TYPE Original Research PUBLISHED 27 January 2023 DOI 10.3389/fcimb.2023.1114772 Efficient detection of African OPEN ACCESS Swine Fever Virus using EDITED BY Denis V. Kolbasov, Federal Research Center of Virology and minimal equipment through Microbiology, Russia REVIEWED BY a LAMP PCR method Chungwon Joseph Chung, Agricultural Research Service (USDA), United States Jose Alejandro Bohorquez 1, Saraswathi Lanka 1, Rosa Rosell 2,3,4,5, Ilya Titov, Federal Research Center of Virology and Marta Pérez-Simó 2,3,4, Mònica Alberch 2,3,4, Fernando Microbiology, Russia Rodriguez 3,4, Llilianne Ganges 2,3,4† and Carol W. Maddox 1,6*† *CORRESPONDENCE 1 Veterinary Diagnostic Laboratory, College of Veterinary Medicine, University of Illinois at Urbana- Carol W. Maddox Champaign, Urbana, IL, United States, 2 WOAH Reference Laboratory for Classical Swine Fever, IRTA- maddox@illinois.edu CReSA, Barcelona, Spain, 3 Unitat mixta d’Investigació IRTA-UAB en Sanitat Animal, Centre de Recerca † These authors share senior authorship en Sanitat Animal (CReSA), Bellaterra, Barcelona, Spain, 4 IRTA, Programa de Sanitat Animal, Centre de Recerca en Sanitat Animal (CReSA), Bellaterra, Barcelona, Spain, 5 Departament d’Acció Climàtica, SPECIALTY SECTION Alimentació i Agenda Rural, Generalitat de Catalunya, Barcelona, Spain, 6 Department of Pathobiology, This article was submitted to College of Veterinary Medicine, University of Illinois at Urbana-Champaign, Urbana, IL, United States Clinical Microbiology, a section of the journal Frontiers in Cellular and Infection Microbiology African swine fever virus (ASFV) currently represents the biggest threat to the RECEIVED 05 December 2022 ACCEPTED 09 January 2023 porcine industry worldwide, with high economic impact and severe animal health PUBLISHED 27 January 2023 and welfare concerns. Outbreaks have occurred in Europe and Asia since ASFV was CITATION reintroduced into the continent in 2007 and, in 2021, ASFV was detected in the Bohorquez JA, Lanka S, Rosell R, Caribbean, raising alarm about the reemergence of the virus in the Americas. Given Pérez-Simó M, Alberch M, Rodriguez F, Ganges L and Maddox CW (2023) Efficient the lack of vaccines against ASFV, control of the virus relies on molecular detection of African Swine Fever Virus surveillance, which can be delayed due to the need for sample shipment to using minimal equipment through specialized laboratories. Isothermal PCR techniques, such as LAMP, have a LAMP PCR method. Front. Cell. Infect. Microbiol. 13:1114772. become increasingly attractive as point-of-care diagnostic tools given the doi: 10.3389/fcimb.2023.1114772 minimal material expense, equipment, and training required. The present study COPYRIGHT aimed to develop a LAMP assay for the detection of ASFV. Four LAMP primer sets © 2023 Bohorquez, Lanka, Rosell, were designed, based on a consensus sequence for the ASFV p72 gene, and were Pérez-Simó, Alberch, Rodriguez, Ganges and Maddox. This is an open-access article tested using a synthetic plasmid containing the cloned ASFV p72 target gene as a distributed under the terms of the Creative positive control. Two primer sets, were selected for further validation, given their Commons Attribution License (CC BY). The very short time for amplification. Both primer sets showed thermal stability, use, distribution or reproduction in other forums is permitted, provided the original amplifying the ASFV DNA at temperatures between 60-70°C and proved to have author(s) and the copyright owner(s) are an analytical limit of detection as low as one ASFV-plasmid DNA copy/µL, using credited and that the original publication in this journal is cited, in accordance with both fluorometric and colorimetric methods. The selected primers did not yield accepted academic practice. No use, false positive or cross reactive results with other common swine pathogens, distribution or reproduction is permitted showing high specificity. Testing of DNA-spiked samples showed that LAMP which does not comply with these terms. amplification was not affected by the nature of the matrices, including oral fluids, tonsils, blood, or rectal swabs. The primer sets were able to detect the two more prevalent ASFV genotypes in the field. Taken together, the results show that ASFV-LAMP-BG2 and ASFV-LAMP-BG3 would be a useful tool for rapid, highly sensitive on-site diagnostic testing. KEYWORDS African swine fever, surveillance, disease control, LAMP PCR, isothermal amplification, point of care testing Frontiers in Cellular and Infection Microbiology 01 frontiersin.org Bohorquez et al. 10.3389/fcimb.2023.1114772 1 Introduction detection of the conserved p72 gene (King et al., 2003; Zsak et al., 2005; Ferná ndez-Pinero et al., 2013). These techniques have proved to African swine fever (ASF) currently poses one of the most be highly sensitive, but their main drawback is the requirement for worrisome threats to the porcine industry worldwide (Costard specialized equipment and infrastructure, which implies the transport et al., 2009; Sauter-Louis et al., 2021a; Gladue and Borca, 2022). of samples to the diagnostic laboratory, prolonging the time to results. The disease is characterized by a severe hemorrhagic disease, leading Hence, a rapid, pen-side molecular test, with a similar sensitivity to to high lethality. Its complex epidemiology, which involves different qPCR would be an exceptionally useful tool for ASF surveillance transmission cycles taking place in domestic or wild environments, and control. complicates the control of ASF (Tulman et al., 2009; Pietschmann Loop-mediated isothermal amplification (LAMP) PCR methods et al., 2016; Ramirez-Medina et al., 2022). Its etiological agent, the have gained prominence as a feasible alternative for molecular ASF virus (ASFV), is the sole member of the Asfivirus genus and the diagnosis at the point of care (Knox and Beddoe, 2021; Lu et al., Asfarviridae family (Alonso et al., 2018). Currently, there is no 2021; Sakthivel et al., 2021). These assays are based on the commercially available vaccine that can be used globally in all amplification of nucleic acid, using strand displacement ASFV affected regions. Therefore, the disease control relies on polymerases, which can be carried out without the sudden testing and elimination of affected animals, as well as those within a temperature changes needed for conventional PCR (Notomi et al., determined radius surrounding the affected area. Other control 2000). This amplification can be visualized either by traditional measures include movement restrictions of pork-derived products electrophoresis methods, by detection of fluorescence, turbidity or from the affected countries, as well as heightened biosecurity color changes in the reaction (Mori et al., 2001; Parida et al., 2008; measures in domestic pig farms (Costard et al., 2009; Bosch-Camó s Tanner et al., 2015). The need for a minimum of 6 primer sequences et al., 2021). The direct impact of the disease and the control measures within a ≈ 300 nt span for LAMP amplification, complicates the assay associated with it have led to losses as high as $130 billion in some of design, in terms of sensitivity, but also provides increased specificity. the affected countries, mostly targeting smallholders (Weaver and Against this background, the present work focused on the Habib, 2020; Brown et al., 2021; Frezal et al., 2021; Nguyen-Thi et al., development of a LAMP assay for the detection of ASFV. The sensitivity 2021). Additionally, ASFV outbreaks have indirect repercussions and specificity of the assay were evaluated against the molecular diagnostic along a wide range of industries, leading to further losses and techniques recommended by the USDA and the WOAH. The assay was market compensations that destabilize the economy (Weaver and also tested in a variety of matrices, aiming to provide a tool