International Journal of Molecular Sciences Article Obtaining miRNA from Saliva—Comparison of Sampling and Purification Methods Aintzane Urbizu 1 , Laura Arnaldo 1,2 and Katrin Beyer 1,2, * 1 Department of Pathology, Germans Trias i Pujol Research Institute (IGTP), 08916 Badalona, Spain 2 Department of Biochemistry, Universitat Autònoma de Barcelona, 08193 Barcelona, Spain * Correspondence: kbeyer@igtp.cat Abstract: The use of saliva as a biomarker source has advantages over other biofluids and imaging techniques, and miRNAs are ideal biomarker candidates. They are involved in numerous cellular processes, and their altered expression suggests that miRNAs play a crucial regulatory role in disease development. We wanted to find an easily reproducible and executable miRNA-obtaining methodol- ogy suitable for quantification. Three commercial miRNA extraction kits (mirVana, Nucleospin and miRNeasy) and three saliva collectors (50 mL tubes, Salimetrics and Oragene) were tested. Several features, including RNA quality and technical parameters, were evaluated. The expression of five synthetic spike-in controls and seven saliva-miRNAs was analyzed independently and grouped by the collectors and the extraction kits. The combination of Oragene and miRNeasy assured the most sensitive detection of all seven saliva miRNAs. Testing different combinations of saliva collectors and RNA purification kits permitted the establishment of combinations for different uses. The results of our study highlight that optimization of resources for biomarker studies is possible after careful planning of each study. Keywords: miRNAs; saliva biomarker; purification methods; miRNA quantification 1. Introduction Citation: Urbizu, A.; Arnaldo, L.; Non-coding RNAs (ncRNA) are RNA molecules that are not translated into a protein. Beyer, K. Obtaining miRNA from ncRNAs are divided into small ncRNAs (<200 nt) that include miRNAs, piRNAs, snoRNAs; Saliva—Comparison of Sampling and long ncRNAs (lncRNA) (>200 nt). miRNAs, in particular, have a length average of and Purification Methods. Int. J. Mol. 22 nt and play important roles in regulating gene expression by affecting the translation Sci. 2023, 24, 2386. https:// and stability of their mRNA targets through binding to the 30 untranslated region (UTR) doi.org/10.3390/ijms24032386 in most cases, although interacting with 50 UTRs, coding sequences and gene promoters Academic Editors: Omar Cauli and have also been reported [1]. Mature miRNAs can interact with their target RNAs in Juan Gambini subcellular locations, or be secreted into extracellular fluids, such as plasma and serum, cerebrospinal fluid, saliva, breast milk, urine, tears or peritoneal fluid. They can also be Received: 30 November 2022 transported to target cells via extracellular vesicles (exosomes) or by binding to proteins Revised: 20 January 2023 such as argonaute-2, nucleophosmin-1 and high-density lipoprotein [1,2]. Accepted: 22 January 2023 miRNAs are involved in numerous cellular processes in different tissues and organs, Published: 25 January 2023 including cell proliferation, differentiation, apoptosis, energy balance, metabolic homeosta- sis, inflammation, angiogenesis and DNA repair. Altered expression of certain miRNAs suggests that they could have a crucial regulatory function in disease development [3]. Copyright: © 2023 by the authors. Therefore, extracellular miRNAs might represent useful biomarkers for a variety of dis- Licensee MDPI, Basel, Switzerland. orders such as cancer, epilepsy or neurodegenerative, autoimmune and mitochondrial This article is an open access article diseases [2]. In fact, in the last decade numerous studies have focused on the identification distributed under the terms and of miRNAs as blood, serum, CSF or saliva biomarkers to facilitate disease diagnosis and conditions of the Creative Commons monitoring, including treatment response. However, the lack of reproducibility of the Attribution (CC BY) license (https:// findings indicates that the use of miRNAs as biomarkers is still in its early stages [2]. creativecommons.org/licenses/by/ Factors such as ageing can directly affect and modulate miRNA expression levels. 4.0/). The expression of miRNAs found in biological fluids, called circulatory miRNAs, might Int. J. Mol. Sci. 2023, 24, 2386. https://doi.org/10.3390/ijms24032386 https://www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2023, 24, 2386 2 of 20 correlate with aging and lifespan in humans. Since circulatory miRNAs can be easily obtained, they could be used as noninvasive biomarkers of aging and for tracking individual decline [4]. In plasma, three ageing peaks producing significant changes in the metabolome and transcriptome have been described to occur around the ages of 34, 60 and 75 [5]. Correspondingly, a signature of decreased miRNAs was identified in individuals older than 60 years compared to individuals 30 years of age, leading to an increased expression of ageing-related gene sets [6]. Another modifying factor of miRNA expression in biofluids is the circadian rhythm. In this context, defined miRNA sets showing consistent diurnal oscillation have been identified in both human plasma and saliva and have been denominated CircaMiRs [7,8]. Because miRNAs regulate the majority of human genes, a considerable number of circadian genes are now thought to be directly regulated by miRNAs [9]. Finally, lifestyle and environmental