The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein
Abella Rusiñol, Marc (Institut de Recerca i Tecnologia Agroalimentàries. Centre de Recerca en Sanitat Animal)
Rodríguez, Sonia (Institut de Recerca i Tecnologia Agroalimentàries. Centre de Recerca en Sanitat Animal)
Paytubi, Sonia (Institut de Recerca i Tecnologia Agroalimentàries. Centre de Recerca en Sanitat Animal)
Campoy Sánchez, Susana 
(Universitat Autònoma de Barcelona. Departament de Genètica i de Microbiologia)
White, Malcolm F. (Institut de Recerca i Tecnologia Agroalimentàries. Centre de Recerca en Sanitat Animal)
Barbé García, Jordi 
(Universitat Autònoma de Barcelona. Departament de Genètica i de Microbiologia)
| Fecha: |
2007 |
| Resumen: |
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression. |
| Derechos: |
Aquest document està subjecte a una llicència d'ús Creative Commons. Es permet la reproducció total o parcial, la distribució, la comunicació pública de l'obra i la creació d'obres derivades, sempre i quan aquestes es distribueixin sota la mateixa llicència que regula l'obra original i es reconegui l'autoria.  |
| Lengua: |
Anglès |
| Documento: |
Article ; recerca ; Versió publicada |
| Publicado en: |
Nucleic acids research, Vol. 35 (10 2007) , p. 6788-6797, ISSN 0305-1048 |
DOI: 10.1093/nar/gkm782
PMID: 17921500
El registro aparece en las colecciones:
Documentos de investigación >
Documentos de los grupos de investigación de la UAB >
Centros y grupos de investigación (producción científica) >
Ciencias de la salud y biociencias >
Centre de Recerca en Sanitat Animal (CReSA-IRTA)Artículos >
Artículos de investigaciónArtículos >
Artículos publicados
Registro creado el 2017-12-20, última modificación el 2026-03-04