with potential to Habib, 2020; Frezal et al., 2021). Considering this, ASFV is considered be used in field conditions. All the validation testing performed with the a high-risk pathogen, handled under biosafety level 3 (BSL3) plasmid target was carried out at the veterinary diagnostic laboratory, conditions and included in the list of mandatory notification to the University of Illinois at Urbana-Champaign, IL, USA (VDL-UIUC). The World Organization for Animal Health (WOAH, formerly OIE) validation of the assays, using ASFV viral strains, was performed in the (World organisation for animal health, 2019a). biosafety level 3 facilities at IRTA-CReSA, Barcelona, Spain. ASFV is an icosahedral shape virus, measuring ≈ 200 nm in diameter, with a dsDNA genome between 170 – 190 kb long, encoding 150 – 170 open reading frames (Alonso et al., 2018; 2 Materials and methods Wang et al., 2021b). It was discovered in sub-Saharan Africa in the 1920s, where it has remained endemic ever since, and was spread to 2.1 Cells and viruses Europe in the 1960s and to the Americas a decade later (Costard et al., 2013; Schambow et al., 2022). Following eradication in the 1990s, Collection of porcine alveolar macrophages (PAMs) from healthy ASFV was reintroduced into the Eurasian continent in 2007 through donor pigs was carried out by bronchoalveolar lung lavages with PBS. Georgia and, from there, ASFV has spread both east and west-ward Cells were cultured in RPMI 1640 medium, supplemented with 10% (Rowlands et al., 2008; Costard et al., 2013). This led to a series of fetal bovine serum. outbreaks during the early 2010s, culminating in the introduction of The Badajoz 71 virulent strain (BA71, Genotype I), isolated from the virus in large pork-producing countries, such as China and the 1971 Spanish ASFV outbreak, was provided by Dr. ML Salas Germany (Sauter-Louis et al., 2021b; Ito et al., 2022). Notably, in (CBMSO-CSIC, Madrid-Spain). The Georgia 2007/1 virulent strain 2021, ASFV was detected in the Dominican Republic and Haiti, (genotype II) was provided by Dr. Linda Dixon (The Pirbright raising alarms about the reintroduction of the disease into the Institute, Ash Road, Pirbright, Surrey GU24 0NF, UK). Americas (Gonzales et al., 2021; Stepien and Cole, 2021; Schambow Viral strains were titrated in PAMs by endpoint dilution, using a et al., 2022). peroxidase‐linked assay. The virus titers were expressed as tissue Therefore, efficient ASFV surveillance, based on serologic or culture infectious dose 50 (TCID50) per milliliter and calculated using molecular tests, has become one of the most important tools for standard statistical methods (Reed and Muench, 1938). avoiding the introduction of the disease into a country or taking the necessary actions, once it has been detected. However, the high degree of virulence of the pandemic ASFV strain causes rapid death in most 2.2 ASFV sequence analysis infected animals (Borca et al., 2020; Gallardo et al., 2021) and some of them die before they can generate an effective antibody response The ASFV p72 gene was selected as the target for ASFV-LAMP (Monteagudo et al., 2017). Currently, the molecular diagnosis of ASF primer design. All the full length (n=111) and partial (n=1304) p72 is mostly based on real time PCR methods (qPCR), aimed at the sequences available in NCBI were aligned using the BioEdit sequence Frontiers in Cellular and Infection Microbiology 02 frontiersin.org Bohorquez et al. 10.3389/fcimb.2023.1114772 alignment Editor, version 7.0.5.3 (Hall, 1999) and a consensus DNA extraction, a heating method for DNA release with minimal sequence was generated (1941 nt, >99% homology with field ASFV equipment was employed, when specified. The samples, diluted at a strains). The ASFV sequences alignment was then subjected to 1:10 or 1:100 ratio in sterile water, were then subjected to a heating at entropy analysis, to find the most conserved regions within the 94° C for 10 min before either qPCR or LAMP amplification. gene sequence. Selected gene regions that contained multiple Detection of ASFV DNA was carried out by the WOAH- conserved sequences (>15 continuous nts) within a 200 nt span recommended ASFV qPCR assay (Ferná ndez-Pinero et al., 2013), were stored for further analysis. using the modified protocol that employs the ASF-VP72P1 probe instead of the UPL probe, in accordance with the WOAH guidelines (World organisation for animal health, 2019b). This test is routinely 2.3 Plasmid insert designs used at IRTA-CReSA for ASFV surveillance, following the standard operating procedures of the European Union Reference laboratory for The consensus sequence from ASFV p72 (1941 nt) was submitted ASF at CISA-INIA (CISA-INIA, 2021). Cycle threshold (Ct) values to Integrated DNA technologies Inc. (IDT, Coralville, IA, USA) for below 35 were considered as positive, between 35 and 40 as suspect custom gene synthesis and cloning into a plasmid vector expressing a and above 40 as negative. Additionally, the USDA-validated ASFV kanamycin resistance gene (pUCIDT (Kan)). The pUCIDT (Kan) qPCR assay (Zsak et al., 2005), routinely used in the VDL-UIUC for plasmid, with the p72 insert (named pSLA) was transfected by heat ASFV surveillance, was used for detection of pSLA DNA, with Ct shock into competent E. coli (NEB® DH5-alpha Competent E. coli values under 40 being considered positive. (High Efficiency), New England Biolabs, Ipswich, MA) for propagation. After plasmid purification with the QIAGEN plasmid Midi Kit (Qiagen, Hilden, Germany), the p72 sequence insert was 2.6 Fluorometric LAMP reactions verified by Sanger sequencing. Plasmid quantification was carried out using the Qubit™4 Fluorometer system (Thermo Fisher Scientific, Fluorometric LAMP reactions were performed in a final reaction Waltham, MA) and plasmid ten-fold dilutions were performed, volume of 25µL under the following conditions: Fluorometric LAMP starting at a concentration of 107 plasmid copies/µL until 1 plasmid Mastermix (ISO-004, OptiGene Limited, West Sussex, UK) 1X, FIP copy/µL. The plasmid dilutions were used as standards and positive and BIP primers (0.8µM), LoopF and LoopB primers (0.4µM), F3 and control for the ASFV-LAMP validation. B3 primers (0.2µM) and DNA template (5µL). LAMP amplification was carried out at 65°C for 30 min, in the Genie® II LAMP machine (OptiGene), unless indicated otherwise. 2.4 ASFV-LAMP primer design The annealing temperature of the pSLA amplifications was used to establish the annealing temperature for ASFV-LAMP reactions. The LAMP designer, version 1.16 software (Premier Biosoft, Palo Samples were considered as positive if there was a detectable Alto, CA, USA) was used for the design of the LAMP primers, based amplification peak before the end of the amplification time, as well on the full-length consensus p72 sequence (1941 nts). The sequences as an annealing temperature within 0.5°C of that established for the from each primer in every primer set generated by the software, were positive controls. evaluated by pairing them against the ASFV p72 full sequence alignment. Degenerations were manually introduced into each primer, in cases when the nucleotide (nt) showed <90% homology 2.7 Colorimetric LAMP reactions in all the analyzed sequences. Primer sets that included any “N” degenerations were discarded, as were those that included primers Colorimetric ASFV-LAMP reactions were performed under the with >10% of degenerated nts in the primer sequence. Additionally, following conditions: WarmStart® Colorimetric LAMP Master Mix the OligoAnalyzer tool of IDT (https://www.idtdna.com/pages/tools/ (New England biolabs, Ipswitch, MA) 1X, FIP and BIP primers oligoanalyzer) was used to assess the complementarity in the primers. (0.8µM), LoopF and LoopB primers (0.4µM) and F3 and B3 Both the non-degenerated, and the degenerated primer sequences primers (0.2µM). LAMP amplification was carried out at 65°C, were compared to check for major increases in complementarity either in a thermocycler (GeneAmp® PCR system 2700, Applied associated with degenerations. biosystems) or in a water bath, using pSLA DNA as template (5µL/ reaction). Final reaction volume was set at 25µL. Amplification was carried out at 65°C for 30 minutes. Reactions were deemed as positive 2.5 qPCR reference methods for ASFV (bright yellow), suspect (pale pink) or negative (bright pink), detection according to the coloration of the mastermix at the end of the amplification. All viral culture and infected animal samples were subjected to viral DNA extraction, using the IndiMag Pathogen Kit (Indical, Leipzig, Germany) according to the manufacturer’s instructions. 