factors have also been shown to exert a direct influence on miRNA expression. Among several factors, long-term exercise significantly alters the profiles of plasma miRNAs [10], and both aerobic and resistance-based exercise induces miRNA expression changes [11]. When analyzing the role of tobacco in fetal growth, specific miRNAs were identified to reduce growth when smoking during pregnancy [12]. Specifically, in saliva, the transcriptome of the microbiome represents an elevated per- centage of total RNA with pronounced inter-individual heterogeneity [13]. The higher the RNA content corresponding to the microbiome, the higher the masking rate of expression data [13,14]. The use of saliva as a biomarker source has advantages over other biofluids and imaging techniques because its collection is noninvasive, inexpensive and requires minimal personnel training [15–17]. Saliva is an ultrafiltrate of blood plasma and therefore mirrors systemic processes, mainly via extracellular vesicles, including exosomes [13,14]. The latter are excreted from virtually all organs and carry information on ongoing pathological changes in the organism [18,19]. However, few studies have explored the utility of saliva miRNAs as disease biomark- ers. One of the reasons could be the lack of specific commercial kits to extract miRNA from saliva, so the protocols of other extraction kits have to be adjusted [20,21]. Furthermore, since there are no standardized protocols for sample collection, storage or methodology, every researcher uses the most convenient method. Therefore, the implementation of each step described in the literature has several possible outcomes, without evidence of which is the best option. To overcome this issue, we wanted to determine which methodology for whole saliva miRNA obtaining samples suitable for quantification is easily reproducible and executable. Therefore, we tested and compared three different commercial miRNA extraction kits in combination with three different saliva collectors to determine the most suited protocol regarding efficiency, time and cost to be considered for future studies. 2. Results The schematic representation of the study, starting with the collection of samples until miRNA quantification, is illustrated in Figure 1. Int. Int.J.J.Mol. Mol.Sci. 2023,24, Sci.2023, 24,2386 x FOR PEER REVIEW 33 of of 20 19 Figure 1. Scheme of the study. In sequential order, from top to bottom, saliva collection (three different collectors, (A) 50 mL tubes, (B) Salimetrics, (C) Oragene), RNA extraction (three different kits, I. mirVana, II. Nucleospin, III. miRNeasy), DNase treatment (RNA samples purified with I. mirVana, II. Nucleospin), cDNA synthesis (for 1 h at 42 ◦ C), miRNA quantification on a real-time PCR machine. Created in BioRender.com, accessed on 29 November 2022. 2.1. Saliva Collectors FigureThree different 1. Scheme saliva of the collectors study. were order, In sequential tested,from Oragene top toRNA collection bottom, tubes (Oragene), saliva collection (three dif- Salimetrics 2 mL ferent collectors, (A)cryovials (Salimetrics) 50 mL tubes, and(C) (B) Salimetrics, 50Oragene), mL sterile RNA conical tubes extraction (50 different (three mL tubes).kits, Regarding I. mirVana, the saliva collection II. Nucleospin, procedure, III. miRNeasy), DNasethree of the (RNA treatment five volunteers reported samples purified withmajor I. mir- Vana, II. Nucleospin), difficulty in collectingcDNAsalivasynthesis into the(for 1 h at 42 °C), Salimetrics miRNAalthough collector, quantification on a real-time it included the SalivaPCR machine. Created Collector in BioRender.com. aid specifically designed for that use. Oragene saliva collectors were the most expensive. The use of 50 mL tubes represents only 2.5% of the cost of Salimetrics collectors, 2.1.12.5% or SalivaofCollectors the cost of Oragene collectors. When taking into account the three saliva collectors, Threealthough different50saliva mL tubes and Salimetrics collectors tubesOragene were tested, are processed RNAorcollection stored immediately tubes (Or- agene), Salimetrics 2 mL cryovials (Salimetrics) and 50 mL sterile conical tubes (50 mL tubes). Regarding the saliva collection procedure, three of the five volunteers reported Int. J. Mol. Sci. 2023, 24, 2386 4 of 20 after saliva obtaining, the Oragene collector has to be incubated before processing at 50 ◦ C for one hour in a water bath, or two hours in an air incubator. 2.2. miRNA Extraction Kits Three different kits were used, the mirVana miRNA isolation kit (MV kit), the NucleoSpin®® miRNA Plasma kit (NS kit) and the miRNeasy Serum/Plasma Advanced Kit (MR kit). Regarding the time cost of the miRNA extraction protocol, the three RNA purification kits used a similar amount of time, approximately 1.5 h, for the processing of two or three samples. Regarding the economic cost, MV was the most expensive kit, allowing users to process only 20 samples. However, MV is the only kit that allowed the obtaining of total RNA and small RNAs in separated fractions. In comparison, the cost of MR, including the DNase kit, would be approximately 60% of the cost of MV, and NS, also including the DNase kit, would be 40% of the cost of MV. As a result, the most economical combination would consist of using 50 mL tubes with the NS kit, and the most expensive would be using Oragene collectors and the MV kit. 2.3. RNA Extraction 2.3.1. Total RNA Amount Total