton C, Cortez-Cordova J, Schweizer HP. 2010. Mini-Tn7 vec- reveal multiple novel genomospecies associated with clinical isolates of tors as genetic tools for single copy gene cloning in Acinetobacter June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 18 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology baumannii. J Microbiol Methods 82:296–300. https://doi.org/10.1016/j drug resistance determinants. Genome Biol 9:R74. https://doi.org/10 .mimet.2010.07.002. .1186/gb-2008-9-4-r74. 49. Zhang Y, Cao Y, Zhang L, Hikichi Y, Ohnishi K, Li J. 2021. The Tn7-based 70. Conchillo-Sole O, Yero D, Coves X, Huedo P, Martinez-Servat S, Daura X, genomic integration is dependent on an attTn7 box in the glmS gene and Gibert I. 2015. Draft genome sequence of Stenotrophomonas maltophilia is site-specific with monocopy in Ralstonia solanacearum species com- Strain UV74 reveals extensive variability within its genomic Group. Genome plex. Mol Plant Microbe Interact 34:720–725. https://doi.org/10.1094/ Announc 3:e00611-15. https://doi.org/10.1128/genomeA.00611-15. MPMI-11-20-0325-SC. 71. Lira F, Hernandez A, Belda E, Sanchez MB, Moya A, Silva FJ, Martinez JL. 50. Peters JE, Craig NL. 2001. Tn7: smarter than we thought. Nat Rev Mol Cell 2012. Whole-genome sequence of Stenotrophomonas maltophilia D457, a Biol 2:806–814. https://doi.org/10.1038/35099006. clinical isolate and a model strain. J Bacteriol 194:3563–3564. https://doi 51. Vogler AP, Trentmann S, Lengeler JW. 1989. Alternative route for biosyn- .org/10.1128/JB.00602-12. thesis of amino sugars in Escherichia coli K-12 mutants by means of a cata- 72. Andersson DI, Hughes D. 2010. Antibiotic resistance and its cost: is it pos- bolic isomerase. J Bacteriol 171:6586–6592. https://doi.org/10.1128/jb sible to reverse resistance? Nat Rev Microbiol 8:260–271. https://doi.org/ .171.12.6586-6592.1989. 10.1038/nrmicro2319. 52. Choi KH, DeShazer D, Schweizer HP. 2006. mini-Tn7 insertion in bacteria 73. Hernando-Amado S, Sanz-Garcia F, Blanco P, Martinez JL. 2017. Fitness with multiple glmS-linked attTn7 sites: example Burkholderia mallei ATCC costs associated with the acquisition of antibiotic resistance. Essays Bio- 23344. Nat Protoc 1:162–169. https://doi.org/10.1038/nprot.2006.25. chem 61:37–48. https://doi.org/10.1042/EBC20160057. 53. McDaniel MS, Lindgren NR, Billiot CE, Valladares KN, Sumpter NA, Swords 74. Pope CF, McHugh TD, Gillespie SH. 2010. Methods to determine fitness in WE. 2023. Pseudomonas aeruginosa promotes persistence of Stenotropho- bacteria. Methods Mol Biol 642:113–121. https://doi.org/10.1007/978-1 monas maltophilia via increased adherence to depolarized respiratory epi- -60327-279-7_9. thelium. Microbiol Spectr 11:e0384622. https://doi.org/10.1128/spectrum 75. CLSI. 2015. Clinical and Laboratory Standards Institute, Wayne, PA. .03846-22. 76. Flores-Trevino S, Bocanegra-Ibarias P, Camacho-Ortiz A, Morfin-Otero R, 54. McDaniel MS, Schoeb T, Swords WE. 2020. Cooperativity between Steno- Salazar-Sesatty HA, Garza-Gonzalez E. 2019. Stenotrophomonas malto- trophomonas maltophilia and Pseudomonas aeruginosa during polymicro- philia biofilm: its role in infectious diseases. Expert Rev Anti Infect Ther 17: bial airway infections. Infect Immun 88:e00855-19. https://doi.org/10 877–893. https://doi.org/10.1080/14787210.2019.1685875. .1128/IAI.00855-19. 77. García G, Girón JA, Yañez JA, Cedillo ML. 2022. Stenotrophomonas malto- 55. White CV, Darby BJ, Breeden RJ, Herman MA. 2016. A Stenotrophomonas philia and its ability to form biofilms. Microbiology Res 14:1–20. https:// maltophilia strain evades a major Caenorhabditis elegans defense path- doi.org/10.3390/microbiolres14010001. way. Infect Immun 84:524–536. https://doi.org/10.1128/IAI.00711-15. 