2.8 Thermal stability For all samples, an initial volume of 200 ml of sample were used for a final yield of 100 ml of DNA. Tissue samples were suspended in The thermal stability of the ASFV-LAMP amplification was tested RPMI 1640 media (Lonza bioscience, Morrisville, NC) and macerated for both fluorometric and colorimetric reactions, in a temperature through a 70mm filter before DNA extraction. As an alternative to gradient between 60-70°C, using the temperature gradient function of Frontiers in Cellular and Infection Microbiology 03 frontiersin.org Bohorquez et al. 10.3389/fcimb.2023.1114772 the Genie® II LAMP machine. The LAMP reactions were performed tonsil, spleen, and sera. In the case of genotype II, domestic pigs had using the pSLA DNA at a concentration of 104 plasmid copies/µL. been infected with the Georgia2007/01 strain at a dose of 104 hemadsorption units (HA50)/ml, through intranasal inoculation. Sample matrices included: Nasal swab, oral swab, rectal swab, 2.9 LAMP analytical limit of detection lymph node, lung, tonsil, sera, and whole blood. The inoculation took place at the biosafety level 3 facilities (BSL3) at IRTA-CReSA and Ten-fold dilutions of pSLA DNA were used to assess the was carried out according to existing Spanish and European analytical limit of detection for the ASFV-LAMP assays, starting at regulations. The protocol had been approved by the Ethical a concentration of 106 plasmid copies/µL through 1 plasmid copy/µL. Committee of the Generalitat de Catalonia, Spain under the animal The dilutions were tested in triplicate by both fluorometric and experimentation project number 11768. colorimetric LAMP and paired against the Ct value obtained by the USDA-validated ASFV qPCR assay (Zsak et al., 2005). 2.13 ASFV-LAMP detection of viral DNA extracted using minimal equipment 2.10 LAMP biological limit of detection Samples from the ASFV experimentally infected animals (section The ASFV BA71 and Georgia 2007/01 strains, cultured in PAMs, 2.12) were randomly selected and diluted at a 1:10 or 1:100 ratio in were used to evaluate the biological limit of detection of the LAMP sterile water, followed by either magnetic bead-based or heating- assays. Ten-fold dilutions of ASFV-infected PAMs were performed, based extraction, as described in section 2.5. The DNA obtained from starting at a titer of 105 TCID50/ml and 107.2 TCID50/ml for BA71 and both extraction methods was tested by the WOAH-qPCR and by Georgia 2007/01, respectively. Each viral dilution was subjected to ASFV-LAMP. A total of 12 samples (six from genotype I and six from column-based DNA extraction and viral DNA was stored at -80°C. genotype II) were used. Randomized selection led to three Samples were tested, in triplicate, by fluorometric and colorimetric overlapping matrices that were analyzed for both genotypes (serum, LAMP and compared to their respective Ct value by the WOAH- rectal swab and lymph node). Lung, tonsil and spleen samples were recommended ASFV qPCR (Ferná ndez-Pinero et al., 2013). only tested in genotype I-infected animals, whereas whole blood, oral swab and bone marrow were only tested from genotype II- infected pigs. 2.11 LAMP testing of DNA-spiked samples In order to assess the inhibitory capabilities of different matrices 2.14 Specificity testing on the ASFV-LAMP assays, four different matrices were tested: Sera, Tonsil swabs, rectal swabs and oral fluids. Swab samples had been Primer sets ASFV-LAMP-BG2 and ASFV-LAMP-BG3 were diluted in 500 µl of water. Ten samples from each of the four matrices tested against a battery of DNA samples from 22 different were diluted in water at a 1:10 proportion and afterwards were spiked pathogens (Supplementary Table 1). These samples corresponded with pSLA DNA at a concentration of 5*102 plasmid copies/uL. with bacterial and viral pathogens relevant for porcine health, as well Additionally, to simulate a nucleic acid extraction method to be easily as pathogens genomically related to those of relevance in performed in field conditions, the samples were boiled at 100°C for 15 porcine health. minutes (Ceruti et al., 2021; Yang et al., 2022). Afterwards, non- spiked and spiked samples were evaluated by fluorometric and colorimetric LAMP detection. Half of the assays were performed by 2.15 Statistical analysis one operator and the other half by another, to assess the possible effect of the operator on the results. Statistical analysis was performed using the GraphPad Prism 8.3.0 software for Windows (GraphPad Software, San Diego, California USA, www.graphpad.com). The Mann-Whitney non-parametric test 2.12 Detection of ASFV DNA from was used for comparisons of means between groups. experimentally infected animals Samples obtained from animals experimentally infected with 3 Results either ASFV genotype I or II (n=26 samples for each genotype) were randomly selected and evaluated in duplicates using ASFV- 3.1 Selection of ASFV-LAMP primer LAMP. These samples were also tested by the WOAH-recommended candidates qPCR test and results were compared to those obtained with the ASFV-LAMP. Using the established criteria, four primer sets (named ASFV- For genotype I, samples corresponded with a previously LAMP-BG1 to ASFV-LAMP-BG4) were selected for testing. The performed experimental infection in wild boar, using the wild type fluorometric LAMP results showed detection of pSLA DNA by all E75 strain (Cabezó n et al., 2017), were tested. Sample matrices the synthesized primer sets (Figure 1). The fastest ASFV DNA included: nasal swab, rectal swab, lymph node, bone marrow, lung, amplification was detected for primer set ASFV-LAMP-BG3 which Frontiers in Cellular and Infection Microbiology 04 frontiersin.org Bohorquez et al. 10.3389/fcimb.2023.1114772 had detectable fluorescence between 5-6 minutes. A slight increase in Annealing temperatures showed small variations between the tested the time to detection was found for the ASFV-LAMP-BG2, which temperatures and were found to be between 86.5 ± 0.5°C for ASFV- showed positive results starting at 7 minutes, whereas the LAMP-BG2 and between 87.0 ± 0.5°C for ASFV-LAMP- amplification time was increased by over 4 minutes in the BG3 (Figure 2A). remaining two primer sets (Figure 1). None of the primer sets Both ASFV-LAMP assays showed positive results, using tested showed non-specific amplification detectable in the colorimetric detection, after 30 min of amplification at all the negative controls. temperatures between 60-68°C (Figure 2B). The mastermix Due to its shorter time to detection, primer sets ASFV-LAMP- coloration was clearly differentiated between the positive samples BG2 and ASFV-LAMP-BG3 were selected for further validation. The (yellow) and the negative controls (bright pink). primer sequences and their location within the ASFV-p72 gene are detailed in Table 1. 