RNA was extracted using three different kits in combination with three different saliva collectors from 15 samples. Whereas for the NS and MR kits only total RNA samples were obtained, the MV kit could purify a separate fraction of small RNAs leading to 60 miRNA/total RNA samples (Table S1). When comparing the saliva collectors, the RNA amount obtained using Oragene collectors, independently of the miRNA extraction kit was significantly higher than with the other collectors (10.01 µg for Oragene vs. 4.31 µg for 50 mL tubes and 2.05 µg for Salimetrics, p < 0.002). The RNA amounts obtained using NS and MR in combination with Oragene were strikingly higher than those obtained with the same kits but in combination with either 50mL tubes or Salimetrics (Figure 2A, Table S1). In fact, the combination of Oragene and NS allowed us to obtain the highest amount of total RNA, 5003 ng. When comparing miRNA extraction kits, no significant differences were observed in the total RNA amounts (p > 0.05). However, the use of the MV kit resulted in obtaining an elevated amount of total RNA in combination with all three collectors: 2914 ng with 50 mL tubes, 1311 ng with Salimetrics and 2365 ng with Oragene. These amounts were significantly higher when combined with Oragene or the 50 mL tube in comparison with the NS and MR combined with the 50 mL tube or Salimetrics (Figure 2A, Supplementary Materials Table S2). The RNA amounts obtained with the NS kit were 825 ng with 50 mL tubes, 340 ng with Salimetrics and 5003 ng with Oragene; and with the MR kit, 575 ng with 50 mL tubes, 402 ng with Salimetrics, and 2636 ng with Oragene (Figure 2A). 2.3.2. Efficiency Oragene seemed to be the most efficient collector of RNA (4.89 ng/µL, Oragene vs. 2.57 ng/µL, 50 mL tube and 1.22 ng/µL, Salimetrics; p < 0.002) and MV the most efficient kit (2.82 ng/µL, MV vs. 2.28 ng/µL, NS and 2.00 ng/µL, MR; p < 0.05). In fact, as with the total RNA amount, the use of the MV was significantly more efficient when combined with Oragene or the 50 mL tube in comparison with the NS and MR combined with 50mL tubes or Salimetrics (Figure 2B, Table S1). The combinations of 50mL tubes and MV, and Oragene and NS gave the most total RNA (including miRNAs) per µL of saliva: 5.83 and 5.56 ng/µL, respectively. Similar efficiencies were obtained using Oragene in combination with either MV or MR: 4.73 and 4.39 ng/µL, respectively (Figure 2B, Table S3). nt. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW Int. J. Mol. Sci. 2023, 24, 2386 5 of 20 Figure 2. RNA purification amount and efficiency. Vertical bar chart shows the comparison between the combination of the three saliva collectors (50 mL tube, Salimetrics and Oragene) with three Figure 2. RNA kits, miRNA extraction purification MV (mirVana amount and efficiency. miRNA isolation VerticalmiRNA kit), NS (Nucleospin bar chart Plasmashows the comp kit), MR the combination (miRNeasy of the Serum/Plasma three saliva Advanced kit). (A) collectors (50RNA Amount of total mL (intube, Salimetrics ng) isolated and Orage from whole saliva. (B) RNA miRNA extraction extraction efficiency kits, MV (ng of total RNA (mirVana per µL of miRNA saliva used). isolation Dashed kit), lines represent miRN NS (Nucleospin significant differences (p < 0.025). MR (miRNeasy Serum/Plasma Advanced kit). (A) Amount of total RNA (in ng) isola saliva. (B) RNA extraction efficiency (ng of total RNA per µL of saliva used). Dashed significant differences (p < 0.025). 2.3.2. Efficiency Oragene seemed to be the most efficient collector of RNA (4.89 ng/L Int. J. Mol.Int. Sci.J.2023, Mol. 24, Sci.x2023, FOR 24, PEER REVIEW 2386 6 of 19 6 of 20 2.3.3. Purity 2.3.3. Purity The purityTheofpurity the RNA samples of the RNAwas addressed samples after measuring was addressed the absorbance after measuring at 260 the absorbance at nm and 260 280 nm nm.and RNA 280samples nm. RNA obtained withobtained samples the MR kit withhadthethe MRhighest purity kit had as deter-purity as the highest mined by the A260/A280 determined ratio, by the independent A260/A280 ratio,ofindependent the collectoroftube. When using the collector 50mL tube. Whentubes, using 50mL tubes, 80% of the RNA 80% of thehad samples RNA samples ratios had1.8 between ratios andbetween 2.1, when1.8 and Salimetrics, using 2.1, when using Salimetrics, 50% and 60% when50% and Oragene using 60% when usingS1). (Table Oragene (Table S1). 2.4. DNA 2.4. DNA Contamination Contamination Although Although NS and NSMRandkitsMR kits include include a DNasea treatment DNase treatment step in thestepprotocol, in the protocol, agarose agarose gel electrophoresis performed after reverse transcription and amplification gel electrophoresis performed after reverse transcription and amplification of the SNP of the SNP rs2736990 and the non-coding mtDNA region showed the presence rs2736990 and the non-coding mtDNA region showed the presence of DNA in miRNA of DNA in miRNA and total RNA samples obtained by the MV and the NS kits, independent and total RNA samples obtained by the MV and the NS kits, independent of the saliva of the saliva collector collectorused. used.InInnone noneofofthe theRNA RNAsamples samplesobtained obtainedwith withthe MR the MR kit, kit,was wasDNA DNA detected (Figure 3). detected (Figure 3). An additional post-purification DNase treatment performed for samples ob-with the An additional post-purification DNase treatment performed for samples obtained NS and tained with MVand the NS kitsMV removed all remaining kits removed DNA (Figure all remaining DNA 3).