78. Yero D, Huedo P, Conchillo-Sole O, Martinez-Servat S, Mamat U, Coves X, 56. Ciche TA, Groffredi SK. 2007. General methods to investigate microbial Llanas F, Roca I, Vila J, Schaible UE, Daura X, Gibert I. 2020. Genetic variants of symbioses, 3rd ed ASM Press, Washington, DC. the DSF quorum sensing system in Stenotrophomonas maltophilia influence 57. Lambertsen L, Sternberg C, Molin S. 2004. Mini-Tn7 transposons for site- virulence and resistance phenotypes among genotypically diverse clinical iso- specific tagging of bacteria with fluorescent proteins. Environ Microbiol lates. Front Microbiol 11:1160. https://doi.org/10.3389/fmicb.2020.01160. 6:726–732. https://doi.org/10.1111/j.1462-2920.2004.00605.x. 79. Franklin MJ, Chang C, Akiyama T, Bothner B. 2015. New technologies for 58. McKown RL, Orle KA, Chen T, Craig NL. 1988. Sequence requirements of studying biofilms. Microbiol Spectr 3 MB-0016-2014. https://doi.org/10 Escherichia coli attTn7, a specific site of transposon Tn7 insertion. J Bacter- .1128/microbiolspec.MB-0016-2014. iol 170:352–358. https://doi.org/10.1128/jb.170.1.352-358.1988. 80. Neu TR, Lawrence JR. 2014. Investigation of microbial biofilm structure by 59. Hugh R, Ryschenkow E. 1961. Pseudomonas maltophilia, an alcaligenes-like laser scanning microscopy. Adv Biochem Eng Biotechnol 146:1–51. https:// species. J Gen Microbiol 26:123–132. https://doi.org/10.1099/00221287-26-1 doi.org/10.1007/10_2014_272. -123. 81. Fritts RK, LaSarre B, Stoner AM, Posto AL, McKinlay JB. 2017. A Rhizobiales- 60. Swings J, De Vos P, Van den Mooter M, De Ley J. 1983. Transfer of Pseudo- specific unipolar polysaccharide adhesin contributes to Rhodopseudomo- monas maltophilia Hugh 1981 to the Genus Xanthomonas as Xanthomo- nas palustris biofilm formation across diverse photoheterotrophic condi- nas maltophilia (Hugh 1981) comb. nov. Int J Syst Bacteriol 33:409–413. tions. Appl Environ Microbiol 83:e03035-16. https://doi.org/10.1128/AEM https://doi.org/10.1099/00207713-33-2-409. 61. Palleroni NJ, Bradbury JF. 1993. Stenotrophomonas, a new bacterial genus .03035-16. for Xanthomonas maltophilia (Hugh 1980) Swings et al. 1983. Int J Syst 82. Onyeziri MC, Hardy GG, Natarajan R, Xu J, Reynolds IP, Kim J, Merritt PM, Bacteriol 43:606–609. https://doi.org/10.1099/00207713-43-3-606. Danhorn T, Hibbing ME, Weisberg AJ, Chang JH, Fuqua C. 2022. Dual ad- 62. Xu H, Davies J, Miao V. 2007. Molecular characterization of class 3 inte- hesive unipolar polysaccharides synthesized by overlapping biosynthetic grons from Delftia spp. J Bacteriol 189:6276–6283. https://doi.org/10.1128/ pathways in Agrobacterium tumefaciens. Mol Microbiol 117:1023–1047. JB.00348-07. https://doi.org/10.1111/mmi.14887. 63. Xu Y, Tao F, Ma C, Xu P. 2013. New constitutive vectors: useful genetic en- 83. Moya-Anderico L, Admella J, Fernandes R, Torrents E. 2020. Monitoring gineering tools for biocatalysis. Appl Environ Microbiol 79:2836–2840. gene expression during a Galleria mellonella bacterial infection. Microor- https://doi.org/10.1128/AEM.03746-12. ganisms 8:1798. https://doi.org/10.3390/microorganisms8111798. 64. Wilton R, Ahrendt AJ, Shinde S, Sholto-Douglas DJ, Johnson JL, Brennan 84. Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual, MB, Kemner KM. 2017. A new suite of plasmid vectors for fluorescence- 3rd ed Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. based imaging of root colonizing pseudomonads. Front Plant Sci 8:2242. 85. Grote A, Hiller K, Scheer M, Munch R, Nortemann B, Hempel DC, Jahn D. https://doi.org/10.3389/fpls.2017.02242. 2005. JCat: a novel tool to adapt codon usage of a target gene to its 65. Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP. 1998. A potential expression host. Nucleic Acids Res 33:W526–W531. https://doi broad-host-range Flp-FRT recombination system for site-specific excision .org/10.1093/nar/gki376. of chromosomally-located DNA sequences: application for isolation of 86. Pedelacq JD, Cabantous S, Tran T, Terwilliger TC, Waldo GS. 2006. Engi- unmarked Pseudomonas aeruginosa mutants. Gene 212:77–86. https://doi neering and characterization of a superfolder green fluorescent protein. .org/10.1016/s0378-1119(98)00130-9. Nat Biotechnol 24:79–88. https://doi.org/10.1038/nbt1172. 66. Kovach ME, Phillips RW, Elzer PH, Roop RM, 2nd, Peterson KM. 1994. 