3.3 The two selected ASFV-LAMP assays are able to detect as few as 1 gene copy/µL 3.2 The ASFV-LAMP-BG2 and ASFV-LAMP- BG3 primer sets showed thermal stability Using fluorometric detection, amplification was detected as early as 5 minutes in the highest pSLA concentration tested (106 plasmid In the fluorometric assay, the pSLA DNA (104 plasmid copies/µL) copies/µL, Ct value ≈ 16 by qPCR), by either ASFV-LAMP-BG2 or was amplified by both ASFV-LAMP-BG2 and ASFV-LAMP-BG3 ASFV-LAMP-BG3 (Figures 3A, B). Both ASFV-LAMP assays were primer sets at all the amplification temperatures tested (between 60 capable to detect all the subsequent ten-fold dilutions, showing and 70°C, Figure 2A). The shortest times to detection were found in similar amplification times up to 10 plasmid copies/µL. In the the reactions carried out at temperatures <67°C for both primer sets. lowest plasmid concentration tested (1 copy/µL), the ASFV-LAMP- BG3 primer set showed better performance, detecting all the triplicates tested, with an amplification time ≈ 13 minutes, whereas the ASFV-LAMP-BG2 failed to detect one of the triplicates and showed amplification time over 20 minutes. The Ct value from this plasmid dilution by qPCR was around 36, near the limit of detection of the technique. For the colorimetric assay, color changes in the mastermix from both ASFV-LAMP-BG2 and ASFV-LAMP-BG3 assays were observed as early as 20 min of amplification, particularly at the highest plasmid FIGURE 1 concentrations (Figures 3C, D). Primer set ASFV-LAMP-BG3 Comparison of the fluorometric ASFV-LAMP PCR amplification by the showed a more noticeable yellow coloration at this time-point. four designed primer sets. Amplification is represented as the normalized fluorescence, shown in a colorimetric scale, of the three Following an extra 10 min amplification, all the reactions with replicates performed using each primer set. ASFV plasmid dilutions showed a bright yellow color, in contrast with the bright pink of the negative control (Figures 3C, D). For the TABLE 1 Primer sequences for the ASFV-LAMP-BG2 and ASFV-LAMP-BG3 primer sets. Primer set Primer Sequence Position F3 CAAGATCAGCCGTRGTGATAG 72-92 B3 TCCGTAACTGCTCATGGTA 321-300 FIP(F1c+F2) CCTTTGCTTTGAAGCCACGGAATTCTCTTGCTCTGGATACG 194-175; 125-145 ASFV-LAMP-BG2 BIP(B1c+B2) CATCATCGCVCCCGGATCRTAGTTCTGCAGCTCTTACATAC 199-218; 275-255 LoopF GAGGAATACCAACCCAGTGG 174-155 LoopB ATYGMATTGCCTCCGTAG 230-247 F3 GTTGCGTCCGTRATAGGRG 1037-1055 B3 ATGACTGGATATAAGCACTTGG 1281-1260 FIP(F1c+F2) CGAACGTGYAGCCATACCAGGATATTGTGVGAGTTCTCGG 1146-1128; 1080-1098 ASFV-LAMP-BG3 BIP(B1c+B2) GCTTTGGTGCGGCTTGTGCAGGAGGTATCGGTGGAG 1180-1197; 1254-1238 LoopF CCCGAAATTYCTTTCACARCAT 1126-1105 LoopB TGAATGTTGCATAGGAGAGGG 1205-1225 In bold-Italics: sequences in reverse-complementary form. Frontiers in Cellular and Infection Microbiology 05 frontiersin.org Bohorquez et al. 10.3389/fcimb.2023.1114772 above reasons, primer set BG3 became the primary target of the “suspect” samples was still clearly differentiated from the negative further testing. controls and the unspiked samples (Figure 4B). The ASFV-LAMP-BG3 assay also proved to be highly specific, since none of the nucleic acid samples from other pathogens was positive by fluorometric nor colorimetric LAMP (Supplementary Table 1). 3.5 The ASFV-LAMP assays showed highly efficient detection of ASFV DNA from multiple viral genotypes 3.4 The ASFV-LAMP-BG3 assay detected target DNA in a variety of matrices In the ASFV genotype I strain (BA71), amplification time for the highest DNA concentration tested (105 TCID50/ml, Ct value ≈ 16 by None of the matrices tested showed non-specific amplification, qPCR) was around 5:30 minutes by ASFV-LAMP-BG3, increasing by neither in the fluorometric, nor the colorimetric assays. Conversely, about one minute for each subsequent dilution. The ASFV-LAMP all the spiked samples were positive by fluorometric detection. assay was able to consistently detect ASFV DNA until the sample Amplification times in the fluorometric LAMP detection were extracted from the 10 TCID50/ml virus dilution, while one of the similar for all the matrices tested, as well as for both operators, with triplicates from the 1 TCID 50 /ml dilution was also positive no statistical differences being evidenced (Figure 4A). (Figure 5A). Replicates that were negative by ASFV-LAMP assays In the colorimetric detection, the ASFV-LAMP-BG3 primer set were also negative by the WOAH-recommended ASFV qPCR test. showed clearly positive results in over 70% of pSLA-spiked samples, Using colorimetric detection, ASFV-LAMP-BG3 showed bright while the remaining samples showed pale pink coloration, yellow coloration in the majority of the genotype I viral DNA corresponding with suspect results. Nevertheless, the coloration on samples, corresponding with clear positive results. Only the lowest A B FIGURE 2 Thermal stability of ASFV-LAMP. (A) Fluorometric detection of ASFV-LAMP-BG2 (blue dots and bars) and ASFV-LAMP-BG3 (red dots and bars) amplification. Dots represent the time to detection (in minutes, left Y axis) and bars represent the annealing temperature for each reaction (in °C, right Y axis). (B) Colorimetric detection of ASFV-LAMP-BG2 (upper panel) and ASFV-LAMP-BG3 (lower panel) showing amplification at different temperatures. Reactions were deemed as positive when a discernible color change could be observed in the mastermix, compared with the negative control (far right tube). Frontiers in Cellular and Infection Microbiology 06 frontiersin.org Bohorquez et al. 10.3389/fcimb.2023.1114772 A B C D FIGURE 3 Analytical limit of detection for the ASFV-LAMP-BG2 and ASFV-LAMP-BG3 assays. Ten-fold dilutions of the pSLA plasmid (containing the ASFV-p72 gene sequence) were tested by fluorometric (A, B) and colorimetric (C, D) LAMP, as well as by the USDA-reference qPCR test. For the fluorometric detection, results are represented as the time to detection (in minutes, X axis), compared to the qPCR results, expressed in Ct value (Y axis). Samples that showed LAMP amplification before 30 minutes (dotted line), were considered as positive. Colorimetric reactions were checked after 20 and 30 minutes of amplification and were deemed as positive when a discernible color change could be observed in the mastermix, compared with the negative control (far right tube). concentration detected was characterized as suspect (pale dilution with a titer of 103.2 TCID50/ml. This was also the only DNA pink coloration). concentration showing a suspect result, with the rest being clearly Amplification times of ASFV genotype II DNA (Georgia2007/01 positive (Figure 5C). strain) ranged from 6 to 17 minutes in samples with titers between 107.2 and 102.2 TCID50/ml, using fluorometric detection for ASFV- LAMP-BG3. The LAMP assay was able to consistently detect DNA 3.6 The ASFV-LAMP-BG3 primer set was from viral dilutions as low as 103.2 TCID50/ml (Ct values of highly efficient at detecting viral DNA from approximately 28) and showed partial detection at lower ASFV-infected tissues and clinical samples concentrations, near the limit of detection for the WOAH- recommended qPCR assay (Figure 5B). In the colorimetric LAMP All the sera and tissue samples evaluated from E75-infected wild tests, the lowest DNA concentration detected corresponded with viral boar (ASFV genotype I) were positive by both fluorometric and A B FIGURE 4 Detection of pSLA DNA (containing the ASFV-p72 gene sequence) in spiked matrices by ASFV-LAMP-BG3. (A) Fluorometric detection of pSLA DNA. Amplification is represented as the normalized fluorescence, shown in a colorimetric scale, of the spiked samples. (B) Colorimetric detection of ASFV-LAMP- BG3 amplification. Reactions were characterized as positive, suspect or negative, according to the coloration of the mastermix after 30 min of amplification. Frontiers in Cellular and Infection Microbiology 07 frontiersin.org Bohorquez et al. 10.3389/fcimb.2023.1114772 A B C FIGURE 5 Detection of ASFV genotypes I and II by LAMP PCR. Ten-fold dilutions of viral cultures from ASFV Badajoz 71 strain (genotype I, panels A and upper panel of C) and Georgia 