(Figure 3). Figure 3. DNA contamination. 1.5% agarose gels showing the purity of the RNA obtained from the Figure 3. DNA contamination. 1.5% agarose gels showing the purity of the RNA obtained from the different combinations of saliva collectors (50 mL tube, Salimetrics and Oragene) with the miRNA extractiondifferent kits (MV,combinations of saliva Ambion mirVana collectors miRNA (50 mL isolation tube, kit; NS, SalimetricsmiRNA Nucleospin and Oragene) withMR, Plasma kit; the miRNA miRNeasy Serum/Plasma Advanced kit) before and after DNase treatment. Amplification of an in- kit; MR, extraction kits (MV, Ambion mirVana miRNA isolation kit; NS, Nucleospin miRNA Plasma tronic SNPmiRNeasy of SNCASerum/Plasma gene (280 bp) andAdvanced kit) before a non-coding and after (mtDNA) mitochondrial DNase treatment. Amplification region (623 bp) indi- of an intronic cates presence SNP of of DNA in SNCA geneacid the nucleic (280 bp) and aInnon-coding extraction. mitochondrial each reaction, (mtDNA) a positive (PC) region (623 bp) and a negative control (NC) were presence indicates included. of DNA in the nucleic acid extraction. In each reaction, a positive (PC) and a negative control (NC) were included. No significant differences were observed between miRNA expression levels in pre- No significant and post-DNase-treated differences were observed between miRNA expression levels in pre- samples. and post-DNase-treated samples. 2.5. miRNA Quantification 2.5. miRNA Quantification 2.5.1. Synthetic Spike-In Standards 2.5.1. Synthetic Spike-In Standards The expression levels of UniSp3 and UniSp6 were constant, as observed with quan- The expression levels of UniSp3 and UniSp6 were constant, as observed with quan- tification cycle (Cq) values around 18, indicating reverse transcription reaction and qPCR tification cycle (Cq) values around 18, indicating reverse transcription reaction and qPCR worked correctly (Table S4). As expected, UniSp2, UniSp4 and UniSp5 presented different worked correctly (Table S4). As expected, UniSp2, UniSp4 and UniSp5 presented different expression levels, on the one hand, due to their different concentrations and on the other, expression levels, on the one hand, due to their different concentrations and on the other, due to the different extraction efficiencies. UniSp2, as the most concentrated synthetic con- due to the different extraction efficiencies. UniSp2, as the most concentrated synthetic trol, representing high expression, control, representing was detected high expression, wasbetween detected 23–28 cycles; between 23–28UniSp4 cycles; between UniSp4 between 30–36 cycles; and UniSp5, the most diluted and representing low expression, when 30–36 cycles; and UniSp5, the most diluted and representing low expression, when de-detected tected ititwas wasbetween betweenaround around36–39 36–39cycles cycles(Figure (Figure4). 4). Int. Int. J. J. Mol. Mol. Sci. Sci. 2023,2023, 24, x FOR PEER REVIEW 24, 2386 7 of7 20 of 19 Figure Figure 4. MiRNA 4. MiRNA expression expression levels levels are are shown shown forspike-in for all all spike-in standards standards andand hsa-miRNAs hsa-miRNAs included included in the study. (A): UniSp2 and hsa-miRNA with high expression, (B): UniSp5 and hsa-miRNA withwith in the study. (A): UniSp2 and hsa-miRNA with high expression, (B): UniSp5 and hsa-miRNA lowlow expression, expression, (C):(C): UniSp4 UniSp4 andand hsa-miRNAs hsa-miRNAs withwith intermediate intermediate expression. expression. Dashed Dashed lines lines represent represent the most significant differences, p < 0.001. the most significant differences, p < 0.001. WhenWhen comparing comparing thethe saliva saliva collectors, collectors, in general, in general, Salimetrics Salimetrics collectors collectors yielded yielded the the highest expression corresponding to the lowest Cq values for concentrated highest expression corresponding to the lowest Cq values for concentrated spike-ins UniSp2 spike-ins andUniSp2 UniSp4,and UniSp4, being being statistically statistically significant forsignificant the latterfor the (p < latter(Figure 0.001) (p < 0.001) 4A,C); (Figure 4A,C); however, thehowever, the useallowed use of Oragene of Oragene allowed to obtain to obtain constant constantdata expression expression for the data for spike-in diluted the diluted spike-in UniSp5 UniSp5 (Figure (Figure 4B, Table 1).4B, WhenTable 1). When comparing comparing the extraction the kits, extraction kits, significant significant differencesdif- wereferences were observed observed among them among themspike-ins for the three for the three spike-ins (p < 0.001 (p < 0.001 for UniSp2, p 30 ) Length (bp) Cycles Temp/Time Temp/Time Temp/Time rs2736990 PrU TGGCAGTTGAGAGGAGTATTC 280 95 ◦ C/4000 62 ◦ C/3000 72 ◦ C/5000 35 rs2736990 PrL GTGACTAGCAGATGATGAGCA L2-16485 GAACTGTATCCGACATCTGG 560 94 ◦ C/6000 55 ◦ C/4000 72 ◦ C/6000 35 H2-481 GATTAGTAGTATGGGAGTGG An additional DNase treatment was performed on those samples that contained DNA using the DNA-freeTM DNA Removal Kit (ThermoFisher) following the manufacturer’s instructions. After re-quantification of RNAs reverse transcription and amplification of rs2736990 and mtDNA were repeated. 