87. Figurski DH, Helinski DR. 1979. Replication of an origin-containing derivative pBBR1MCS: a broad-host-range cloning vector. Biotechniques 16:800–802. of plasmid RK2 dependent on a plasmid function provided in trans. Proc 67. Craig NL. 1996. Transposon Tn7. Curr Top Microbiol Immunol 204:27–48. Natl Acad Sci U S A 76:1648–1652. https://doi.org/10.1073/pnas.76.4.1648. 68. Gringauz E, Orle KA, Waddell CS, Craig NL. 1988. Recognition of Esche- 88. Miller VL, Mekalanos JJ. 1988. A novel suicide vector and its use in con- richia coli attTn7 by transposon Tn7: lack of specific sequence require- struction of insertion mutations: osmoregulation of outer membrane pro- ments at the point of Tn7 insertion. J Bacteriol 170:2832–2840. https://doi teins and virulence determinants in Vibrio cholerae requires toxR. J Bacter- .org/10.1128/jb.170.6.2832-2840.1988. iol 170:2575–2583. https://doi.org/10.1128/jb.170.6.2575-2583.1988. 69. Crossman LC, Gould VC, Dow JM, Vernikos GS, Okazaki A, Sebaihia M, 89. Simon R, Priefer U, Pühler A. 1983. A broad host range mobilization system Saunders D, Arrowsmith C, Carver T, Peters N, Adlem E, Kerhornou A, Lord for in vivo genetic engineering: transposon mutagenesis in Gram-negative A, Murphy L, Seeger K, Squares R, Rutter S, Quail MA, Rajandream MA, bacteria. Nat Biotechnol 1:784–791. https://doi.org/10.1038/nbt1183-784. Harris D, Churcher C, Bentley SD, Parkhill J, Thomson NR, Avison MB. 90. Bao Y, Lies DP, Fu H, Roberts GP. 1991. An improved Tn7-based system for the 2008. The complete genome, comparative and functional analysis of single-copy insertion of cloned genes into chromosomes of Gram-negative Stenotrophomonas maltophilia reveals an organism heavily shielded by bacteria. Gene 109:167–168. https://doi.org/10.1016/0378-1119(91)90604-a. June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 19 mini-Tn7 Delivery Plasmids for Stenotrophomonas Applied and Environmental Microbiology 91. Aubert DF, Hamad MA, Valvano MA. 2014. A markerless deletion method 95. Huedo P, Yero D, Martinez-Servat S, Estibariz I, Planell R, Martinez P, Ruyra for genetic manipulation of Burkholderia cenocepacia and other multi- A, Roher N, Roca I, Vila J, Daura X, Gibert I. 2014. Two different rpf clusters drug-resistant Gram-negative bacteria. Methods Mol Biol 1197:311–327. distributed among a population of Stenotrophomonas maltophilia clinical https://doi.org/10.1007/978-1-4939-1261-2_18. strains display differential diffusible signal factor production and viru- 92. Skinner SO, Sepulveda LA, Xu H, Golding I. 2013. Measuring mRNA copy lence regulation. J Bacteriol 196:2431–2442. https://doi.org/10.1128/JB number in individual Escherichia coli cells using single-molecule fluores- .01540-14. cent in situ hybridization. Nat Protoc 8:1100–1113. https://doi.org/10 96. Betts JW, Phee LM, Woodford N, Wareham DW. 2014. Activity of colistin in combination with tigecycline or rifampicin against multidrug-resistant Sten- .1038/nprot.2013.066. otrophomonas maltophilia. Eur J Clin Microbiol Infect Dis 33:1565–1572. 93. Daims H, Lucker S, Wagner M. 2006. daime, a novel image analysis pro- https://doi.org/10.1007/s10096-014-2101-3. gram for microbial ecology and biofilm research. Environ Microbiol 8: 97. Hanahan D. 1985. Techniques for transformation of E. coli, p 109–135. In 200–213. https://doi.org/10.1111/j.1462-2920.2005.00880.x. Glover DM (ed), DNA cloning: a practical approach. IRL, Oxford. 94. Barnes RJ, Leung KT, Schraft H, Ulanova M. 2008. Chromosomal gfp labelling 98. Avison MB, von Heldreich CJ, Higgins CS, Bennett PM, Walsh TR. 2000. A of Pseudomonas aeruginosa using a mini-Tn7 transposon: application for TEM-2beta-lactamase encoded on an active Tn1-like transposon in the studies of bacteria-host interactions. Can J Microbiol 54:48–57. https://doi genome of a clinical isolate of Stenotrophomonas maltophilia. J Antimi- .org/10.1139/w07-118. crob Chemother 46:879–884. https://doi.org/10.1093/jac/46.6.879. June 2023 Volume 89 Issue 6 10.1128/aem.00317-23 20