2007/01 strain (genotype II, panel B and lower panel of C) were tested by the ASFV-LAMP-BG3 primer set. Results of fluorometric LAMP are represented as the time to detection in minutes (panels A and B, X axis) in comparison with the Ct value from the WOAH recommended qPCR assay (panels A and B, Y axis). Samples that showed LAMP amplification before 30 minutes (dotted line), were considered as positive. Colorimetric results are shown in a qualitative scale, in accordance with the mastermix coloration after 30 min amplification. colorimetric detection using the ASFV-LAMP-BG3 primer set, In the case of Georgia2007/01-infected animals (ASFV genotype though one of the replicates from a tonsil sample was negative by II), all the samples that were positive by the WOAH-recommended fluorometric LAMP (Figure 6A). Half of the nasal swab samples qPCR test were also positive in at least one replicate, by both evaluated were negative by fluorometric LAMP detection, as was one fluorometric and colorimetric LAMP (Figure 6B). The two samples of the rectal swab samples. These samples corresponded with the with one positive and one negative replicate in both detection lowest DNA concentrations tested, showing CT values >28 by the techniques (one lung and one oral swab), had also shown the WOAH-recommended qPCR. highest CT values by qPCR. The annealing temperature for all the Frontiers in Cellular and Infection Microbiology 08 frontiersin.org Bohorquez et al. 10.3389/fcimb.2023.1114772 A B FIGURE 6 ASFV-LAMP-BG3 testing in samples from infected animals. Samples from wild boar infected with the Badajoz 71 strain (genotype I, panel A) or pigs infected with the Georgia2007/01 strain (genotype II, panel B) were tested by ASFV-LAMP in duplicate, using fluorometric and colorimetric detection, as well as by the WOAH-recommended qPCR. Fluorometric LAMP results are represented as time to amplification with each bar representing one sample (upward facing bars) and error lines showing the variability in the LAMP duplicates. Samples that showed LAMP amplification before 30 minutes (dotted line), were considered as positive. Asterisk represents samples with one positive and one negative replicate by LAMP-PCR. Colorimetric LAMP results are shown in a qualitative scale, with duplicates represented as two small, stacked rectangles between the LAMP and qPCR bars. qPCR results are shown as Ct value (downward facing bars). Samples that showed a Ct value below 40 were considered as positive. samples from animals infected whether with genotype I or II ASFV, only the heat-extracted serum sample and the rectal swab sample was within 1° C of variability (86.08 – 87.07). were negative (Figure 7B). 3.7 ASFV-LAMP amplification can be 4 Discussion efficiently performed using minimal equipment DNA extraction The current epidemiological situation of ASFV continues to pose a great concern for the swine industry worldwide (Sauter-Louis et al., In the samples diluted at a 1:10 ratio, animals that were infected 2021a; Sauter-Louis et al., 2021b; Ito et al., 2022). This is exacerbated with genotype I ASFV were positive in the six matrices tested by both by the lack of a global vaccination strategy against the virus, which ASFV-LAMP-BG3 and qPCR, regardless of the extraction method renders surveillance as the basis around which prevention and control used. Ct values and amplification time were slightly higher in the strategies are built (Costard et al., 2009; Urbano and Ferreira, 2022). DNA samples extracted through heating treatment (Figure 7A blue). The currently used techniques, while being highly sensitive and Colorimetric LAMP detection was also positive in both the magnetic specific, entail a delay of the time to obtain a result, given the bead-based and the heating-based DNA extraction from these requirement for special equipment and infrastructure to carry them samples. In the case of genotype II-infected pigs, the serum and out (World organisation for animal health, 2019b). The results of the lymph node samples that had been subjected to heating extraction present study show the design of an ASFV-LAMP PCR primer set, were not amplified by ASFV-LAMP, neither by fluorometric nor which can be employed for the detection of ASFV DNA using colorimetric detection, despite being positive by qPCR. The portable equipment, potentially reducing the time to diagnosis. remaining samples from animals infected with genotype II ASFV Additionally, this primer set (ASFV-LAMP-BG3) proved to were positive by qPCR and both ASFV-LAMP detection methods perform efficiently with a colorimetric detection scheme requiring (Figure 7A pink) minimal equipment, making it adaptable to point-of-care testing. For the samples diluted at a proportion of 1:100, all the samples The ASFV-LAMP primer sets were designed based on the ASFV- from animals infected with ASFV genotypes I or II were positive by p72 gene, which shows highly conserved regions across different qPCR and colorimetric LAMP detection, using both DNA extraction genotypes. This gene has proven to be very reliable as a target for methods (Figure 7B). In the ASFV-LAMP fluorometric detection, ASFV molecular diagnosis and is currently used for the WOAH and Frontiers in Cellular and Infection Microbiology 09 frontiersin.org Bohorquez et al. 10.3389/fcimb.2023.1114772 A B FIGURE 7 Evaluation of ASFV-LAMP-BG3 using an equipment-free DNA extraction method. Samples from animals infected with ASFV were diluted at a ratio of 1:10 (A) or 1:100 (B) and subjected to magnetic bead-based (plain bars) or equipment-free extraction based on heating (striped bars). DNA samples were tested by ASFV-LAMP, using fluorometric and colorimetric detection, as well as by the WOAH-recommended qPCR. Animals had been infected either with the Badajoz 71 strain (genotype I, blue shaded panels) or the Georgia2007/01 strain (genotype II, red shaded panels). Fluorometric LAMP results are represented as time to amplification with each bar representing one sample (upward facing bars). Samples that showed LAMP amplification before 30 minutes (dotted line), were considered as positive. Colorimetric LAMP results are shown in a qualitative scale, as rectangles between the LAMP and qPCR bars. qPCR results are shown as Ct value (downward facing bars). Samples that showed a Ct value below 40 were considered as positive. USDA recommended qPCR assays (King et al., 2003; Zsak et al., 2005; studies have been performed using reagents, such as lysis buffers and Ferná ndez-Pinero et al., 2013). Using this target, the ASFV-LAMP pH stabilizers, that are not readily available at the point of care. In the assay proved to reliably detect as few as 1 target copy/µl (5 target present study, this DNA release method was applied to tissues from copies/reaction), while being highly specific and not showing animals infected with ASFV, using water as a diluent, instead of a amplification of any other tested microorganisms. This analytical commercial dilution lysis buffer for the samples before DNA release limit of detection proved to be similar to that of the WOAH- through heating. The fact that all these samples were positive by qPCR recommended qPCR assay (Ferná n dez-Pinero et al., 2013). after heating extraction shows that DNA release using water was Remarkably, the highly sensitive detection of ASFV DNA by ASFV- successful. This was replicated by boiling the DNA-spiked samples LAMP-BG3 was achieved using both fluorometric and colorimetric for 15 minutes, which yielded positive LAMP-PCR results. detection methods. This primer set consistently showed a clear Nevertheless, in the tissues from animals infected with ASFV, not all differentiation between negative and positive samples, in the of the matrices tested showed a positive result. It is possible that certain colorimetric detection assays, particularly those carried out with matrices