4.6. Synthetic RNA Spike-In In order to provide a control for the quality of the RNA isolation, miRNA cDNA synthesis and quantification, RNA spike-ins were added to the sample: (1) prior to RNA isolation: UniSp2, UniSp4 and UniSp5 were provided pre-mixed in one vial, each at a different concentration with 100-fold increments (miRCURY LNA RNA Spike-In Kit, Qiagen). One µL RNA spike-in mix was added to the lysis buffer before adding the sample (see detailed in Appendix A); (2) prior to cDNA synthesis: UniSp6 (miRCURY LNA RT Kit, Qiagen), 0.5 µL was added to the reverse transcription reaction; and (3) miRNA quantification: UniSp3 contained in the miRCURY®® LNA®® SYBR®® Green PCR Kit (Qiagen) is used as inter-plate calibrator. Int. J. Mol. Sci. 2023, 24, 2386 15 of 20 4.7. miRNA Quantification Hsa-miRNAs and synthetic spike-in controls included in this study are listed in Table 5. In total, seven miRNAs previously reported to be expressed in saliva with possibly different levels [23] were selected to test the different miRNA extraction methods: (1) high expression miRNAs detectable between 19–24 cycles: hsa-miR-191-5p and hsa-miR-223-3p; (2) intermediate-expression miRNAs detectable between 24–30 cycles: hsa-miR-24-3p and hsa-miR-26b-5p, which have been also recommended as housekeeping miRNAs in saliva in a cancer-related study [36]; (3) low expression miRNAs detectable between 30–32 cycles: hsa-miR-30c-5p and hsa-miR-375-3p; and (4) hsa-miR-27a-3p as a reference for Parkinson’s disease [37]. Table 5. Hsa-miRNA sequences and synthetic spike-in controls analyzed in this study. Cat. Nº miRNA ID Target Sequence MiRCury Assay 1 YP00205986 hsa-miR-223-3p UGUCAGUUUGUCAAAUACCCCA 2 YP00204260 hsa-miR-24-3p UGGCUCAGUUCAGCAGGAACAG 3 YP00204306 hsa-miR-191-5p CAACGGAAUCCCAAAAGCAGCUG 4 YP00204783 hsa-miR-30c-5p UGUAAACAUCCUACACUCUCAGC 5 YP00204362 hsa-miR-375-3p UUUGUUCGUUCGGCUCGCGUGA 6 YP00206038 hsa-miR-27a-3p UUCACAGUGGCUAAGUUCCGC 7 YP00204117 hsa-miR-26b-5p CCUGUUCUCCAUUACUUGGCUC 8 YP00203950 UniSp2 9 YP00203953 UniSp4 10 YP00203955 UniSp5 11 YP02119288 UniSp3 12 YP00203954 UniSp6 Expression of miRNAs was quantified by miRCURY®® LNA®® miRNA Custom Pan- els (Qiagen) using a LightCycler 480 instrument (Roche Diagnostics, Mannheim, Germany). Ten ng of either total RNA or miRNA (obtained by mirVana, Thermo Fisher, Vilnius, Lithua- nia) were reversely transcribed following the manufacturer instructions of the miRCURY LNA Universal RT miRNA SYBR®® Green PCR-kit (Qiagen). cDNAs were amplified as de- scribed by manufacturer using the miRCURY®® LNA®® SYBR®® Green PCR- kit (Qiagen). DNA was used as a negative control to assure miRNA quantification only. To account for inter- and intra-run variations, all experiments were performed in technical duplicates and UniSp3 was used as an interplate calibrator. Raw quantification cycles (Cq) were obtained by the LightCycler software. Cq of 40 or higher were considered as no-expression. 4.8. Data Analysis Samples were analyzed in nine different groups according to the different combina- tions of collectors and extraction kits. To test differences in the amount and efficiency of extracted RNA between the different collectors or the different RNA extraction kits, one-way and two-way ANOVA tests were performed. Wilcoxon Signed Rank Test was applied to compare all combinations. Cq data were normalized using spike-in 3 and 6. Since the normal distribution of the data cannot be guaranteed, the Wilcoxon Signed Rank test was performed for the analysis of normalized Cq in pre-treated samples compared with DNase-treated samples, and of miRNA and spike-in 2, 4 and 5 expression comparing groups of collectors, extraction kits Int. J. Mol. Sci. 2023, 24, 2386 16 of 20 and both. Additionally, when data from all samples obtained with the same collector or the same extraction kit were grouped, Cq-values were normalized using the group mean. p-values less than 0.05 were considered as significant. However, when groups were defined considering both variables (collectors and extraction kits) together, the p-value was corrected for multiple comparison testing, and significance was established as significant at p < 0.025. All the statistical analyses were performed using R software (R Core Team 2021), version 3.6.1 for Windows. 5. Conclusions The testing of different combinations of saliva collectors and RNA purification kits permitted identification of combinations for different uses. Whereas the MV kit obtains small RNAs in an independent fraction, low expressing miRNAs could be reliably detected using the combination of the Oragene collector and the MR kit. The quantification of highly expressing miRNAs within a well-defined study can be carried out in an inexpensive combination of 50 mL tube collectors and the NS kit. Thus, identifying the scope of each study and taking into account the expected outcome will make it easy to decide which methodology is best to be used. Supplementary Materials: The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24032386/s1. Author Contributions: Conceptualization, K.B. and A.U.; methodology, A.U. and L.A.; formal analysis, L.A.; resources, K.B.; writing—original draft preparation, A.U.; writing—review and editing, K.B.; project administration, K.B.; funding acquisition, K.B. