The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein
Abella Rusiñol, Marc (Institut de Recerca i Tecnologia Agroalimentàries. Centre de Recerca en Sanitat Animal)
Rodríguez, Sonia (Institut de Recerca i Tecnologia Agroalimentàries. Centre de Recerca en Sanitat Animal)
Paytubi, Sonia (Institut de Recerca i Tecnologia Agroalimentàries. Centre de Recerca en Sanitat Animal)
Campoy Sánchez, Susana (Universitat Autònoma de Barcelona. Departament de Genètica i de Microbiologia)
White, Malcolm F. (Institut de Recerca i Tecnologia Agroalimentàries. Centre de Recerca en Sanitat Animal)
Barbé García, Jordi (Universitat Autònoma de Barcelona. Departament de Genètica i de Microbiologia)

Data:	2007
Resum:	Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.
Drets:	Aquest document està subjecte a una llicència d'ús Creative Commons. Es permet la reproducció total o parcial, la distribució, la comunicació pública de l'obra i la creació d'obres derivades, fins i tot amb finalitats comercials, sempre i quan aquestes es distribueixin sota la mateixa llicència que regula l'obra original i es reconegui l'autoria de l'obra original.
Llengua:	Anglès
Document:	Article ; recerca ; Versió publicada
Publicat a:	Nucleic acids research, Vol. 35 (10 2007) , p. 6788-6797, ISSN 1362-4962

DOI: 10.1093/nar/gkm782
PMID: 17921500

10 p, 411.8 KB

El registre apareix a les col·leccions:
Documents de recerca > Documents dels grups de recerca de la UAB > Centres i grups de recerca (producció científica) > Ciències de la salut i biociències > Centre de Recerca en Sanitat Animal (CReSA-IRTA)
Articles > Articles de recerca
Articles > Articles publicats