can hinder LAMP amplification, or the detection methods viral DNA. used, and thus require further dilution. This appeared to be the case in Recently, the WOAH identified point of care isothermal the present study, in which sample dilution at a proportion of 1:100 techniques, such as LAMP, as promising technologies for ASFV field yielded 100% positive results in the colorimetric detection. This is diagnosis, but showed that the relatively high cost of detection noteworthy, considering that this is the cheaper and most feasible equipment remains their main drawback (Inui et al., 2022). The method to be implemented as a pen-side test, due to the lack of results of the present study directly address these concerns with the equipment that would be needed. Therefore, the application of this development of an ASFV-LAMP PCR assay that can be performed with method would be of great relevance for the active surveillance of the minimal equipment (i.e. a water bath). Another concern for the virus, and it can be used in animal movement transport, on farms and implementation of these techniques in the field relates to the need even in areas where dead boar carcasses can be detected. for DNA extraction, which also requires equipment that is not readily Considering the potential advantages posed by isothermal available in the field (Inui et al., 2022). In this regard, previous studies amplification techniques for the development of point of care have shown that pathogen lysis through heating, can be used for nucleic diagnostic tests, multiple isothermal assays have recently been acid release without the need for extraction columns or laboratory developed for the detection of ASFV (Mee et al., 2020; Ceruti et al., equipment (Ceruti et al., 2021; Yang et al., 2022). However, these 2021; Wang et al., 2021a; Yang et al., 2022). However, their detection Frontiers in Cellular and Infection Microbiology 10 frontiersin.org Bohorquez et al. 10.3389/fcimb.2023.1114772 methods rely on specialized equipment or dyes (such as SYBR green). in parts of Africa (Mulumba-Mfumu et al., 2019; Njau et al., 2021; Qu Lateral flow approaches, associated with some of these techniques et al., 2022), should be assessed in future studies. In this regard, the have also been reported to be subject to cross contamination risk portability of a LAMP PCR machine for fluorometric detection or the (Ceruti et al., 2021). Comparatively, the ASFV-LAMP assay designed austere setup with which the colorimetric LAMP can be performed, in the present study provides either faster detection or requires would suggest that these tools can be applied for surveillance even in minimal equipment, while continuing to show high performance remote regions or backyard farms. This is important, considering through fluorometric and colorimetric detection. Additionally, the that, as high as 98% of the outbreaks have been related to backyard interest spiked by LAMP technologies has led to recent improvements productions in the Dominican Republic (Gonzales et al., 2021; in terms of development of thermostable enzymes (facilitating travel), Rademacher et al., 2022). In addition, wildlife plays a key role in as well as portable detection methods, using smartphones, that can the epidemiology of ASFV and must be taken into account in any potentially be applied to the designed ASFV-LAMP-BG3 assay surveillance program (Mighell and Ward, 2021; Sauter-Louis et al., (Chander et al., 2014; Jankelow et al., 2022). 2021a; Urbano and Ferreira, 2022). It should also be in the interest of Moreover, the matrices used for spiking in the present study swine producers worldwide to maintain surveillance of the disease in corresponded with those generally received at the VDL and at IRTA- the regions where it had been confined, since this would likely prevent CReSA for surveillance of ASFV or other pathogens. These included further outbreaks. samples that are routinely taken by veterinarians in the field or at Taken together, the results from the present study provide two slaughterhouses (serum and tonsils), as well as some obtained promising ASFV-LAMP tools (fluorometric and colorimetric) for the through minimally invasive methods that do not require a high surveillance of ASFV, with the potential to be implemented in various level of training to collect in the field (oral fluids and rectal swabs). field situations in a simple and practical way. The high analytical The ASFV-LAMP tests showed high performance in the great sensitivity and specificity of the ASFV-LAMP assays developed in this majority of matrices tested, suggesting that this strategy could be work suggest they might be highly valuable for their use in a laboratory applied in field conditions with minimal training. setting, while the relative easiness with which they can be performed It should be noted that the ASFV-LAMP PCR assay developed for the using minimal equipment means they can be implemented in field present study (using fluorometric and colorimetric detection) was designed conditions. The potential impact of the significant decrease in time to with the aim to be useful for detection of as many ASFV genotypes as detection afforded by these techniques, cannot be understated. The possible and proved to detect viral DNA from genotypes I and II. This is ASFV-LMAP-BG3 assay can be used as a primary screening test, to particularly important, considering that nearly all ASFV outbreaks since the take preliminary action (such as temporary quarantine) before reintroduction of the virus in Europe, Asia and the Caribbean have been definitive diagnosis with a more standardized diagnostic technique. related to genotype II strains (Ge et al., 2018; Gallardo et al., 2021; Mighell This could allow for faster implementation of the control protocols and and Ward, 2021). Additionally, genotype I has recently been found to be therefore lead to a reduced impact of a potential outbreak, with severe reemerging in China (Sun et al., 2021), making both of these genotypes implications in economic and animal welfare terms. highly important targets for surveillance in countries with large pork production. Notably, even though the ASFV-LAMP assays showed a similar analytical limit of detection to the reference qPCR methods, this Data availability statement seemed to be higher when testing viral DNA rather than plasmid DNA. This could be due to mutations in individual viral particles that may hinder primer The original contributions presented in the study are included in hybridization, which would only affect amplification at lower DNA the article/Supplementary Materials, further inquiries can be directed concentrations. Another possible explanation would be that the DNA to the corresponding author/s. extracted from plasmids, besides being more uniform, also had higher integrity after extraction. It has been shown that DNA integrity, influenced by the extraction method used, is a factor that may affect LAMP PCR results Ethics statement (Ablordey et al., 2021). This is in line with testing performed in our lab which showed that freezing-thawing of DNA samples increased the amplification The protocol had been approved by the Ethical Committee of the time by LAMP (Data not shown). Generalitat de Catalonia, Spain under the animal experimentation In any case, the lowest viral DNA concentration detected by the project number 11768. ASFV-LAMP assays (10 and 102.2 TCID50/ml, for genotypes I and II, respectively) was well within the values observed during ASFV experimental infections (Cabezó n et al., 2017; Lohse et al., 2022). Author contributions However, it also indicates that the efficiency of the LAMP tests, while very good, remains inferior to the reference qPCR tests, and should Conceptualization, LG. Methodology, JA, SL, RR, MP-S, MA, FR, therefore be considered as complementary to these techniques. In LG, and