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by Spain’s Ministry of Science and Innovation, grant number PI18/00276 and PI21/00833, integrated in the National R + D + I and funded by the ISCIII and the European Regional Development Fund. Institutional Review Board Statement: The study was conducted in accordance with the Declaration of Helsinki, and approved by the Institutional Ethics Committee of the University Hospital Germans Trias i Pujol. Informed Consent Statement: Informed consent was obtained from all subjects involved in the study. Data Availability Statement: Additional data can be requested from the corresponding author of this study. Acknowledgments: The authors express their gratitude to the volunteers for their cooperation and contributions. Laura Arnaldo is a PhD student attached to the Biochemistry, Molecular Biology and Biomedicine PhD Programme at the Universitat Autònoma de Barcelona (UAB). Conflicts of Interest: The authors declare no conflict of interest. Appendix A miRNA isolation using the Ambion mirVana miRNA Isolation Kit 1. Thaw the frozen samples (if saliva was collected by Oragene collector, incubate the entire sample in the original vial at 50 ◦ C for 2 h in an air incubator). 2. Add 1 µL Spike-in to 600 µL Lysis Buffer and mix by pipetting. 3. Add the mix of Lysis Buffer with Spike-in to 500 µL of saliva sample. 4. Add 50 µL of miRNA Homogenate Additive (1/10 volume), mix well by inverting the tubes several times. 5. Leave the mixture on ice for 10 min. During this time, prepare two new 1.5 mL tubes. 6. Split the sample to the new tubes (around 550 µL in each tube) and add 500 µL (250 µL in each tube) of Acid-Phenol:Chloroform (a volume that is equal to the volume before addition of the Homogenate Additive). 7. Vortex for 1 min and centrifuge for 10 min at max speed. Int. J. Mol. Sci. 2023, 24, 2386 17 of 20 8. Transfer the supernatant to new fresh tubes. At this point put in DEPC-treated water at 95 ◦ C for use in eluting the RNA from the filter at the end of procedure. 9. Add 1/3 volume room temperature 100% EtOH to the aqueous phase, invert tubes several times to mix. 10. Place a filter cartridge into collection tube, pipet the mixture from the previous step onto the filter cartridge (up to 700 µL). 11. Centrifuge for approx. 15 s at min. 10,000× g, collect the filtrate (contains the miRNA). 12. Add 2/3 volume room temperature 100% EtOH to the filtrate, mix throughly. 13. Place a new cartridge into collection tube and pipette the filtrate/EtOH mixture onto a second filter cartridge. 14. Centrifuge for around 15 s at equal or less than 10,000× g, discard the flow-through, and reuse the collection tube for the washing steps. 15. Add 700 µL of Washing Solution 1 to the filter cartridge and centrifuge for around 5–10 s at equal or less than 10,000× g. Discard the through-flow, reuse the collection tube. 16. Add 500 µL of Washing Solution 2/3, centrifuge for 5–10 s at equal or less than 10,000× g. 17. Repeat with a second 500 µL of Washing Solution 2/3. 18. After discarding the flow-through, replace the filter in the same collection tube and spin for 1 min to remove residual liquid from the filter. 19. Transfer the filter into a new collection tube and apply 20 µL of pre-heated (60 ◦ C) water to the center of the filter. Spin 1 min at max speed. 20. Store collected miRNA at −20 ◦ C. miRNA isolation using the miRNeasy Serum/Plasma Advanced kit 1. Thaw the frozen samples (if saliva was collected by Oragene collector, incubate the entire sample in the original vial at 50 ◦ C for 2 h in an air incubator). 2. Add 180 µL Buffer RPL and 1 µL Spike-in into a 1.5-mL microcentrifuge tube 3. Transfer 600 µL saliva into the 1.5 mL microcentrifuge tube with the buffer and spike-in. Close the tube caps and vortex for > 5 s. Leave at room temperature for 3 min. 4. Add 60 µL Buffer RPP. Close the tube caps and mix vigorously by vortexing for >20 s. Incubate at room temperature for 3 min. 5. Centrifuge at 1200× g for 3 min at room temperature to pellet the precipitate. (Super- natant should be clear and colorless). 6. Transfer supernatant to a new microcentrifuge tube. Add 1 volume of isopropanol. Mix well by vortexing. 7. Transfer the entire sample to an RNeasy UCP MinElute column. Close the lid, and centrifuge for 15 s at ≥8000× g. Discard the flow-through. 8. Add 350 µL Buffer RWT (prepared with isopropanol) to the RNeasy UCP MinElute spin column. Close the lid gently, and centrifuge for 15 s at ≥8000× g to wash the membrane. Discard the flow-through. Reuse the collection tube in the next step. 9. Add 10 µL DNase I stock solution to 70 µL Buffer RDD. Mix by gently inverting the tube, and centrifuge briefly to collect residual liquid form the sides of the tube. 10. Add 80 µL of the DNase I incubation mix directly to the RNeasy UCP MinElute spin column membrane, and place on the benchtop (20–30 ◦ C) for 15 min. 11. Add 500 µL Buffer RWT (prepared with isopropanol) to the RNeasy UCP MinElute spin column. Close the lid gently, and centrifuge for 15 s at ≥8000× g. Save the flow-through for use in step the next step. 12. Place the spin column in a new 2-mL collection tube. Apply the flow-through saved in the previous step to the spin column. Centrifuge for 15 s at ≥8000× g. Discard the flow-through. Reuse the collection tube in the next step. 13. Pipet 500 µL Buffer RPE onto the RNeasy UCP MinElute spin column. Close the lid, and centrifuge for 15 s at ≥8000× g. Discard the flow-through. Reuse the collection tube in the next step. Int. J. Mol. Sci. 2023, 24, 2386 18 of 20 14. Add 500 µL of 80% ethanol to the RNeasy UCP MinElute spin column. Close the lid gently, and centrifuge for 2 min at ≥8000× g to wash the spin column membrane. Discard the flow-through. After centrifuge, remove the RNeasy UCP MinElute spin column from the collection tube so that the column does not contact the flow-through. 15. Place the RNeasy UCP MinElute spin column in a new 2-mL collection tube. Open the lid of the spin column and centrifuge at full speed for 5 min to dry the membrane. Discard the flow-through and the collection tube. 16. Place the RNeasy UCP MinElute spin column in a new 1.5 mL collection tube. Add 20 µL of pre-heated (60 ◦ C) RNase-free water directly to the center of the spin column membrane and incubate 1min. Close the lid, and centrifuge for 1 min at full speed to elute the RNA. 17. Store collected miRNA at −20 ◦ C. miRNA isolation using NucleoSpin®® miRNA Plasma 1. Thaw the frozen samples (if saliva was collected by Oragene collector, incubate the entire sample in the original vial at 50 ◦ C for 2 h in an air incubator). 2. Add 270 µL Buffer MLP and 1 µL Spike-in into a 1.5 mL microcentrifuge tube. 3. Add 900 µL saliva sample and vortex for 5 s. Incubate for 3 min at room temperature. 4. Add 90 µL Buffer MPP and vortex for 5 s. Incubate for 1 min at room temperature. Centrifuge for 3 min at 11,000× g to pellet the protein. 5. Transfer the clear supernatant to two new collection tubes (approx. 600 µL per each tube). 6. Add 1200 µL isopropanol (600 µL per each tube) and vortex for 5 s. 7. Place a NucleoSpin®® miRNA Column into a collection tube and load the sample onto the column. 8. Incubate for 2 min at room temperature and centrifuge for 30 s at 11,000× g. Discard the flow-through and place the column back into the collection tube. Repeat this step until all sample is loaded onto the column. 9. Add 700 µL Buffer MW2 to the NucleSpin®® miRNA Column. Centrifuge for 30 s at 11,000× g. Discard flow-through and place the column back into the collection tube. 10. Add 250 µL Buffer MW2 to the NucleSpin®® miRNA Column. Centrifuge for 2 min at 11,000× g. It is not necessary to discard the flow-through. 11. Add 50 µL rDNase (previously dissolved in Reaction Buffer) directly onto the silica membrane of the NucleSpin®® miRNA Column. Close the lid and incubate at room temperature for 15 min. 12. Add 100 µL Buffer MW1 to the NucleSpin®® miRNA Column. Centrifuge for 30 s at 11,000× g. Discard flow-through and place the column back into the collection tube. 13. Add 700 µL Buffer MW2 to the NucleSpin®® miRNA Column. Centrifuge for 30 s at 11,000× g. Discard flow-through and place the column back into the collection tube. 14. Add 250 µL Buffer MW2 to the NucleSpin®® miRNA Column. Centrifuge for 2 min at 11,000× g to dry the membrane completely. 15. Place the NucleSpin®® miRNA Column in a new collection tube. Add 20 µL of pre-heated (60 ◦ C) RNase-free H2O directly onto the silica membrane of the column. Incubate for 1 min at room temperature. Close the lid and centrifuge for 1 min at 11,000× g. 16. Store collected miRNA at −20 ◦ C. References 1. O’Brien, J.; Hayder, H.; Zayed, Y.; Peng, C. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front. Endocrinol. 2018, 9, 402. [CrossRef] [PubMed] 2. Condrat, C.E.; Thompson, D.C.; Barbu, M.G.; Bugnar, O.L.; Boboc, A.; Cretoiu, D.; Suciu, N.; Cretoiu, S.M.; Voinea, S.C. miRNAs as Biomarkers in Disease: Latest Findings Regarding Their Role in Diagnosis and Prognosis. Cells 2020, 9, 276. [CrossRef] [PubMed] 3. Li, S.; Lei, Z.; Sun, T. The role of microRNAs in neurodegenerative diseases: A review. Cell Biol. Toxicol. 2022, 31, 1–31, ahead of print. [CrossRef] [PubMed] Int. J. Mol. Sci. 2023, 24, 2386 19 of 20 4. Kinser, H.E.; Pincus, Z. MicroRNAs as modulators of longevity and the aging process. Hum. Genet. 2020, 139, 291–308. [CrossRef] 5. Lehallier, B.; Gate, D.; Schaum, N.; Nanasi, T.; Lee, S.E.; Yousef, H.; Moran Losada, P.; Berdnik, D.; Keller, A.; Verghese, J.; et al. Undulating changes in human plasma proteome profiles across the lifespan. Nat. Med. 2019, 25, 1843–1850. [CrossRef] 6. Noren Hooten, N.; Abdelmohsen, K.; Gorospe, M.; Ejiogu, N.; Zonderman, A.B.; Evans, M.K. microRNA expression patterns reveal differential expression of target genes with age. PLoS ONE 2010, 5, e10724. [CrossRef] 7. Heegaard, N.H.; Carlsen, A.L.; Lilje, B.; Ng, K.L.; Rønne, M.E.; Jørgensen, H.L.; Sennels, H.; Fahrenkrug, J. Diurnal Variations of Human Circulating Cell-Free Micro-RNA. PLoS ONE 2016, 11, e0160577. [CrossRef] 8. Hicks, S.D.; Khurana, N.; Williams, J.; Dowd Greene, C.; Uhlig, R.; Middleton, F.A. Diurnal oscillations in human salivary microRNA and microbial transcription: Implications for human health and disease. PLoS ONE 2018, 13, e0198288. [CrossRef] 9. Figueredo Dde, S.; Barbosa, M.R.; Gitaí, D.L.; de Andrade, T.G. Predicted microRNAs for mammalian circadian rhythms. J. Biol. Rhythm. 2013, 28, 107–116. [CrossRef] 10. Li, F.; Bai, M.; Xu, J.; Zhu, L.; Liu, C.; Duan, R. Long-Term Exercise Alters the Profiles of Circulating Micro-RNAs in the Plasma of Young Women. Front. Physiol. 