CM. Validation, JA, SL, RR, MP-S, MA, LG, and CM. Formal addition, the use of ASFV-LAMP testing should likely be limited to analysis, JA, LG, and CM. Resources, LG and CM. Data curation, JA, samples in which high viral DNA load is likely to be found, considering LG, and CM. Writing—original draft preparation, JA, SL, LG, and that samples corresponding with the highest qPCR Ct values, such as CM. Writing—review and editing, JA, SL, FR, LG, and CM. nasal swabs, showed the poorest performance in ASFV-LAMP. Visualization, JA. Supervision, LG and CM. Project administration, The capability of the ASFV-LAMP- BG3 tests to detect some of LG and CM. Funding acquisition, LG and CM. All authors the less common ASFV genotypes, which are mostly circulating solely contributed to the article and approved the submitted version. Frontiers in Cellular and Infection Microbiology 11 frontiersin.org Bohorquez et al. 10.3389/fcimb.2023.1114772 Funding Publisher’s note This research was funded by the National Animal Health All claims expressed in this article are solely those of the authors Laboratory Network from the United States Department of and do not necessarily represent those of their affiliated organizations, Agriculture under grant AP21VSD&B000C011 and partially by or those of the publisher, the editors and the reviewers. Any product the Spanish Science Ministry grant PID2019-107616RB-I00. that may be evaluated in this article, or claim that may be made by its 2020-2022. manufacturer, is not guaranteed or endorsed by the publisher. Conflict of interest Supplementary material The authors declare that the research was conducted in the The Supplementary Material for this article can be found online absence of any commercial or financial relationships that could be at: https://www.frontiersin.org/articles/10.3389/fcimb.2023.1114772/ construed as a potential conflict of interest. full#supplementary-material References Ablordey, A., Ahotor, E., Narh, C. A., King, S. A., Cruz, I., Ndung’u, J. M., et al. (2021). Gladue, D. P., and Borca, M. V. (2022). Recombinant ASF live attenuated virus strains Evaluation of different DNA extraction methods and loop-mediated isothermal as experimental vaccine candidates. Viruses 14, 878. doi: 10.3390/v14050878 amplification primers for the detection of mycobacterium ulcerans in clinical Gonzales, W., Moreno, C., Duran, U., Henao, N., Bencosme, M., Lora, P., et al. (2021). specimens. BMC Infect. Dis. 21, 1–8. doi: 10.1186/S12879-021-06308-Z/TABLES/6 African Swine fever in the Dominican republic. Transbound Emerg. Dis. 68, 3018–3019. Alonso, C., Borca, M., Dixon, L., Revilla, Y., Rodriguez, F., and Escribano, J. M. (2018). doi: 10.1111/TBED.14341 ICTV virus taxonomy profile: Asfarviridae. J. Gen. Virol. 99, 613–614. doi: 10.1099/ Hall, T. A. (1999). BioEdit: A user-friendly biological sequence alignment Editor and JGV.0.001049/CITE/REFWORKS analysis program for windows 95/98/NT. Nucleic Acids Symp. 41, 95–98. doi: 10.14601/ Borca, M. V., O’Donnell, V., Holinka, L. G., Risatti, G. R., Ramirez-Medina, E., Vuono, phytopathol_mediterr-14998u1.29 E. A., et al (2020). Deletion of CD2-like gene from the genome of African swine fever Inui, K., Gallardo, C., Portugal, R., Dixon, L., Baton, C., and Williams, D. (2022). The virus strain Georgia does not attenuate virulence in swine. Sci. Rep. 10, 494–502. OIE ASF reference laboratory network’s overview of African swine fever diagnostic tests for doi: 10.1038/s41598-020-57455-3 field application (World Organization for Animal Health (WOAH):Paris, France). Bosch-Camó s, L., Ló pez, E., Navas, M. J., Pina-Pedrero, S., Accensi, F., Correa-Fiz, F., Ito, S., Bosch, J., Martı́nez-Avilé s, M., and Sá nchez-Vizcaı́no, J. M. (2022). The et al. (2021). Identification of promiscuous African swine fever virus t-cell determinants evolution of African swine fever in China: A global threat? Front. Vet. Sci. 9. using a multiple technical approach. Vaccines 9, 1–20. doi: 10.3390/vaccines9010029 doi: 10.3389/fvets.2022.828498 Brown, V. R., Miller, R. S., McKee, S. C., Ernst, K. H., Didero, N. M., Maison, R. M., Jankelow, A. M., Lee, H., Wang, W., Hoang, T. H., Bacon, A., Sun, F., et al. (2022). et al. (2021). Risks of introduction and economic consequences associated with African Smartphone clip-on instrument and microfluidic processor for rapid sample-to-answer swine fever, classical swine fever and foot-and-mouth disease: A review of the literature. detection of zika virus in whole blood using spatial RT-LAMP. Analyst 147, 3838-3853. Transbound Emerg. Dis. 68, 1910–1965. doi: 10.1111/TBED.13919 doi: 10.1039/D2AN00438K Cabezó n, O., Muñoz-Gonzá lez, S., Colom-Cadena, A., Pérez-Simó , M., Rosell, R., Lavı́n, S., King, D. P., Reid, S. M., Hutchings, G. H., Grierson, S. S., Wilkinson, P. J., Dixon, L. K., et al. (2017). African Swine fever virus infection in classical swine fever subclinically infected et al. (2003). Development of a TaqMan® PCR assay with internal amplification control wild boars. BMC Vet. Res. 13, 227-238. doi: 10.1186/s12917-017-1150-0 for the detection of African swine fever virus. J. Virol. Methods 107, 53–61. doi: 10.1016/ Ceruti, A., Kobialka, R. M., Ssekitoleko, J., Okuni, J. B., Blome, S., Abd El Wahed, A., S0166-0934(02)00189-1 et al. (2021). Rapid extraction and detection of African swine fever virus DNA based on Knox, A., and Beddoe, T. (2021). Isothermal nucleic acid amplification technologies for isothermal recombinase polymerase amplification assay. Viruses 2021 13, 1731. the detection of equine viral pathogens. Anim. an Open Access J. MDPI 11, 2150-2172. doi: 10.3390/V13091731 doi: 10.3390/ANI11072150 Chander, Y., Koelbl, J., Puckett, J., Moser, M. J., Klingele, A. J., Liles, M. R., et al. (2014). Lohse, L., Nielsen, J., Uttenthal, Å., Olesen, A. S., Strandbygaard, B., Rasmussen, T. B., A novel thermostable polymerase for RNA and DNA loop-mediated isothermal et al. (2022). Experimental infections of pigs with African swine fever virus (Genotype II); amplification (LAMP). Front. Microbiol. 5. doi: 10.3389/FMICB.2014.00395/XML/NLM studies in young animals and pregnant sows. Viruses 2022 14, 1387. doi: 10.3390/ CISA-INIA (2021) Detection of African swine fever virus (ASFV) by real-time V14071387 polymerase chain reaction (PCR) (TaqMan probe ASF-VP72P1 or UPL commercial Lu, S., Lin, S., Zhang, H., Liang, L., and Shen, S. (2021). Methods of respiratory virus probe). Available at: http://www.fao.org/3/a- (Accessed September 29, 2022). detection: Advances towards point-of-Care for early intervention. Micromachines 12, 697- Costard, S., Mur, L., Lubroth, J., Sanchez-Vizcaino, J. M., and Pfeiffer, D. U. (2013). 716. doi: 10.3390/MI12060697 Epidemiology of African swine fever virus. Virus Res. 173, 191–197. doi: 10.1016/ Mee, P. T., Wong, S., O’riley, K. J., da Conceição, F., Jong, J. B., da, C., et al. (2020). Field j.virusres.2012.10.030 verification of an African swine fever virus loop-mediated isothermal amplification Costard, S., Wieland, B., De Glanville, W., Jori, F., Rowlands, R., Vosloo, W., et al. (LAMP) assay during an outbreak in timor-leste. Viruses 12, 1444-1460. doi: 10.3390/ (2009). African Swine fever: How can global spread be prevented? Philos. Trans. R. Soc B V12121444 Biol. Sci. 364, 2683–2696. doi: 10.1098/RSTB.2009.0098 Mighell, E., and Ward, M. P. (2021). African Swine fever spread across Asia 2018–2019. Ferná ndez-Pinero, J., Gallardo, C., Elizalde, M., Robles, A., Gó mez, C., Bishop, R., et al. Transbound Emerg. Dis. 68, 2722–2732. doi: 10.1111/TBED.14039 (2013). Molecular diagnosis of African swine fever by a new real-time PCR using universal Monteagudo, P. L., Lacasta, A., López, E., Bosch, L., Collado, J., and Pina-Pedrero, S. probe library. Transbound Emerg. Dis. 60, 48–58. doi: 10.1111/J.1865-1682.2012.01317.X (2017). BA71DCD2: a New Recombinant Live Attenuated African Swine Fever Virus with Frezal, C., Hubertus-Gay, S., and Nenert, C. (2021)The impact of the African swine Cross-Protective Capabilities. J. Virol. 