2020, 11, 372. [CrossRef] 11. Silva, F.C.D.; Iop, R.D.R.; Andrade, A.; Costa, V.P.; Gutierres Filho, P.J.B.; Silva, R.D. Effects of Physical Exercise on the Expression of MicroRNAs: A Systematic Review. J. Strength Cond. Res. 2020, 34, 270–280. [CrossRef] 12. Barrio, E.; Quirós, A.; Lerma-Puertas, D.; Labarta, J.I.; Gascón-Catalán, A. Identification of miRNAs Involved in Foetal Growth Restriction Due to Maternal Smoking during Pregnancy. J. Clin. Med. 2022, 11, 5808. [CrossRef] 13. Ostheim, P.; Tichý, A.; Sirak, I.; Davidkova, M.; Stastna, M.M.; Kultova, G.; Paunesku, T.; Woloschak, G.; Majewski, M.; Port, M.; et al. Overcoming challenges in human saliva gene expression measurements. Sci. Rep. 2020, 10, 11147. [CrossRef] 14. Ostheim, P.; Alemu, S.W.; Tichý, A.; Sirak, I.; Davidkova, M.; Stastna, M.M.; Kultova, G.; Schuele, S.; Paunesku, T.; Woloschak, G.; et al. Examining potential confounding factors in gene expression analysis of human saliva and identifying potential housekeeping genes. Sci. Rep. 2022, 12, 2312. [CrossRef] 15. Wang, J.; Schipper, H.M.; Velly, A.M.; Mohit, S.; Gornitsky, M. Salivary biomarkers of oxidative stress: A critical review. Free Radic. Biol. Med. 2015, 85, 95–104. [CrossRef] 16. Roi, A.; Rusu, L.C.; Roi, C.I.; Luca, R.E.; Boia, S.; Munteanu, R.I. A New Approach for the Diagnosis of Systemic and Oral Diseases Based on Salivary Biomolecules. Dis. Mrk. 2019, 2019, 8761860. [CrossRef] 17. Cressatti, M.; Juwara, L.; Galindez, J.M.; Velly, A.M.; Nkurunziza, E.S.; Marier, S.; Canie, O.; Gornistky, M.; Schipper, H.M. Salivary microR-153 and microR-223 Levels as Potential Diagnostic Biomarkers of Idiopathic Parkinson’s Disease. Mov. Disord. 2020, 35, 468–477. [CrossRef] 18. Ogawa, Y.; Taketomi, Y.; Murakami, M.; Tsujimoto, M.; Yanoshita, R. Small RNA transcriptomes of two types of exosomes in human whole saliva determined by next generation sequencing. Biol. Pharm. Bull. 2013, 36, 66–75. [CrossRef] 19. Keller, S.; Ridinger, J.; Rupp, A.K.; Janssen, J.W.; Altevogt, P. Body fluid derived exosomes as a novel template for clinical diagnostics. J. Transl. Med. 2011, 9, 86. [CrossRef] 20. Luedemann, C.; Reinersmann, J.L.; Klinger, C.; Degener, S.; Dreger, N.M.; Roth, S.; Kaufmann, M.; Savelsbergh, A. Prostate Cancer-Associated miRNAs in Saliva: First Steps to an Easily Accessible and Reliable Screening Tool. Biomolecules 2022, 12, 1366. [CrossRef] 21. Hicks, S.D.; Carpenter, R.L.; Wagner, K.E.; Pauley, R.; Barros, M.; Tierney-Aves, C.; Barns, S.; Greene, C.D.; Middle- ton, F.A. Saliva MicroRNA Differentiates Children with Autism From Peers With Typical and Atypical Development. J. Am. Acad. Child Adolesc. Psychiatry 2020, 59, 296–308. [CrossRef] [PubMed] 22. Sullivan, R.; Montgomery, A.; Scipioni, A.; Jhaveri, P.; Schmidt, A.T.; Hicks, S.D. Confounding Factors Impacting microRNA Expression in Human Saliva: Methodological and Biological Considerations. Genes 2022, 13, 1874. [CrossRef] [PubMed] 23. Patel, R.S.; Jakymiw, A.; Yao, B.; Pauley, B.A.; Carcamo, W.C.; Katz, J.; Cheng, J.Q.; Chan, E.K. High resolution of microRNA signatures in human whole saliva. Arch. Oral. Biol. 2011, 56, 1506–1513. [CrossRef] [PubMed] 24. Prinz, F.; Schlange, T.; Asadullah, K. Believe it or not: How much can we rely on published data on potential drug targets? Nature reviews. Drug. Discov. 2011, 10, 712. [CrossRef] [PubMed] 25. Errington, T.M.; Mathur, M.; Soderberg, C.K.; Denis, A.; Perfito, N.; Iorns, E.; Nosek, B.A. Investigating the replicability of preclinical cancer biology. eLife 2021, 10, e71601. [CrossRef] 26. Baker, M. 1500 scientists lift the lid on reproducibility. Nature 2016, 533, 452–454. [CrossRef] 27. Kabitzke, P.; Cheng, K.M.; Altevogt, B. Guidelines and Initiatives for Good Research Practice. In Good Research Practice in Non-Clinical Pharmacology and Biomedicine, 1st ed.; Bespalov, A., Michel, M.C., Steckler, T., Eds.; Springer: Cham, Switzerland; Berlin/Heidelberg, Germany, 2020; Volume 257, pp. 19–34. 28. Schwab, S.; Janiaud, P.; Dayan, M.; Amrhein, V.; Panczak, R.; Palagi, P.M.; Hemkens, L.G.; Ramon, M.; Rothen, N.; Senn, S. Ten simple rules for good research practice. PLoS Comput. Biol. 2022, 18, e1010139. [CrossRef] 29. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [CrossRef] 30. Sullivan, R.; Heavey, S.; Graham, D.G.; Wellman, R.; Khan, S.; Thrumurthy, S.; Simpson, B.S.; Baker, T.; Jevons, S.; Ariza, J.; et al. An zoptimized saliva collection method to produce high-yield, high-quality RNA for translational research. PLoS ONE 2020, 15, e0229791. [CrossRef] Int. J. Mol. Sci. 2023, 24, 2386 20 of 20 31. Gandhi, V.; O’Brien, M.H.; Yadav, S. High-Quality and High-Yield RNA Extraction Method from Whole Human Saliva. Biomark. Insights 2020, 15, 1177271920929705. [CrossRef] 32. Gallo, A.; Tandon, M.; Alevizos, I.; Illei, G.G. The majority of microRNAs detectable in serum and saliva is concentrated in exosomes. PLoS ONE 2012, 7, e30679. [CrossRef] 33. Dewhirst, F.E.; Chen, T.; Izard, J.; Paster, B.J.; Tanner, A.C.; Yu, W.H.; Lakshmanan, A.; Wade, W.G. The human oral microbiome. J. Bacteriol. 2010, 192, 5002–5017. [CrossRef] 34. Marsh, P.D.; Do, T.; Beighton, D.; Devine, D.A. Influence of saliva on the oral microbiota. Periodontology 2000 2016, 70, 80–92. [CrossRef] 35. Lim, Y.; Totsika, M.; Morrison, M.; Punyadeera, C. The saliva microbiome profiles are minimally affected by collection method or DNA extraction protocols. Sci. Rep. 2017, 7, 8523. [CrossRef] 36. Park, N.J.; Zhou, H.; Elashoff, D.; Henson, B.S.; Kastratovic, D.A.; Abemayor, E.; Wong, D.T. Salivary microRNA: Discovery, characterisation, and clinical utility for oral cancer detection. Clin. Cancer Res. 2009, 15, 5473–5477. [CrossRef] 37. Martinez, B.; Peplow, P.V. MicroRNAs in Parkinson’s disease and emerging therapeutic targets. Neural. Regen. Res. 2017, 12, 1945–1959. Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.