91:e01058-17. doi: 10.1128/jvi.01058-17 fever outbreak in China on global agricultural markets. In: OECD FOOD, agric. fish. Available at: https://www.oecd.org/publications/the-impact-of-the-african-swine-fever- Mori, Y., Nagamine, K., Tomita, N., and Notomi, T. (2001). Detection of loop- outbreak-in-china-on-global-agricultural-markets-96d0410d-en.htm (Accessed July 1, mediated isothermal amplification reaction by turbidity derived from magnesium 2022). pyrophosphate formation. Biochem. Biophys. Res. Commun. 289, 150–154. doi: 10.1006/BBRC.2001.5921 Gallardo, C., Soler, A., Nurmoja, I., Cano-Gó mez, C., Cvetkova, S., Frant, M., et al. (2021). Dynamics of African swine fever virus (ASFV) infection in domestic pigs infected Mulumba-Mfumu, L. K., Saegerman, C., Dixon, L. K., Madimba, K. C., Kazadi, E., with virulent, moderate virulent and attenuated genotype II ASFV European isolates. Mukalakata, N. T., et al. (2019). African Swine fever: Update on Eastern, central and Transbound Emerg. Dis. 68, 2826–2841. doi: 10.1111/TBED.14222 southern Africa. Transbound Emerg. Dis. 66, 1462–1480. doi: 10.1111/TBED.13187 Ge, S., Li, J., Fan, X., Liu, F., Li, L., Wang, Q., et al. (2018). Molecular characterization of Nguyen-Thi, T., Pham-Thi-Ngoc, L., Nguyen-Ngoc, Q., Dang-Xuan, S., Lee, H. S., African swine fever virus, China 2018 - volume 24, number 11–November 2018 - Nguyen-Viet, H., et al. (2021). An assessment of the economic impacts of the 2019 African emerging infectious diseases journal - CDC. Emerg. Infect. Dis. 24, 2131–2133. swine fever outbreaks in Vietnam. Front. Vet. Sci. 8. doi: 10.3389/FVETS.2021.686038/ doi: 10.3201/EID2411.181274 BIBTEX Frontiers in Cellular and Infection Microbiology 12 frontiersin.org Bohorquez et al. 10.3389/fcimb.2023.1114772 Njau, E. P., Machuka, E. M., Cleaveland, S., Shirima, G. M., Kusiluka, L. J., Okoth, E. A., contamination in feed ingredients and risk of introduction into the united states. et al. (2021). African Swine fever virus (ASFV): Biology, genomics and genotypes Transbound Emerg. Dis. 69, 157–175. doi: 10.1111/tbed.14358 circulating in Sub-Saharan Africa. Viruses 13, 2285-2301. doi: 10.3390/V13112285 Stepien, M., and Cole, L. (2021) USDA Statement on confirmation of African swine fever Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., in Haiti (USDA). Available at: https://www.aphis.usda.gov/aphis/newsroom/news/sa_by_ et al. (2000). Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, e63. date/sa-2021/asf-confirm (Accessed June 22, 2022). doi: 10.1093/NAR/28.12.E63 Sun, E., Huang, L., Zhang, X., Zhang, J., Shen, D., Zhang, Z., et al. (2021). Genotype I Parida, M. M., Sannarangaiah, S., Dash, P. K., Rao, P. V. L., and Morita, K. (2008). Loop African swine fever viruses emerged in domestic pigs in China and caused chronic mediated isothermal amplification (LAMP): A new generation of innovative gene infection. Emerg. Microbes Infect. 10, 2183. doi: 10.1080/22221751.2021.1999779 amplification technique; perspectives in clinical diagnosis of infectious diseases. Rev. Tanner, N. A., Zhang, Y., and Evans, T. C. (2015). Visual detection of isothermal Med. Virol. 18, 407. doi: 10.1002/RMV.593 nucleic acid amplification using pH-sensitive dyes. Biotechniques 58, 59–68. doi: 10.2144/ Pietschmann, J., Mur, L., Blome, S., Beer, M., Pé rez-Sá nchez, R., Oleaga, A., et al. 000114253/ (2016). African Swine fever virus transmission cycles in central Europe: Evaluation of wild Tulman, E. R., Delhon, G. A., Ku, B. K., and Rock, D. L. (2009). African Swine fever boar-soft tick contacts through detection of antibodies against ornithodoros erraticus virus. Curr. Top. Microbiol. Immunol. 328, 43–87. doi: 10.1007/978-3-540-68618-7_2/ saliva antigen. BMC Vet. Res. 12, 1-5. doi: 10.1186/s12917-015-0629-9 COVER/ Qu, H., Ge, S., Zhang, Y., Wu, X., and Wang, Z. (2022). A systematic review of Urbano, A. C., and Ferreira, F. (2022). African Swine fever control and prevention: An genotypes and serogroups of African swine fever virus. Virus Genes 58, 77–87. update on vaccine development. Emerg. Microbes Infect. 11, 2021–2033. doi: 10.1080/ doi: 10.1007/S11262-021-01879-0/FIGURES/2 22221751.2022.2108342 Rademacher, C., Brown, J., and Karriker, L. (2022). Impact of human behavior on the Wang, Y., Dai, J., Liu, Y., Yang, J., Hou, Q., Ou, Y., et al. (2021a). Development of a spread of African swine fever virus: What every veterinarian should know. J. Am. Vet. potential penside colorimetric LAMP assay using neutral red for detection of African Med. Assoc. 260, 1413–1417. doi: 10.2460/JAVMA.22.06.0250 swine fever virus. Front. Microbiol. 12. doi: 10.3389/FMICB.2021.609821/BIBTEX Ramirez-Medina, E., O’Donnell, V., Silva, E., Espinoza, N., Velazquez-Salinas, L., Wang, Y., Kang, W., Yang, W., Zhang, J., Li, D., and Zheng, H. (2021b). Structure of African Moran, K., et al. (2022). Experimental infection of domestic pigs with an African swine swine fever virus and associated molecular mechanisms underlying infection and fever virus field strain isolated in 2021 from the Dominican republic. Viruses 2022 14, immunosuppression: A review. Front. Immunol. 12. doi: 10.3389/FIMMU.2021.715582/BIBTEX 1090. doi: 10.3390/V14051090 Weaver, T. R. D., and Habib, N. (2020)Evaluating losses associated with African swine Reed, L. J., and Muench, H. (1938). A simple method of estimating fifty per cent fever in the people’s republic of China and neighboring countries. In: ADB East Asia work. endpoints. Am. Jounal Hyg. 27, 493–497. pap. ser. Available at: https://www.adb.org/publications/losses-african-swine-fever-prc- Rowlands, R. J., Michaud, V., Heath, L., Hutchings, G., Oura, C., Vosloo, W., et al. neighboring-countries (Accessed July 1, 2022). (2008). African Swine fever virus isolate, Georgia 2007. Emerg. Infect. Dis. 14, 1870–1874. World organisation for animal health (2019a)Chapter 15.1 infection with African doi: 10.3201/EID1412.080591 swine fever virus. In: Terrestrial animal health code. Available at: http://www.oie.int/ Sakthivel, D., Delgado-Diaz, D., McArthur, L., Hopper, W., Richards, J. S., and Narh, C. fileadmin/Home/eng/Health_standards/tahc/current/chapitre_asf.pdf (Accessed A. (2021). Point-of-Care diagnostic tools for surveillance of SARS-CoV-2 infections. February 1, 2021). Front. Public Heal. 9. doi: 10.3389/FPUBH.2021.766871 World organisation for animal health (2019b). “Chapter 3.8.1 African swine fever Sauter-Louis, C., Conraths, F. J., Probst, C., Blohm, U., Schulz, K., Sehl, J., et al. (2021a). (Infection with African swine fever virus),” in Manual of diagnostic tests and vaccines for African Swine fever in wild boar in Europe–a review. Viruses 2021 13, 1717. doi: 10.3390/ terrestrial animals (Paris, France: World Organisation for Animal Health), 1–8. V13091717 Yang, L., Wang, L., Lv, M., Sun, Y., and Cao, J. (2022). Clinical validation of DNA Sauter-Louis, C., Forth, J. H., Probst, C., Staubach, C., Hlinak, A., Rudovsky, A., et al. extraction-free qPCR, visual LAMP, and fluorescent LAMP assays for the rapid detection (2021b). Joining the club: First detection of African swine fever in wild boar in Germany. of African swine fever virus. Life 12, 1067. doi: 10.3390/life12071067 Transbound Emerg. Dis. 68, 1744–1752. doi: 10.1111/TBED.13890 Zsak, L., Borca, M. V., Risatti, G. R., Zsak, A., French, R. A., Lu, Z., et al. (2005). Schambow, R. A., Sampedro, F., Urriola, P. E., van de Ligt, J. L. G., Perez, A., and Preclinical diagnosis of African swine fever in contact-exposed swine by a real-time PCR Shurson, G. C. (2022). Rethinking the uncertainty of African swine fever virus assay. J. Clin. Microbiol. 43, 112–119. doi: 10.1128/JCM.43.1.112-119.2005 Frontiers in Cellular and Infection Microbiology 13 frontiersin.org